Dendritic Cells as a Biomarker for Gut Pathology

Transcription

1 Dendritic Cells as a Biomarker for Gut Pathology A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Life Sciences 2012 Rowann Bowcutt

2 2

3 Contents List of Figures... 8 List of Tables Abstract Declaration Copyright Acknowlegements Abbreviations Chapter One: Introduction Gastrointestinal Helminth Infections Trichuris muris Immune response to T. muris Cytokines associated with susceptibility to T. muris Effector mechanisms associated with resistance to T. muris infection Granulocytes: Eosinophils and basophils Mast Cells Adaptive immunity: Antibody Production and B cells The intestinal epithelium Goblet cell hyperplasia Smooth Muscle Contractility Macrophages and Dendritic Cells Macrophages Classical macrophage activation AAM Alternatively activated macrophages in helminth infections AAM and T. muris Dendritic cells Dendritic cell subsets in the gastrointestinal tract Dendritic cell migration Migration of DCs Detection of helminth infection by DCs Contents 3

4 Driving Th2 responses by helminth-primed DCs Regulation of the immune response by DCs DCs and T. muris Pattern Recognition Receptors PRRS and Trichuris muris Nucleotide-binding oligomerization domain-containing protein 2 (Nod2) Structure of Nod Nod2 and TLRs Nod2 in Intestinal epithelial cells Nod2 in infection and disease Conclusions and aims of the project References Chapter Two: A role for the pattern recognition receptor Nod2 in promoting recruitment of CD103 + Dendritic Cells to the gut in response to Trichuris muris infection Abstract Introduction Materials and Methods Results Nod2 mrna expression in colonic epithelial cells shows an increased trend 24 hours after T. muris infection Nod2 -/- mice have impaired recruitment of CD103 + DCs to the colonic epithelium Impaired T. muris expulsion kinetics in Nod2 -/- mice Nod2 does not drive basophil recruitment Increased CD103 + numbers is due to migration not proliferation Nod2 -/- DCs can migrate normally in vitro and in vivo Nod2 -/- epithelial cells show impaired chemokine secretion in vitro Discussion Acknowledgements References Contents 4

5 Chapter Three: Arginase-1 Expressing Macrophages are Dispensable for Resistance to Infection with the Gastrointestinal Helminth Trichuris muris Abstract Introduction Materials and methods Results Expulsion of T. muris from BL6 mice does not require Arg1 expression in macrophages T. muris-specific cytokine responses are not affected by the absence of arginase T. muris-specific serum antibody responses are not affected by the absence of arginase activity Arginase is not essential for the regulation of pathology during T. muris infection Arginase activity is not essential for the regulation of the host immune response and parasiteinduced pathology during chronic T. muris infection Discussion Acknowledgements References Chapter Four: IL-10 production by CD11c + cells does not regulate Trichuris muris induced inflammation and pathology Abstract Introduction Materials and methods Results CD11c-specific IL-10 deficiency does not cause an overt increase in pathology during chronic T. muris infection CD11c-specific IL-10 deficiency does not cause any overt increase in pathology during chronic T. muris infection CD11c-specific IL-10 deficiency does affect CD45 + or Foxp3 + cell infiltrate during chronic T. muris infection T. muris-specific cytokine responses are not affected by the absence of IL-10 production via CD11c + cells CD11c-specific IL-10 deficiency does not affect serum antibody responses during chronic T. muris infection Contents 5

6 Discussion Acknowledgements References Chapter Five: Summary Discussion The global problem Initiation of immunity to Trichuris a role for the pattern recognition receptor Nod2? How important are DCs in initiation of immunity? How is pathology resolved in T. muris infection a role for Arginase and Arg1-expressing macrophages? How is pathology resolved in T. muris infection- a role for DCs? Conclusions Future work References Chapter Six: Supplementary Materials and Methods Parasite specific techniques Maintenance of T.muris life-cycle Preparation of E/S antigen Assessment of egg infectivity Preparation of eggs for infection Ex vivo analyses Worm burden assessment Isolation and culture of mesenteric lymph node cells CBA analysis parasite-specific IgG1 and IgG2a ELISA Histology Tissue processing Haematoxylin and Eosin staining Goblet cell staining Collagen staining Immunohistochemistry Tissue processing Arginase and Relmα staining: Contents 6

