VNTR . VNTR. VNTR. (Original Article) PCR-RFLP ( ETR-B, ETR-C, ETR-D, ETR-E, ETR-F : 7 .VNTR : : (Atypical Mycobacteria)

Transcription

1 (Original Article) (Non- Tuberculosis Mycobacterium, NTM) :.. (Variable Number Tandem Repeat, VNTR). VNTR ) 48 : PCR-RFLP ( MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F : 7 VNTR. VNTR 7. VNTR : 42. ( ) PCR 6. :. VNTR..VNTR : : fzheidari@yahoo.com : 89/9/15 : 88/10/19 : : (Atypical Mycobacteria) (Mycobacteria other Than Tuberculosis) MOTT EM (Non-Tuberculosis Mycobacteria) NTM. (Environmental Mycobacteria) : ٣

2 90 2. ETR DNA ETR-A MPTR-A. ETR-C, ETR-B,ETR-D, ETR-E, ETR-F ETR-C, ETR-D, ETR-E, ETR-F. ETR-B.(8 7) VNTR (11) VNTR 7.(9) ( ) %4. LJ (Lowenstein Jensen). (40µg/ml) (0/2µg/ml) (2µg/ml) (2µg/ml) (10µg/ml) MDR DNA. MDR hsp65 PRA. - (Heat Shock Protein 65KD PCR Restriction Analysis) (1)....(2).(3). VNTR IS6110-RFLP IS6110-RFLP 1990.(14 4). PCR PCR Spoligotyping VNTR VNTR.(15 5) ( ) 11 VNTR.(6) 5 MPTR (Major Polymorphic Tandem Repeats) 6 (MPTR-A, MPTR-B, MPTR-C, MPTR-D, MPTR-E) ETR-A, ETR-B, ETR-C,). ETR(Exact Tandem Repeats) (ETR-D, ETR-E, ETR-F 7 11 (MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F) (Insertion) (Deletion) 15 MPTR.(7) ٤

3 ) PCR.(7) (1 PCR 30 94ºC 5 : ºC 30 94ºC : ºC %1/7 PCR. PCR.(7) Hpa II Hph I Ava II 3.(20 19) VNTR 48 Myco. Simiae (ATCC 25275T). Myco. Fortuitum (ATCC 49404). Myco. Chelonae Abscessus (ATCC 19977T). Myco. Chelonae Chelonae (ATCC 35749T). Myco. Intracellular (ATCC 13950T). Myco. Parascrofulaceum (ATCC 19981T). Myco. Malmoens (ATCC 29571T). Myco. Gordonae (ATCC 14470T). Myco. Kansasii (ATCC 12478T). H 37 RV :1 (3'-5') *(bp) PCR (bp) MPTR-A GGTTACCACTTCGATGCGTCTGCC AGCCGCCGAAACCCATC ( 16 15) 343 Frothingham (1995) ETR-A AAATCGGTCCCATCACCTTCTTAT CGAAGCTGGGGTCGCCCGCGATTT ( 3 75) Goyal et al (1994) ETR-B GCGAACACCAGGACAGCATCATG GGCATGCCGGTGATCGAGTGG ( 3 57) ETR-C ETR-D GTGATGCGCTGCAGAACCTGCAG GGCGTCTTGACCTCCACGAGCT CAGGTCACAACGAGAGGAAGAGC GCGGATCGGCCAGCGACTCCTC ( 4 58) ( 3 77) Frothingham and Meeker O Connell (1998) ETR-E CTTCGGCGTCGAAGAGAGCCTC CGGAACGCTGGTCACCACCTAAG ( 3 53) ETR-F CTCGGTGATGGTCCGGCCGGTCAC GGAAGTGCTCGACAACGCCATGCC ( 3 79) ETR-D ETR-E.(7) ETR-F (%58/3) 28 (%41/6) (%72/9) 35.. (%27) ± : ( ) MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F : H37RV 6. 4 MPTRA ETR-A ETR-B ETR-C ٥

4 VNTR 2 42 (3 ) 3 PCR 6 ) VNTR.(1 ).( PCR MPTR-A, ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F ) (3. 30/3 54/7 2 (%95/8) (%4/2) 36 (%8/3) 4 MDR (%16/6) 8 2. MDR (%75) (%27) 13 hsp65 PRA.(2 ) (%73) :2 hsp65 PRA VNTR :3 ETR-F ETR-E ETR-D ETR-C ETR-B ETR-A MPTR-A ٦

5 ٧

6 90 2 Myco. Simiae ETR-C, ETR-A, ETR-E :1 Myco. Simiae (100 bp Ladder) DNA :M :N Myco. Simiae :1-10 ٨

7 5 (BCG).(7) VNTR MPTR ETR ETR-A.(17) MPTR ETR VNTR VNTR. M. ulceranse VNTR 2005 Ablordey (18) M. ulceranse 2007 Hilty VNTR (6) Agy99. M. ulceranse ٩..(10) 1908.(2) Duvall. ) (.(12) VNTR MPTR ETR Meeker-O.(16 13) VNTR 1998 Frothingham ( ) H 37 RV VNTR 6 (MPTR-A, MPTR-B, MPTR-C, MPTR-E, MPTR-F) (ETR-A, ETR-B, ETR-C, ETR-D, ETR-E, ETR-F) ETR 6 MPTR 5. (Inserting) (Deletion) BCG

