Received 19 July 1995/Accepted 11 October 1995

Transcription

1 JOURNAL OF VIROLOGY, Feb. 1996, p Vol. 70, No X/96/$ Copyright 1996, American Society for Microbiology PCR-In Situ Hybridization Detection of Human T-Cell Lymphotropic Virus Type 1 (HTLV-1) tax Proviral DNA in Peripheral Blood Lymphocytes of Patients with HTLV-1-Associated Neurologic Disease MICHAEL C. LEVIN, 1 * ROBERT J. FOX, 1 TANYA LEHKY, 1 MATTHEW WALTER, 1 CECIL H. FOX, 2 NICHOLAS FLERLAGE, 1 RICHARD BAMFORD, 3 AND STEVEN JACOBSON 1 Neuroimmunology Branch, National Institute of Neurological Diseases and Stroke 1 and National Cancer Institute, 3 Bethesda, Maryland 20892, and Molecular Histology Laboratories, Gaithersburg, Maryland Received 19 July 1995/Accepted 11 October 1995 PCR-in situ hybridization (PCR-ISH) was developed and utilized to determine the distribution of human T-cell lymphotropic virus type 1 (HTLV-1) tax proviral DNA in peripheral blood lymphocytes (PBL) from patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). PCR-ISH of HTLV-1 tax DNA in PBL from patients with HAM/TSP revealed that 1 in 5,000 to 1 in 10,000 PBL contained virus. PCR-ISH was sensitive, because a positive signal was consistently demonstrated from the HTLV-1-infected cell lines HUT-102 (which contains four to six copies of HTLV-1 proviral DNA per cell) and MT-1 (which contains one to three copies of HTLV-1 proviral DNA per cell). Also, intracellular amplification by PCR-ISH significantly increased sensitivity compared with conventional ISH and was shown to be specific for HTLV-1 tax DNA. These results are in contrast to solution-phase PCR amplification in which greater than 1% of cells were estimated to be infected. The discordance between these results is discussed and may indicate that more than one copy of HTLV-1 tax proviral DNA is present in an individual PBL. Human T-cell lymphotropic virus type 1 (HTLV-1), a virus endemic in certain regions of Japan, the Caribbean, and Africa, is associated with a number of human diseases, most notably adult T-cell leukemia and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) (3, 12, 28, 35 37, 45). How HTLV-1 infection results in human disease is being extensively studied. Only 1 to 5% of infected individuals develop clinical disease, the remainder being asymptomatic carriers of the virus. In HAM/TSP, a chronic progressive neurologic disorder of the central nervous system, studies have focused on a number of possible differences between the diseased and the asymptomatic states. These include analysis of virus strain (6, 32), human histocompatibility leukocyte antigen (HLA) (42), viral load (10, 11, 22, 25, 38, 46), and immune function (15, 17, 18, 21, 23, 30). To date, molecular analysis of HTLV-1 sequences from patients with HAM/TSP and from asymptomatic carriers has revealed minimal differences (6, 32). HLA studies have demonstrated a disease association with particular alleles of patients with HAM/TSP in Japan (42). Patients with HAM/TSP have been shown to have an activated cellular immune response. Specifically, there is an increase in the number of large CD3 cells that express T-cell activation markers such as HLA-DR and interleukin-2 receptor molecules (18, 21). Further evidence of activation is shown by the ability of peripheral blood lymphocytes (PBL) from patients with HAM/TSP to spontaneously proliferate in vitro in the absence of exogenously added antigen (17, 18, 21). In addition, elevated antibody titers to HTLV-1 (35, 36) and increased levels of HTLV-1-specific CD8 cytotoxic T lymphocytes have been demonstrated in blood and cerebrospinal fluid from patients with HAM/TSP * Corresponding author. Mailing address: Neuroimmunology Branch, NINDS, NIH, Building 10, Room 5B-16, 9000 Rockville Pike, Bethesda, MD Phone: (301) Fax: (301) (19, 20). In central nervous system tissue from HAM/TSP autopsies, CD8 T cells have been localized (29) and HTLV-1 tax RNA has been colocalized to glial fibrillary acidic proteinpositive astrocytes (26). Although these immune abnormalities are overrepresented in patients with HAM/TSP, they can occur to a lesser degree in asymptomatic HTLV-1-infected individuals. Therefore, it has been suggested that an increased HTLV-1 viral load may be involved in the immunopathogenesis of HAM/TSP. Several studies have shown an increased HTLV-1 proviral DNA load in PBL of patients with HAM/TSP compared with that of asymptomatic HTLV-1-infected individuals (10, 11, 22, 25, 38, 46). Estimates of PBL viral load indicate that between 1 and 15% of PBL may be infected (10, 11, 22, 25, 38, 46). These investigators utilized a combination of PCR and Southern hybridization to assess HTLV-1 proviral load and assumed that only a single copy of HTLV-1 integrates into each cell. The predominant cell type containing HTLV-1 proviral DNA was shown to be the CD4 T cell isolated from a patient s PBL (38), although a thorough evaluation of other tissues of the immune system has yet to be performed. Interestingly, estimates of HIV infection in PBL of patients with AIDS are similar (39). This level of infection may be important to disease pathogenesis, since a high viral load may drive antigen-specific immunopathogenic mechanisms suggested to be operative in patients with HAM/TSP (16). The association of an increased viral load with disease pathogenesis is consistent with the observation that patients with HAM/TSP who acquired HTLV-1 infection from contaminated blood transfusions have a dramatic decrease in latency from time of infection to the onset of disease (13, 34). Also, patients experiencing the onset of myelopathy at a younger age may have an increased HTLV-1 proviral load (22). The purpose of this study was to develop and utilize PCR-in situ hybridization (PCR-ISH) (1, 7, 8, 14, 24, 27, 33) to directly 924