7 6.4.3 CD45 and FoxP3 staining Immunofluorescence Flow cytometry LPL/IEL preparation and FACs staining Molecular Biology Colonic epithelial cell isolation for RNA extraction RNA extraction cdna synthesis and Quantitive PCR Genotyping Arg1 flox/flox ;Tie2cre and Arg +/+ ;Tie2cre Other methods Generation of bone marrow chimeras: Verifying successful reconstitution of bone marrow chimeras References Contents 7

8 List of Figures Chapter 1: Introduction Figure 1: Figure 2: Trichuris muris lifecycle...21 Differential cell surface expression and arginine metabolism of classically and alternatively activated macrophages...34 Figure 3: Figure 4: Structure of Nod Nod2 Signalling Pathway...50 Chapter 2: A role for the pattern recognition receptor Nod2 in promoting recruitment of CD103 + DC to the gut in response to Trichuris muris infection Figure 1: Delayed recruitment of CD103 + DCs to the colonic epithelium in Nod2 -/- mice in response to T.muris...83 Figure 2: Delayed recruitment of CD103 + DCs to the colonic epithelium in Nod2 -/- mice in response to T. muris...84 Figure 3: Figure 4: Delayed expulsion kinetics of T. muris in Nod2 -/- mice...85 Increased CD103 + cells in the large intestine is not due to in situ proliferation of DCs and Nod2 has no role in basophil recruitment to the large intestine...86 Figure 5: Figure 6: Figure 7: Nod2 -/- dendritic cells can migrate to a Nod2 +/+ epithelium...89 Nod2 -/- colonic epithelial cells are unable to produce the chemokines CCL How does T. muris activate Nod2?...96 Chapter 3 Arginase-1 Expressing Macrophages are Dispensable for Resistance to Infection with the Gastrointestinal Helminth Trichuris muris. Figure 1: Figure 2: Expulsion of T. muris from BL6 mice is not dependent on arginase T. muris-specific cytokine responses are not affected by the absence of arginase Figure 3: T. muris-specific serum antibody responses are not affected by the absence of arginase Figure 4: Arginase is not essential for the regulation of pathology during T. muris infection Figure 5: Analysis of the immune response and inflammatory regulation in Arg1 flox/flox ;Tie 2-cre and control mice during chronic T. muris infection List of Figures 8

9 Chapter 4 IL-10 production by CD11c + cells does not regulate Trichuris muris induced inflammation and pathology Figure 1: Figure 2: Figure 3: Figure 4: Figure 5: Chronic T. muris infection does not cause weight loss in CD11c + -IL-10 deficient mice CD11c + cell specific IL-10 production is not essential for the regulation of pathology during chronic T. muris infection Absence of CD11c + cell specific IL-10 production increases submucosal thickness but does not affect CD45 + cell or Treg numbers in the large intestine in response to T. muris T. muris-specific cytokine responses are not affected by the absence of IL-10 production by CD11c + cells T. muris-specific serum antibody responses are not affected by the absence of IL-10 production by CD11c + cells Chapter 5: Summary discussion Figure 5.1 Schematic showing possible mechanisms that are involved in the immune response to T. muris during its life cycle in the large intestine List of Figures 9

10 List of Tables Chapter 2: A role for the pattern recognition receptor Nod2 in promoting recruitment of CD103 + DC to the gut in response to Trichuris muris infection Table 1: Primer sequences used for quantitative PCR of colonic epithelial cell...80 Chapter 6: Supplementary Materials and Methods Table 1: Primer sequences for qpcr analysis of colonic epithelial cells Table 2: Primer squences for genotyping of Arg1 flox/flox ;Tie2cre and Arg +/+ ;Tie2cre List of Tables 10