8 90 2 MPTR. ETR VNTR. MPTR ETR. 48 VNTR 7 MPTR-A, ETR-A, ETR-E, ETR-D, ETR-C, ETR-B, ETR-F PCR. MPTR ETR References: 1. Hartmans S, Bont AM. The Genus Mycobacterium Nonmedical. In the Prokaryotes. Dwrkin M, editor. New York: Springer; p (Vol 3). 2. Katoch VM. Infection Due to Non-Tuberculous Mycobacteria. Indian J Med Res 2004;120: AI-Mahruqi SH, Van Ingen J, Busaidys-AI, Boeree MJ, AI-Zadjalis, Patel A, et al. Clinical Relevance of Non Tuberculous Mycobacteria. Oman Emery Infect Dis 2009;15: Mostrom P, Gordon M, Sola C, Ridell M. Methods Used In The Molecular Epidemiology of Tuberculosis. J Clin Microbiol 2002;8(11): Doroudchi M, Kremer K, Basiri EA. IS6110- RFLP and Spoligotyping of Mycobacterium Tuberculosis Isolates in Iran. J Infect Dis 2000;32: Hilty M, Kaser M, Zinsstag J, Stinear T, Pluschke G. Analysis of the Mycobacterium Ulcerans Genome Sequence Reveals New Loci for Variable Number Tandem Repeats (VNTR) Typing. Microbiol 2007;153: Frothingham R, Meeker O, Connell W. Genetic Diversity In The Mycobacterium Tuberculosis Complex Based On Variable Number of Tandem DNA Repeats. J Clin Microbiol 1998;144: Skuce RA, McCorry TP, McCarroll JF, Roring SM, Scott AN, Brittain D, et al. Discrimination of Mycobacterium Tuberculosis Complex Bacteria Using Novel VNTR-PCR Targets. J Clin Microbiol 2002;148: Stragier P, Ablordey A, Meyers WM, Portaels F. Genotyping Mycobacterium Ulcerans and Mycobacterium Marinum by Using Mycobacterial Interspersed Repetitive Units. J Bacteriol 2005;187: Demort M, Chaulet P. Treatment of Tuberculosis: Guidelines For National Programmes. Geneva: WHO; p Hidarei F, Farnia P, Nowroozi J, Majd A, Tajeddin E, Masjedi MR, Velayati AA. The Rapid Identification Atypical Mycobacterium Pulmonary in Tuberculosis Patients: Avaluation of QUB3232 Locus Using the VNTR Method. J Zanjan University 2009;17(67): [Full Text in Persian] 12. Sriyabhaya N, Wonswatana S. Pulmonary Infection Caused by Atypical Mycobacteria: A Report of 24 Cases in Thailand. Rev Infect Dis 1981;3: Portaels F, Stragier P, Ablordey A, Meyers WM. Genotyping Mycobacterium Ulcerans and Mycobacterium Marinum by Using Mycobacterium Interspersed Repetitive Units. J Bacter 2005;187(5): ١٠

9 14. Farnia P, Masjedi MR, Varahram M, Mirsaeidi M, Ahmadi M, et al. The Recent-Transmission of Mycobacterium Tuberculosis Strains Among Iranian and Afghan Relapse Cases: A DNA- Fingerprinting Using RFLP and Spoligityping. BMC Infect Dis 2008;8: Kam K, Yip CW, Tse W, et al. Optimization of Variable Tandem Repeat Typing Set for Diferentiating Mycobacterium Tuberculosis Strains in the Beijing Family. FEMS Microbiol Lett 2006;256: Mazars E, Lesjean S, Banuls AL, et al. High-Resolution Minisatellite-Based Typing as a Portable Approach to Global Analysis of Mycobacterium Tuberculosis Molecular Epidemiology. Proc Natl Acad Sci USA 2001;98: Tajeddin E, Farnia P, Nowroozi J, Masjedi MR, Velayati AA. Evaluation of Genetic Pattern of Mycobacterium Tuberculosis Separated of Iranian and Afgan TB Patients: Using the VNTR Typing Method. J Kurdestan University 2008;31: [Full Text in Persian] 18. Ablordey A, Swings J, Hubans C, Chemlal K, Locht C, Portaels F, Supply Ph. Multilocus Variable-Number Tandem Repeat Typing of Mycobacterium Ulcerans. J Clin Microbial 2005;43(4): Kim H, Kim SH, Shim TS, et al. PCR Restriction Fragment Length Polymorphism Analysis (PRA)-Algorithm Targeting 644 bp Heat Shock Protein 65(hsp65) Gene for Gifferentiation of Mycobacterium Spp. J Microbiol Methods 2005;62: Hafner B, Haag H, Geiss HK, Nolte O. Different Molecular Methods for the Identification of Rarely Isolated Non- Tuberculous Mycobacteria and Description of New hsp65 Fragment Length Polymorphism Patterns. Mol Cell Probes 2004;18: ١١