2 VOL. 70, 1996 PCR-ISH IN HTLV-1-RELATED DISEASES 925 Downloaded from FIG. 1. Autoradiograms of HUT-102 cells after ISH and PCR-ISH (bright-field microscopy; hematoxylin and eosin counterstain; magnification, 400). (a) ISH for HTLV-1 tax RNA with an antisense 35 S-HTLV-1 tax probe. Intense signal localization in all cells. (b) ISH for HTLV-1 tax DNA with a sense 35 S-HTLV-1 tax probe. Minimal signal localization within cells compared with background. (c) PCR of HTLV-1 tax DNA, excluding Taq polymerase from the PCR cocktail, and ISH detection of amplified DNA (PCR-ISH) with the sense HTLV-1 tax probe. Signal is similar to that shown in panel b. (d) PCR-ISH of HTLV-1 tax DNA with complete PCR cocktail and detection of amplified DNA with the sense HTLV-1 tax probe. Intense signal localization in all cells. (e) PCR-ISH of HTLV-1 tax DNA, excluding tax-specific primers from the PCR cocktail, and detection of the amplified DNA with the sense HTLV-1 tax probe. Minimal signal localized to cells. (f) PCR-ISH of HTLV-1 tax DNA with complete PCR cocktail and ISH detection of amplified DNA with a 35 S-nonsense probe. Minimal signal localized to cells. on September 26, 2018 by guest visualize the presence of HTLV-1 proviral DNA in PBL from patients with HAM/TSP. The advantage of conventional ISHbased techniques over solution-phase analysis of cell lysates is that it allows for the in situ visualization of signal. However, utilizing ISH for retroviral studies can be problematic because it is a relatively insensitive technique, requiring a minimum of 15 to 20 copies of template for consistent signal detection (33). Moreover, most conventional ISH techniques are designed to favor the detection of RNA over DNA. Both issues are critical, because retroviruses may be present only in a latent proviral DNA form (14) and potentially may integrate only a single copy into a cell s genome. By performing PCR on whole cells adhered to slides and detecting PCR products with specific crna probes, we were able to significantly increase sensitivity

3 926 LEVIN ET AL. J. VIROL. Downloaded from FIG. 2. Autoradiograms of MT-1 cells after ISH and PCR-ISH (bright-field microscopy; hematoxylin and eosin counterstain; magnification, 400). (a) ISH for HTLV-1 tax RNA with the antisense 35 S-HTLV-1 tax probe. Approximately 5% of the cells are positive (arrows). (b) ISH for HTLV-1 tax DNA with the sense 35 S-HTLV-1 tax probe. Minimal signal localization within cells compared with background. (c) PCR-ISH, excluding Taq polymerase from the PCR cocktail, and detection of amplified DNA with the sense HTLV-1 tax probe. Signal is similar to that seen in panel b. (d) PCR-ISH of HTLV-1 tax DNA, with complete PCR cocktail, and detection of amplified DNA with the sense HTLV-1 tax probe. Intense signal localization in all cells. while maintaining the ability to evaluate data by direct in situ visualization. Surprisingly, with this technique our in situ data revealed a lower number of infected cells in comparison to solution-phase estimates of viral load. MATERIALS AND METHODS Patients. Three patients with HAM/TSP were admitted to the Neuroimmunology Clinical Service at the National Institutes of Health. All patients fulfilled the clinical criteria for HAM/TSP as defined by the World Health Organization and current literature (16). All patients were HTLV-1 seropositive by Western immunoblot analysis (HTLV-Blot 2.3 kit; Diagnostic Biotechnology) and showed spontaneous lymphoproliferation (21) and positive HTLV-1-specific cytotoxic T-lymphocyte activity. Presence of HTLV-1 tax DNA from PBL was confirmed by PCR and Southern hybridization. All patients were human immunodeficiency virus seronegative. Cell lines. HTLV-1-infected cell lines HUT-102 and MT-1 were maintained with RPMI 1640 medium (Gibco Laboratories, Grand Rapids, N.Y.) containing 15% fetal calf serum, 1% glutamine, and 1% (each) penicillin and streptomycin in a humidified incubator (37 C in5%co 2 ). PBL. PBL from patients (uninfected and HAM/TSP) were separated from heparinized whole blood by using Ficoll-based lymphocyte separation medium (LSM; Organon Teknika Corp., Durham, N.C.). Cells were used immediately or stored in liquid nitrogen. Cell clot preparation. For both PCR-ISH and ISH, cell suspension clots were utilized as previously described (5, 44). Briefly, 10 6 to 10 7 cells were pelleted and mixed in 75 l of uninfected human plasma followed by 75 l of thrombin (Sigma) which resulted in clot formation. Clots were fixed in paraformaldehyde (4% in Dulbecco s phosphate-buffered saline, ph 7.4) for 24 to 48 h, embedded in paraffin, sectioned at 5 m, and mounted on silane-treated slides. Primers and probes. Primers designed to amplify a 377-bp region of HTLV-1 tax DNA were 5 -CAACCCTGTCTTTTCCAGACCC (bases 7706 to 7727 of the HTLV-1 genome) and 3 -CGTGCCATCGGTAAATGTCC (bases 8082 to 8063, primer set 1) (40). Some experiments utilized multiple overlapping primer sets (14) which, in addition to the primer set above, included the following pairs: 5 -TTTCGCCTTCTCAGCCCCTT (bases 6863 to 6882) and 3 -TGCTGGTG GAGGAATTGGTGGA (bases 7251 to 7230) (389 bp, primer set 2), 5 - GCAAACCGTCAAGCACAGCTTC (bases 7162 to 7183) and 3 -AGGG GAGTCGAGGGATAAGGAA (bases 7549 to 7528) (388 bp, primer set 3), and 5 -TCCAGAGCATCAGATCACCTGG (bases 7467 to 7488) and 3 -TACAT GCAGACAACGGAGCCTC (bases 7784 to 7763) (318 bp, primer set 4). For actin, primers amplified a 323-bp region of the human -actin gene (31): 5 - TGTGACATGGTGCATCTCTGCC (bases 2001 to 2022) and 3 -CGACG TAGCACAGCTTCTCCTT (bases 2323 to 2302). Specificity of primers was confirmed by solution-phase PCR as described previously (41), and final product was confirmed by Southern hybridization (one example, using primer set 1 is shown in Fig. 7). Also, to confirm that amplification occurred during each PCR-ISH experiment, a solution-phase PCR sample was run in parallel with PCR-ISH slides in the thermocycling oven. Amplified product was separated on 1% agarose gels containing ethidium bromide, and the molecular weight of the expected product was confirmed by UV light exposure. 