Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary

Transcription

1 Online Data Supplement Absence of Kaposi s Sarcoma-Associated Herpesvirus in Patients with Pulmonary Arterial Hypertension Cornelia Henke-Gendo, Michael Mengel, Marius M. Hoeper, Khaled Alkharsah, Thomas F. Schulz

2 Subjects enrolled in the study The Ethics Committee of Hannover Medical School agreed to this study. 26 lung transplant patients were enrolled in this study. All patient were diagnosed as IPAH, including 1 familiar form of PAH, three veno-occlusive variants of PAH (vopah) and 22 classical IPAH. 19 (73.08%) patients were female. The median age was 42 years (min 22 years, max 58 years). All patients were transplanted at Hannover Medical School between 1993 and None of the patients showed a history of appetite suppressant drugs use, nor were they HIV-infected. One patient was chronically infected with Hepatitis C-Virus. Immunhistochemistry For immunhistochemistry, slides were deparaffinized in xylene and rehydrated in graded alcohol. Heat-induced epitope retrieval using the microwave technique (citrate buffer ph 7.2, 20 min at 100 C) was followed by blocking of endogenous peroxidase with 3% H 2 O 2 as well as endogenous biotin by an Avidin/Biotin-blocking Kit (Vector Laboratories, Burlingame, CA, USA). Commercially available primary monoclonal rat anti KSHV (anti LANA-1, clone ORF73) antibody (Advanced Biotechnologies, USA) was incubated (1:750) overnight at 4 C. A biotinylated secondary rabbit-anti-rat antibody (1:250, 60 min, room temperature; Zymed Laboratories, San Francisco, CA, USA) was detected by a sensitive streptavidin-alkalinephosphatase-complex after thyramine amplification (1:200, 60 min, room temperature; NenLifeScience, Boston, MA, USA). Fast red served as substrate and hematoxylin for counterstaining. Molecular biology methods The different PCR protocols using the Amplitaq system (Perkin Elmer, USA) were performed on 5µl of extracted lysate or precipitated DNA. 2.5 mm MgCl 2, 0.25 mm dntp each and 0.1 U/µl Taq-Polymerase were added to the adequately diluted 10x GeneAmp PCR buffer - 1 -

3 (Perkin Elmer, USA) in a total volume of 50 µl. Primers were added at a concentration of 0.1 µm of each primer. Amplification was performed in an oil-free thermocycler (Model GeneAmp 9700; Perkin Elmer, USA). After 35 cycles, for the modified orf26 single round PCR after 40 cycles, the amplified products were separated in a 2% agarose gel (Roth, Germany) and visualised under UV after staining with ethidium bromide (Merck, Germany). Table E1 lists primer sequences as well as the used annealing temperatures and indicates the size of the products

4 Reference List E1. Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: E2. Boshoff, C., D. Whitby, T. Hatziioannou, C. Fisher, W. J. van der, A. Hatzakis, R. Weiss, and T. Schulz Kaposi's-sarcoma-associated herpesvirus in HIV-negative Kaposi's sarcoma. Lancet 345: E3. Pan, L., L. Milligan, J. Michaeli, E. Cesarman, and D. M. Knowles Polymerase chain reaction detection of Kaposi's sarcoma-associated herpesvirus-optimized protocols and their application to myeloma. J.Mol.Diagn. 3: E4. de Sanjose, S., V. Marshall, J. Sola, V. Palacio, R. Almirall, J. J. Goedert, F. X. Bosch, and D. Whitby Prevalence of Kaposi's sarcoma-associated herpesvirus infection in sex workers and women from the general population in Spain. Int.J.Cancer 98: E5. Greensill, J., J. A. Sheldon, N. M. Renwick, B. E. Beer, S. Norley, J. Goudsmit, and T. F. Schulz Two distinct gamma-2 herpesviruses in African green monkeys: a second gamma-2 herpesvirus lineage among old world primates? J.Virol. 74:

5 Legends for Illustrations Figure E1 Figure E1 depicts the first (lower) and second round (upper) panel of the nested orf26-pcr performed on precipitated DNA of 10 patients with IPAH. DNA extracted from a Primary Effusion Lymphoma cell line (BCP-1) served positive control

6 Table E1. Primers used for KSHV specific PCR and γ-herpesviral consensus PCR Locus primer sequences fragment size annealing temperature β-globin (E1) Beta up 5 -CAACTTCATCCACGTTCACC-3 Beta down 5 -GAAGAGCCAAGGACAGGTAC bp 55 C Orf26 (E2) First round 570 bp 60 C KS4: 5 -AGCACTCGCAGGGCAGTACG-3 KS5: 5 -GACTCTTCGCTGATGAACTGG-3 nested round 233 bp 55 C KS1: 5 -AGCCGAAAGGATTCCACCAT-3 KS2: 5 -TCCGTGTTGTCTACGTCCAG-3 Orf72 (E3) OrfK6 (E4) orf72f: 5 -CGCCTGTAGAACGGAAACAT-3 orf72r: 5 -TTGCCCGCCTCTATTATCAG-3 K6-F: 5 -CGCCTAATAGCTGCTGCTACGG K6-R: TGCATCAGCTGCCTAACCCAG K6-P: (6~FAM)CACCCACCGCCCGTCCAAATC(TAMRA) 140 bp 56 C 170 bp 60 C Orf9 (E5) gdtd1b: 5 -CGGCATGCGACAAACACGGAGTC(ACGT) GT(AG)TC(ACGT)CC(AG)TA bp 55 C vygam: 5 -ACGTGCAAC(GT)C(ACGT)GT(ACGT)TA (CT)G(AG)(ACGT)TT(CT)AC(CGT)GG-3 clnia: 5 -TCTGGCATCCT(ACTG)CC(ACGT)TG(CT) (ACT)T(ACGT)(AG)(ACG)(ACGT)AT(ACT)-3 vtqlga: 5 -GAGACCGTGAC(ACGT)(ACG)(CT)(ACGT)(AC) (AG)(AG)GG-3-5 -

7 Illustrations Figure E1 p nested n p n p - 6 -