35 S-labeled crna probes ( 35 S-[dCTP; dpm/ l) (transcribed from plasmids) that overlapped the amplified region of DNA were utilized for ISH. The tax probe is a 2.1-kb clone of HTLV-1 tax RNA, which when transcribed in the antisense configuration was utilized for RNA detection and in the sense configuration was used for DNA detection. The actin probe is a 525-bp clone of human -actin RNA. The nonsense probe was a transcription of the Promega Gemini positive control template (Promega part P2121). All probes were alkaline hydrolyzed so that the final molecular size averaged 350 bp. Hybridization conditions and specificities of the probes were as reported previously (26, 44). Specimen preparation. Slides were deparaffinized in xylene (once for 10 min and three times for 5 min), rinsed in 100% ethanol (5 min) and then in 50% ethanol (5 min), and rehydrated in Tris-HCl (0.1 M, ph 7.4, 10 min). This was on September 26, 2018 by guest

4 VOL. 70, 1996 PCR-ISH IN HTLV-1-RELATED DISEASES 927 Downloaded from FIG. 3. Autoradiograms of uninfected PBL after ISH and PCR-ISH (bright-field microscopy; hematoxylin and eosin counterstain; magnification, 400). (a) ISH for HTLV-1 tax RNA with the antisense 35 S-HTLV-1 tax probe. (b) ISH for HTLV-1 tax DNA with the sense HTLV-1 tax probe. (c) PCR-ISH, excluding Taq polymerase from the PCR cocktail, and detection of amplified DNA with the sense HTLV-1 tax probe. (d) PCR-ISH of HTLV-1 tax DNA, with complete PCR cocktail, and detection of amplified DNA with the sense HTLV-1 tax probe. Minimal signal under all conditions. followed by permeabilization in Tween 20-Nonidet P-40 (0.3% in 0.1 M Tris-HCl for 10 min) and proteinase K (10 g/ml, ph 8.0, at 37 C for 2 to 10 min). Slides were then rinsed in Tris (three times for 5 min), dehydrated in graded ethanol, and air dried. Slides on which ISH alone was performed were stored at 4 C. Slides destined for PCR-ISH were capped with Gene Cones (Gene Tec Corp., Durham, N.C.), per the manufacturer s instructions, and allowed to set for 1 to 24 h at room temperature. Optimization of PCR amplification from each individual paraffin-embedded cell block was determined by evaluating cell morphology and PCR-ISH signal to background ratio under various levels of exposure to proteinase K. Cell blocks required 2 to 10 min of exposure to proteinase K (10 g/ml, ph 8.0, 37 C). One example of the importance of proper permeabilization on the PCR-ISH signal is shown in Fig. 4c. PCR. PCR was performed on slides in a thermocycling oven (Biooven III, Biotherm Corporation). The PCR cocktail (80 l per slide) contained 1 M each primer, 200 M each deoxynucleoside triphosphate, 4.4 U of Taq polymerase (Boehringer Mannheim), 50 mm KCl, 1.5 mm MgCl 2, 0.01% gelatin, and 0.02% Nonidet P-40 in 10 mm Tris-HCl, ph 8.3. A Taq/primer ratio of to worked best for PCR-ISH (4). The following formula was used to calculate the ratio (solve for X): Taq/primer ratio (X l oftaq) (5UofTaq/ l)/(total volume in microliters) (total primer concentration in picomoles per microliter) (4). A modified hot start (33) method was utilized in which slides and PCR cocktail were warmed to 70 C for 5 min and 80 l of the warmed cocktail was pipetted into the Gene Cone, sealed, and replaced in the oven. Cycling conditions were one cycle at 92 C for 2 min, 53 C for 1.25 min, and 70 C for 2 min; 30 cycles of 90 C for 1 min, 53 C for 1.25 min, and 70 C for 2 min; one cycle at 70 C for 8 min and a 4 C soak. After PCR, Gene Cones were removed and slides were placed in chloroform (5 min) to remove residual adhesive and rinsed in 100% ethanol (5 min). Slides were rehydrated in phosphate-buffered saline (PBS) (two times for 5 min), dipped in 2% gelatin, and postfixed in 10% glutaraldehyde (20 min [Fluka]) to retain intracellular nucleic acid products. Slides were dehydrated in 0.3 M ammonium acetate-ethanol, air dried, and stored at 4 C until ISH. ISH. Parts of the ISH protocol have been described previously (9, 26, 44). Briefly, slides were rehydrated in 10 mm dithiothreitol (DTT) in PBS (30 min at 45 C), followed by 10 mm DTT 10 mm iodoacetamide 10 mm N-methyl maleimide in PBS (10 min at room temperature). Slides were rinsed in PBS (two times for 3 min), acetylated (0.5% acetic anhydride in 0.1 M triethanolamine, ph 8.0, for 10 min), and rinsed in 2 SSC (1 SSC is 0.15 M NaCl plus M sodium citrate) (10 min). Twenty-five microliters of prehybridization cocktail (2 SSC, 1 Denhardt s, 50 mm phosphate buffer, 50 mm DTT, 500 g of salmon sperm DNA per l, 250 g of trna per l, 5 g of poly(da) per ml, 100 g of poly(a) per ml, 0.05 pmol of randomer per ml, 57% dextran/formamide) was applied to individual slides, which were coverslipped, incubated at room temperature for 1 h, heat denatured at 80 C for 2 min, and submersed in ice-cold 2 SSC. Slides were removed from the ice bath; 35 S-labeled crna probe was applied, coverslipped, placed in a sealed humidified chamber, and incubated at 45 C overnight (hybridization cocktail contained 0.08 l of probe per l of prehybridization cocktail). Coverslips were removed, and slides were rinsed three times in 2 SSC (5 min each at room temperature). Slides were then incubated in 76% formamide 0.25 SSC 1.2 mm DTT 0.5 mm EDTA (two times for 30 min at 37 C), 0.25 SSC (10 min at 37 C), and RNase (RNase A, 25 g/ml; RNase T 1, 5 U/ml) in 0.5 M NaCl 1.2 mm DTT 0.01 M Tris-HCl (ph 7.4) for 40 min at 37 C. Slides were rinsed in 2 SSC (two times for 5 min), dehydrated through graded 0.3 M ammonium acetate-ethanol, and air dried. Slides were then dipped in NTB-3 (Kodak) photographic emulsion (45 C), sealed in a lighttight box, and incubated at 4 C for 5 days. Slides were developed at 15 C in D-19 developer (Kodak) for 4 min, followed by fixation (Kodak) for 6 min. Slides were counterstained with hematoxylin and eosin, coverslipped with permount, and evaluated under bright- and dark-field microscopy. Solution-phase PCR. DNA for solution-phase PCR was prepared by suspending cells in the following lysing solution: 0.001% Triton X, % sodium dodecyl sulfate (SDS), 30 g of proteinase K per ml (30 U/mg) in 1 TE (Tris-EDTA). The solution was incubated at 56 C overnight, denatured at 95 C for 15 min, and stored at 20 C until use. Two types of serial dilution experiments were performed. First, DNA was extracted from 10 5 HUT-102 cells and 10 5 PBL from patients with HAM/TSP and diluted serially in 10-fold increments. DNA extracted from 10 5 uninfected PBL was added to each dilution as carrier on September 26, 2018 by guest

5 928 LEVIN ET AL. J. VIROL. FIG. 4. Effect of technical variables on detection of HTLV-1 tax DNA signal by PCR-ISH. Autoradiograms of HUT-102 cells and uninfected PBL (bright-field microscopy; hematoxylin and eosin counterstain; magnification, 400). (a) PCR-ISH of HUT-102 cells for HTLV-1 tax DNA, utilizing multiple overlapping primer sets, and detection of amplified product with the sense 35 S-HTLV-1 tax probe. Intense signal localization in all cells is comparable to that seen with single primer sets (Fig. 1d). (b) PCR-ISH of a 1:8 dilution of HUT-102 cells in uninfected PBL for HTLV-1 tax DNA and detection of amplified DNA with the sense HTLV-1 tax probe. Intense signal localized to infected cells at the proper ratio. (c) PCR-ISH of HUT-102 cells for HTLV-1 tax DNA and detection of amplified product with the sense HTLV-1 tax probe after prolonged exposure to proteinase K. In this case cells were exposed to proteinase K for 10 min compared with 2 min (see Materials and Methods) as shown in Fig. 1d, resulting in a decrease in signal and cellular morphology. (d) PCR-ISH of HUT-102 cells for HTLV-1 tax DNA and detection of amplified DNA with

6 VOL. 70, 1996 PCR-ISH IN HTLV-1-RELATED DISEASES 929 DNA, and PCR was done on each of these samples. Second, 10 5 HUT-102 cells and 10 5 PBL from patients with HAM/TSP were serially diluted (prior to DNA extraction), 10 5 uninfected PBL were added to each dilution as carrier DNA, and each sample was digested with lysing solution. PBL were used from three different patients with HAM/TSP. Cycling conditions and the PCR cocktail components were identical to those for PCR-ISH. Southern hybridization. Ten microliters (from a 100- l PCR sample) of amplified DNA was separated on 1% agarose gels and blotted onto Nylon membranes (Schleicher & Schuell). Membranes were hybridized overnight at 42 C with [ - 32 P]ATP end-labeled oligonucleotide probe (internal to the tax primers, 5 -TTCTACCCGAAGACTGTTTGCCCACC-3 ) in5 SSC, 20 mm sodium phosphate, 10 Denhardt s solution, 7% SDS, and 200 g of sheared salmon sperm DNA per ml. Blots were rinsed twice in 2 SSC; washed for 45 min in 3 SSC, 10 mm sodium phosphate, 10 Denhardt s solution, 5% SDS; and then washed for 45 min in 1 SSC 1% SDS. All washes were at 45 C. Blots were exposed on X-ray film for 1 to 3 days (43). EcoRI restriction enzyme analysis. DNA from HUT-102 and MT-1 cells (10 g each) was digested with EcoRI (Gibco-BRL) for 5 h. Samples were separated on a 0.65% agarose gel at 55 V overnight. The gel was washed in 0.25 N HCl (15 min) for DNA nicking, denatured in 0.25 N NaOH 0.6 M NaCl (two times for 15 min each), and neutralized in 0.25 M Tris (ph 7.4) 0.6 M NaCl (two times for 15 min each). The DNA was then transferred to an Optitran filter (supported nitrocellulose; Schleicher & Schuell) by capillary blotting overnight with 20 SSC. The filter was dried in a vacuum oven (120 min at 80 C) and subsequently prehybridized (60 min at 60 C). (Prehybridization/hybridization solution contained 10% non-fat dried milk, 10% formamide, 1% SDS, 0.5 mg of heparin per ml, 0.2 mg of salmon sperm DNA per ml, 0.9 M NaCl, 2 mm EDTA, and 0.05 M sodium phosphate [ph 7.0].) The filter was then hybridized overnight with random-primed, 32 P-radiolabeled (Amersham kit; RPN 1601y) full-length HTLV-1 provirus ( cpm/ml) at 60 C. The following day, the filter was washed under low-stringency conditions (0.5 M NaCl 1% SDS 0.1 M Tris [ph 7.5], 30 min, 60 C) and then high-stringency conditions (0.1 SSC 0.1% SDS, 30 min, 60 C). The filter was then wrapped in plastic wrap and exposed to XAR-2 film (Kodak) for 6 h and developed. Cell counts. To quantitate the number of cells containing either HTLV-1 tax RNA or DNA in patient PBL, the total number of cells per slide was estimated with the use of an ocular micrometer. The number of cells from three representative fields were counted, and the number of fields per slide was determined. By multiplying the number of cells per field by the number of fields per slide, the total number of cells per slide was calculated. Individual slides contained approximately 10,000 to 20,000 cells per slide. The number of positive cells was counted and divided by the total number of cells per slide to estimate the viral load. Experiments on each of three patients were performed twice. RESULTS ISH and PCR-ISH of HTLV-1-infected cell lines and uninfected PBL. Using conventional ISH, HUT-102 cells (a transformed HTLV-1-infected T-cell line), which contain numerous copies of HTLV-1 RNA, showed intense silver grain localization with the 35 S-HTLV-1 tax probe in the antisense configuration (Fig. 1a). Using the 35 S-HTLV-1 tax probe in the sense configuration to detect DNA, there was minimal grain localization in cells (Fig. 1b). After PCR and detection of amplified DNA with the 35 S-HTLV-1 tax probe in the sense configuration (PCR-ISH), there was intense silver grain localization in all cells (Fig. 1d). As controls, there was minimal signal when Taq polymerase (Fig. 1c) or tax-specific primers (Fig. 1e) were eliminated from the PCR cocktail. In addition, if PCR was performed with all components, but the product was detected with a nonsense probe, no signal was visualized (Fig. 1f). Conventional ISH of the HTLV-1-infected T-cell line MT-1, which contains significantly less HTLV-1 RNA than HUT cells, showed that approximately 5% of cells were positive for HTLV-1 RNA with the HTLV-1 tax antisense probe (Fig. 2a). HTLV-1 DNA using conventional ISH with the HTLV-1 tax sense probe was undetectable (Fig. 2b), but after PCR-ISH, HTLV-1 tax DNA was clearly detectable in every cell (Fig. 2d). FIG. 5. Southern hybridization and detection of HTLV-1 DNA extracted from HUT-102 and MT-1 cells, respectively, after digestion with EcoRI. HUT- 102 cells contain four full-length copies of HTLV-1 proviral DNA (four bands 9.0 kb, a doublet at approximately 17 kb) and two partial copies ( 9.0 kb). MT-1 cells contain one to three full-length copies of HTLV-1 proviral DNA (one at approximately 13 kb, and a less-intense doublet at approximately 19 kb). This signal was not present if Taq polymerase was eliminated from the PCR cocktail (Fig. 2c). As a negative control, uninfected PBL from uninfected HTLV-1-seronegative patients were utilized in parallel to the above studies. Signal was not detected under any conditions (Fig. 3). Results from additional experiments designed to evaluate other technical aspects of PCR-ISH are shown in Fig. 4. Multiple overlapping primer sets (14) did not significantly improve DNA detection compared with that observed with single primer sets (compare Fig. 4a and 1d) and therefore were not utilized in further experiments. When PCR-ISH was performed on a mixture of HUT-102 cells and uninfected PBL at a known ratio, positive signal was only localized over viruscontaining cells in the appropriate ratio (Fig. 4b). Under this condition, there have been reports of leakage, that is, the transfer of target DNA (HTLV-1 in this case) to a neighboring uninfected cell, resulting in a false-positive signal. No such leakage was observed (Fig. 4b). Proteinase K permeabilization was critical for signal detection and signal-to-background ratio by PCR-ISH, as shown when comparing Fig. 4c (proteinase K for 10 min) with Fig. 1d (proteinase K for 2 min). Postamplification fixation was also critical, since prolonged exposure of slides to glutaraldehyde significantly decreased signal (compare Fig. 4d and 1d). Also, if hot-start PCR was not utilized, an elevated background signal in uninfected PBL occasionally occurred (compare Fig. 4e and 3d). Finally, use of a thermocycling oven in conjunction with Gene Cones eliminated the need to encase slides in mineral oil-filled plastic bags and the sense HTLV-1 tax probe after prolonged postamplification fixation in glutaraldehyde (6 h rather than 20 min). There is a significant decrease in signal compared with that seen in Fig. 1d. (e) PCR-ISH of uninfected PBL for HTLV-1 tax DNA and detection of amplified product with the sense HTLV-1 tax probe after inadequate hot start. Increased nonspecific signal is present. (f) PCR-ISH of HUT-102 cells for HTLV-1 tax DNA and detection of amplified product with the sense HTLV-1 tax probe, in a thermocycling oven that required slides to be sealed in individual oil bags. There is decreased and uneven distribution of signal compared with that seen in Fig. 1d.

7 930 LEVIN ET AL. J. VIROL. FIG. 6. Autoradiograms of PBL from patients with HAM/TSP after ISH and PCR-ISH of HTLV-1 tax DNA and human -actin DNA. (Representative fields are shown. Panels on the left and right are bright-field and dark-field microscopy, respectively. Hematoxylin and eosin counterstain; magnification, 400). (a and b) ISH for HTLV-1 tax RNA with the antisense 35 S-HTLV-1 tax probe in PBL from a patient with HAM/TSP. Approximately 1 in 10,000 PBL were positive. (c and d) PCR-ISH of HTLV-1 tax DNA in PBL from a patient with HAM/TSP. Approximately 1 in 5,000 to 1 in 10,000 were positive in three different patients. (e and f) PCR-ISH of human -actin DNA in PBL from a patient with HAM/TSP (performed in parallel with PCR-ISH experiments for HTLV-1 tax DNA). All cells were positive. significantly improved signal. Specifically, signal was better localized and more evenly distributed on the slide (compare Fig. 4f and 1d). Sensitivity of PCR-ISH. To evaluate the sensitivity of PCR- ISH in cells, an estimate of the number of copies of HTLV-1 present in an individual cell needed to be determined. This was done by performing an EcoRI digestion followed by Southern hybridization of the cloned HTLV-1-infected cell lines. Since there are no EcoRI sites (11) within the HTLV-1 DNA genome, the number of bands present on the blots will equal the average number of copies of HTLV-1 proviral DNA in each cell. EcoRI digestion of HUT-102 cells revealed an average of six copies of proviral DNA per cell (Fig. 5). Digestion of MT-1 cells revealed an average of one to three copies per cell (Fig. 5). Since PCR-ISH of HTLV-1 tax DNA was consistently detected in MT-1 cells (Fig. 2d), these data are consistent with

8 VOL. 70, 1996 PCR-ISH IN HTLV-1-RELATED DISEASES 931 FIG. 7. Southern hybridization and detection of HTLV-1 tax DNA after PCR. Extraction of DNA and serial dilution of a single-stock DNA solution of HUT-102 cells (A) and HAM/TSP PBL (B). Serial dilution of HAM/TSP PBL followed by DNA extraction and PCR of each diluted sample (C) (see text). HTLV-1 tax DNA was detectable from DNA of a single HUT cell (A) and 100 HAM/TSP PBL (B) when dilutions were performed after DNA extraction. HTLV-1 tax DNA was detected in 1 in 10,000 HAM/TSP PBL when DNA was extracted after serial dilution of HAM/TSP PBL (C). the ability of PCR-ISH to detect one to two copies of DNA per cell. In addition, PCR-ISH for human -actin DNA, which is present at a level of two copies per diploid cell, was successfully detected in PBL from patients with HAM/TSP (Fig. 6e and f). ISH, PCR-ISH, and solution-phase PCR detection of HTLV-1 tax DNA in PBL of patients with HAM/TSP. We used PCR-ISH to determine the distribution of HTLV-1 tax DNApositive cells in the peripheral blood of patients with HAM/ TSP. It had been reported that between 1% and as many as 10% of PBL from patients with HAM/TSP contained HTLV-1 proviral DNA (10, 11, 22, 25, 38, 46), with low levels of HTLV-1 expression in vivo (2). As expected, conventional ISH analysis of HTLV-1 tax RNA expression in PBL from patients with HAM/TSP showed that approximately 1 in 10,000 cells were positive (Fig. 6a and b, a representative field is shown), whereas conventional ISH for DNA, with its low level of sensitivity, never revealed positive signal (data not shown). Surprisingly, however, PCR-ISH analysis of HAM/TSP PBL also demonstrated an unexpectedly low number of cells containing HTLV-1 tax DNA, with an average of 1 in 5,000 to 1 in 10,000 cells positive by PCR-ISH (Fig. 6c and d). PCR-ISH for human -actin DNA (present at one to two copies per cell), a positive control for individual cell amplification on slides, was positive in 100% of HAM/TSP PBL (Fig. 6e and f). These results are in contrast to published reports (10, 11, 22, 25, 38, 46) on the number of HTLV-1-positive cells in HAM/ TSP PBL (based solely on solution-phase PCR) and our own solution-phase results on the amount of HTLV-1 tax DNA in HAM/TSP PBL when DNA was extracted first, followed by serial dilution of a single stock solution (Fig. 7). The same HAM/TSP PBL that showed a low number of HTLV-1 tax DNA-positive cells by PCR-ISH (Fig. 6) were used to estimate the HTLV-1 tax proviral load by solution-phase PCR analysis and Southern hybridization (Fig. 7). HTLV-1 tax DNA was amplified by PCR from serial dilutions of DNA extracted from either HUT-102 cells or HAM/TSP PBL (the first type of serial dilution from a single DNA stock solution). As expected from the HUT-102 cell line, in which every cell is infected (Fig. 1) with multiple copies of HTLV-1 (Fig. 5), a positive PCR signal was detected at a dilution equal to a single cell equivalent (Fig. 7A, lane 10 0 ). A similar dilution series from 10 5 PBL from three different patients with HAM/TSP found that PCR product was detected at a dilution equal to 100 cell equivalents (Fig. 7B, lane 10 2, a representative blot). If one assumes that at least one copy of HTLV-1 proviral DNA is present per cell, then at least 1% of the PBL from patients with HAM/TSP contained HTLV-1 tax DNA. This level of detection is consistent with solution-phase PCR estimates of HTLV-1 proviral load in HAM/TSP PBL described in the literature (10, 11, 22, 25, 38, 46). In contrast, when cells were first serially diluted and then DNA extracted, only 1 in 10 4 cells showed signal (Fig. 7C, lane 10 4, a representative blot), a level of detection that more closely parallels the PCR-ISH results. DISCUSSION PCR-ISH was utilized to detect HTLV-1 tax proviral DNA in PBL of patients with HAM/TSP. A number of technical issues were addressed in this study. The technique was sensitive to a level of one to two copies of target DNA, as shown by HTLV-1 tax DNA in MT-1 cells (Fig. 2d) and the human -actin gene in HAM/TSP PBL (Fig. 6e and f). This level of sensitivity is comparable with solution-phase PCR followed by Southern hybridization of electrophoresed products with a radioactively labeled internal oligonucleotide probe (Fig. 7) and was greatly increased over ISH alone for the detection of DNA. Also, the technique was specific. There was no positive signal in uninfected controls (Fig. 3) when Taq polymerase was excluded from the PCR cocktail (Fig. 1c and 2c) or when tax-specific primers were excluded from the PCR cocktail (Fig. 1e). This latter control is particularly important, since nonspecific amplification of DNA can occur in the presence of Taq polymerase (27). After amplification and detection with a radioactive nonsense probe, no positive signal was present (Fig. 1f). In addition, other technical considerations were found to be important for accurate PCR-ISH results. By performing a mixing study in which a known number of infected and uninfected cells were placed into solution and adhered to slides, there was no evidence of significantly increased numbers of positive cells (Fig. 4b). It was found that postamplification fixation in glutaraldehyde may decrease sensitivity (Fig. 4d), and as reported in other studies, hot-start PCR is helpful in maintaining specificity and low background (Fig. 4e) (33) and proteinase K exposure was critical for maximizing signal detection (Fig. 4c). Since a high viral load has been reported in PBL of patients

9 932 LEVIN ET AL. J. VIROL. with HAM/TSP (10, 11, 22, 25, 38, 46), we expected PCR-ISH, with its greater sensitivity over conventional ISH, to show by direct in situ visualization that as many as 10% of PBL from patients with HAM/TSP may contain HTLV-1 tax DNA. To our surprise, this was consistently not shown, even though our solution-phase PCR results on these samples were similar to those described in the literature when PCR was performed on samples serially diluted from a single stock solution (Fig. 7) (38). Interestingly, when cells were serially diluted prior to PCR, the results more closely paralleled our PCR-ISH data. The PCR-ISH data revealed that at most, only 0.02% of HAM/ TSP PBL contained HTLV-1 tax DNA. When estimates of HTLV-1 proviral load in HAM/TSP PBL are performed by PCR on solution-phase samples, it is assumed that either a single copy or the same number of copies of HTLV-1 proviral DNA is present in an individual cell (10, 11, 22, 25, 38, 46). This assumption is not made in PCR-ISH; the only assumption made is that the technique is sensitive enough to detect very few copies of target DNA (one to two copies of HTLV-1 tax in MT-1 cells (Fig. 2d) and two copies of the human -actin gene in HAM/TSP PBL (Fig. 6e and f). The discordance between the PCR-ISH and solution-phase PCR results may be due to differences between the techniques. It is unclear whether solution-phase PCR performed on cell lysates can accurately quantitate the number of infected cells if an infected cell contains a single copy, greater than one copy, or even variable numbers of copies of HTLV-1 proviral DNA. In comparison, the issue concerning PCR-ISH is whether it is sensitive enough to accurately detect all cells that contain virus. Alternatively, the differences may be due to the presence of greater than a single copy of HTLV-1 proviral DNA in an individual cell. Some studies have already suggested this as a possibility. Kira et al. (22) calculated the total HTLV-1 tax copy number from patient PBL to range from to copies per g of DNA. If one estimates that 1 g of DNA equals PBL (11, 25), then the total HTLV-1 tax proviral DNA load may be between 13 to 360 copies per 100 PBL [( to copies)/( PBL) 100] or up to 3.6 copies per cell. These results are comparable to estimates by Kubota et al. (25), who show viral load to be 2 to 20 copies per 100 PBL. These observations may only be resolved by further tests, such as those utilizing single-cell PCR on multiple HAM/TSP PBL samples. ACKNOWLEDGMENTS M.C.L. is a Postdoctoral Fellow of the National Multiple Sclerosis Society, and R.J.F. and M.W. are Howard Hughes Medical Institute- NIH research scholars. The HTLV-1 provirus probe for the EcoRI restriction enzyme analysis was kindly provided by F. Wong-Staal. REFERENCES 1. Bagasra, O., S. P. Hauptman, H. W. Lischner, M. Sachs, and R. J. Pomerantz Detection of human immunodeficiency virus type 1 provirus in mononuclear cells by in situ polymerase chain reaction. N. Engl. J. Med. 326: Beilke, M. A., D. Riding, M. Gravell, R. S. Hamilton, C. A. Mora, M. Leon-Monzon, P. E. B. Rodgers-Johnson, D. C. Gajdusek, C. J. Gibbs, and V. Zaninovic In situ hybridization detection of HTLV-I RNA in peripheral blood mononuclear cells of TSP/HAM patients and their spouses. J. Med. Virol. 33: Bucher, B., J. A. Puopard, J. C. Vernant, and E. C. DeFreitas Tropical neuromyelopathies and retroviruses: a review. Rev. Infect. Dis. 12: Corcoran, M., M. C. Levin, S. Jacobson, and L. Liotta From hot starts to false starts to smart starts: in situ PCR. NIH Catalyst 5: Cottler-Fox, M., and C. H. Fox Examining cells for infectious agents: a novel approach. J. Infect. Dis. 164: Daenke, S., S. Nightingale, J. K. Cruickshank, and C. R. M. Bangham Sequence variants of human T-cell lymphotropic virus type I from patients with tropical spastic paraparesis and adult T-cell leukemia do not distinguish neurological from leukemic isolates. J. Virol. 64: Embretson, J., M. Zupancic, J. Beneke, M. Till, S. Wolinsky, J. L. Ribas, A. Burke, and A. T. Haase Analysis of human immunodeficiency virusinfected tissues by amplification and in situ hybridization reveals latent and permissive infections at single-cell resolution. Proc. Natl. Acad. Sci. USA 90: Embretson, J., M. Zupancic, J. L. Ribas, A. Burke, P. Racz, K. Tenner-Racz, and A. T. Haase Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature (London) 362: Fox, C. H., and M. Cottler-Fox In situ hybridization in HIV research. Microbiol. Res. Techn. 25: Gessain, A., F. Saal, O. Gout, M. T. Daniel, G. Flandrin, G. de The, and J. Peries High human T cell lymphotropic virus type I proviral DNA load with polyclonal integration in peripheral blood mononuclear cells from French West Indian patients with tropical spastic paraparesis. Int. J. Can. 43: Gessain, A., F. Saal, O. Gout, M. T. Daniel, G. Flandrin, G. de The, J. Peries, and F. Sigaux High human T-cell lymphotropic virus type I proviral DNA load with polyclonal integration in peripheral blood mononuclear cells of French West Indian, Guianese and African patients with tropical spastic paraparesis. Blood 75: Gessain, A., J. C. Vernant, L. Maurs, F. Farin, O. Gout, A. Calender, and G. de-the Antibodies to human T-lymphotropic virus type I in patients with tropical spastic paraparesis. Lancet ii: Gout, O., M. Baulac, A. Gessain, F. Semah, F. Saal, J. Peries, C. Cabrol, S. Foucault-Fretz, D. Laplane, F. Sigaux, and G. de The Rapid development of myelopathy after HTLV-I infection acquired by transfusion during cardiac transplantation. N. Engl. J. Med. 322: Haase, A. T., E. F. Retzel, and K. A. Staskus Amplification and detection of lentiviral DNA inside cells. Proc. Natl. Acad. Sci. USA 87: Hira, H., M. Morita, T. Iwaki, T. Hatae, Y. Itoyama, T. Kitamoto, S. Akizuki, I. Goto, and T. Watanabe Detection of human T lymphotropic virus type I (HTLV-I) proviral DNA and analysis of T cell receptor VB CDR3 sequences in spinal cord lesions of HTLV-I-associated myelopathy/tropical spastic paraparesis. J. Exp. Med. 180: Hollsberg, P., and D. A. Hafler Pathogenesis of disease induced by human lymphotropic virus type I infection. N. Engl. J. Med. 328: Itoyama, Y., S. Minato, J. Kira, I. Goto, H. Sato, K. Okochi, and N. Yamamoto Spontaneous proliferation of peripheral blood lymphocytes increased in patients with HTLV-I associated myelopathy. Neurology 38: Jacobson, S., A. Gupta, D. Mattson, E. Mingioli, and D. E. McFarlin Immunologic studies in tropical spastic paraparesis (TSP). Ann. Neurol. 27: Jacobson, S., D. E. McFarlin, S. Robinson, R. Voskuhl, R. Martin, A. Brewah, A. J. Newell, and S. Koenig HTLV-1-specific cytotoxic T lymphocytes in the cerebrospinal fluid of patients with HTLV-1-associated neurological disease. Ann. Neurol. 32: Jacobson, S., H. Shida, D. E. McFarlin, A. S. Fauci, and S. Koenig Circulating CD8 cytotoxic T lymphocytes specific for HTLV-1 px in patients with HTLV-1 associated neurological disease. Nature (London) 348: Jacobson, S., V. Zaninovic, C. Mora, P. Rodgers-Johnson, W. A. Sheramata, C. J. Gibbs, and D. C. Gadjucek Immunological findings in neurological diseases: activated lymphocytes in tropical spastic paraparesis. Ann. Neurol. 23:S196 S Kira, J., Y. Koyanagi, T. Yamada, Y. Itoyama, I. Goto, N. Yamamoto, H. Sasaki, and Y. Sakaki Increased HTLV-I proviral DNA in HTLV-I associated myelopathy: a quantitative polymerase chain reaction study. Ann. Neurol. 29: Kitajima, I., M. Osame, S. Izumo, and A. Igata Immunological studies of HTLV-I associated myelopathy. Autoimmunity 1: Komminoth, P., A. A. Long, R. Ray, and H. J. Wolfe In situ polymerase chain reaction detection of viral DNA, single-copy genes, and gene rearrangements in cell suspensions and cytospins. Diagn. Mol. Pathol. 1: Kubota, R., T. Fujiyoshi, S. Izumo, S. Yashiki, I. Maruuyama, M. Osame, and S. Sonoda Fluctuation of HTLV-I proviral DNA in peripheral blood mononuclear cells of HTLV-I associated myelopathy. J. Neuroimmunol. 42: Lehky, T. J., C. H. Fox, S. Koenig, M. C. Levin, N. Flerlage, S. Izumo, E. Sato, C. S. Raine, M. Osame, and S. Jacobson Detection of human T-lymphotropic virus type-i (HTLV-I) Tax RNA in the central nervous system of HTLV-I-associated myelopathy/tropical spastic paraparesis patients by in situ hybridization. Ann. Neurol. 37: Long, A. A., P. Komminoth, E. Lee, and H. J. Wolfe Comparison of indirect and direct in-situ polymerase chain reaction in cell preparations and tissue section. Detection of viral DNA, gene rearrangements and chromosomal translocations. Histochemistry 99: McFarlin, D. E., and W. A. Blattner Non-AIDS retroviral infections in

10 VOL. 70, 1996 PCR-ISH IN HTLV-1-RELATED DISEASES 933 humans. Annu. Rev. Med. 42: Moore, G. R. W., U. Traugott, L. C. Scheinberg, and C. R. Raine Tropical spastic paraparesis: a model of virus-induced, cytotoxic T-cell mediated demyelination. Ann. Neurol. 26: Morimoto, C., T. Matsuyama, C. Oshigee, H. Tanaka, T. Hercend, E. L. Reinherz, and S. F. Schlossman Functional and phenotypic studies of Japanese adult T cell leukemia cells. J. Clin. Invest. 75: Nakajima, I. S., H. Hamada, P. Reddy, and T. Kakunaga Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns. Proc. Natl. Acad. Sci. USA 82: Nishimura, M., D. E. McFarlin, and S. Jacobson Sequence comparisons of HTLV-I from HAM/TSP patients and their asymptomatic spouses. Neurology 43: Nuovo, C. J PCR in situ hybridization: protocols and applications. Raven Press, New York. 34. Osame, K., S. Izumo, A. Igata, M. Matsumoto, T. Matsumoto, S. Sonoda, M. Tara, and Y. Shibata Blood transfusion and HTLV-I associated myelopathy. Lancet ii: Osame, M., M. Matsumoto, K. Usuku, S. Izumo, N. Ijichi, H. Amitani, M. Tara, and A. Igata Chronic progressive myelopathy associated with elevated antibodies to human T-lymphotropic virus type I and adult T-cell leukemia-like cells. Ann. Neurol. 21: Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsumoto, and M. Tara HTLV-1 associated myelopathy, a new clinical entity. Lancet i: Poeisz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T cell lymphoma. Proc. Natl. Acad. Sci. USA 77: Richardson, J. H., A. J. Edwards, J. K. Cruickshank, P. Rudge, and A. G. Dalgleish In vivo cellular tropism of human T-cell leukemia virus type I. J. Virol. 64: Schnittman, S. M., M. C. Psallidopoulos, H. C. Lane, L. Thompson, F. Massari, C. H. Fox, N. P. Salzman, and A. S. Fauci The reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4. Science 245: Seiki, M., S. Hattori, Y. Hirayama, and M. Yoshida Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proc. Natl. Acad. Sci. USA 80: Stapleton, M. J., M. C. Levin, and S. Jacobson DNA amplification within cells on slides: advances in evaporation and temperature control. Cell Vision 1: Usuku, K., S. Sonada, M. Osame, S. Yashiki, K. Takahashi, M. Matsumoto, T. Sawada, T. Tsuji, M. Tara, and A. Igata HLA haplotype-linked high immune responsiveness against HTLV-I in HTLV-I associated myelopathy: comparison with adult T cell leukemia/lymphoma. Ann. Neurol. 23:S143 S Utz, U., W. E. Biddison, H. F. McFarland, D. E. McFarlin, M. Flerlage, and R. Martin Skewed T-cell receptor repertoire in genetically identical twins correlates with multiple sclerosis. Nature (London) 364: Walter, M. J., T. J. Lehky, C. H. Fox, and S. Jacobson In situ PCR for the detection of HTLV-I in HAM/TSP patients. Ann. N. Y. Acad. Sci. 724: Wong-Staal, F., and R. C. Gallo Human T-lymphotropic retroviruses. Nature (London) 317: Yoshida, M., M. Osame, H. Kawai, M. Toita, N. Kuwasaki, Y. Nishida, Y. Hiraki, K. Takahashi, K. Nomura, S. Sonoda, N. Eiraku, S. Ijichi, and K. Usuku Increased replication of HTLV-I in HTLV-I-associated myelopathy. Ann. Neurol. 26: Downloaded from on September 26, 2018 by guest

11