11 Abstract Trichuris trichiura (T. Trichiura) is a large-intestinal dwelling nematode that affects over 1 billion people world-wide and thus has large global significance. Much of our understanding of T. trichiura infection comes from the study of the mouse model Trichuris muris (T. muris). However, how the immune system is initiated in response to helminth threat and how inflammation and pathology are resolved in T. muris infection still remain to be addressed. Here, I have attempted to provide insight into these questions. Previous work has shown resistance to T. muris infection is associated with the rapid recruitment of dendritic cells (DCs) to the colonic epithelium via epithelial production of CCL5 and CCL20. However, the epithelial-parasite interaction that drives chemokine production is not known. Pattern recognition receptor (PRRS) are critical mediators of pathogen recognition but there is no known (PRR) specific for T. muris. Here, we address the role of the cytosolic pattern recognition receptor Nod2, the location of which within the crypts correlates with the T. muris niche. In WT mice, in response to infection, there was a rapid influx of CD103 + CD11c + DCs into the colonic epithelium, whereas, this recruitment was impaired in Nod2 -/- animals. In vitro and in vivo experiments confirmed the impairment in DC recruitment in Nod2 -/- mice was attributable to the epithelial compartment. Subsequent work revealed decreased production of epithelial chemokines in the absence of functional Nod2. Thus, we have shown a novel role for Nod2 in the initiation the immune response to T. muris. We next addressed how pathology is regulated during T. muris infection. Firstly we investigated the role of arginase and Arg1-expressing macrophages in regulating pathology. My data showed that, unlike other gastrointestinal helminths, arginase and Arg1-expressing macrophages are not essential for resistance to T. muris or effective resolution of helminthinduced inflammation. I also addressed the role of DCs in the resolution of infection. DCs can regulate immune responses via the anti-inflammatory cytokine IL-10 and induction of regulatory T cells (Treg). I used an IL-10 flox/flox CD11cCre transgenic model in which mice have DCs that cannot make IL-10. I found no role for CD11c + cell mediated IL-10 production in the regulation of pathogen induced pathology in chronic T. muris infection. In summary I have been able to identify factors in the initiation of immunity to T. muris namely epithelial expression of Nod2. However, as arginase, Arg1-expressing macrophages and DC derived IL-10 appeared to play a redundant role in T. muris infection, the question as to how infection induced inflammation is resolved remains elusive. Abstract 11

12 Declaration I declare that no portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning; Copyright i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the Copyright ) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trade marks and other intellectual property (the Intellectual Property ) and any reproductions of copyright works in the thesis, for example graphs and tables ( Reproductions ), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see in any relevant Thesis restriction declarations deposited in the University Library, The University Library s regulations (see and in The University s policy on presentation of Theses Declaration and Copyright 12

13 Acknowledgements Four years ago I found it hard to imagine reaching this stage and admittedly there were some moments when I thought I would never finish but I ve done it! However, I couldn t have done it without the help and support from a lot of amazing people. First and foremost I would like to thank my supervisor Sheena Cruickshank for all the help, guidance and support over the last four years. Thank you to my co-supervisor Richard Grencis it was doing my undergraduate project in the Grencis lab that made me want to do a Phd! Also, thanks to my advisor Kathryn Else for all the endless advice. Thank you to the rest of the Cruickshank group especially Larisa for all the words of wisdom about everything scientific. Thank you to Epistem and the BBSRC for funding this project and to my industrial supervisors Cath Booth and Jim Wilson for help and advice especially during my first year. Thank you to Peter Murray for donating the Nod2 -/- and Arg1 floxflox Tie2cre mice. Thanks to Axel Roers for donating the IL-10 floxflox CD11cCre mice. A special thank you should be said to all the members of the fourth floor who have made the PhD much more enjoyable. Manchester immunology group is definitely a great place to work! A massive thankyou to the FFB s past and present, Asia my first friend! Swapna the Gin Queen, Elaine for being the kindest person you will probably ever meet, Amanda the voice of reason and timely wit! Thanks to my super housemate, Emma - moving is going to be sad! Thanks to Becky - those morning, afternoon and evening hugs got me through this Phd! I will never forget the amazing times we ve all had together, travelling the world and partying hard. I hope for many more years of the same! A massive thank you to all my other friends from Manchester; Mushref, Juliet, Leonidas, Luke and especially Cristina for the constant messages of positivity! And those from Telford, Naomi, Rhiannon, Cat and Steph for providing encouragement and never stopping believing I could do it! I would like to say a massive thank you to Néstor for all his love and encouragement and for putting up with me during this stressful time. Eres lo mejor! Finally thank you to all my family especially my mum, who has always been my rock, providing unequivocal support throughout the highs and lows of this journey! Thanks mum! Acknowledgements 13

14 Abbreviations AA Alternatively activation/alternative activation AAM Alternatively activated macrophage APC Antigen Presenting cell Arg1 Arginase 1 B. malayi Brugia malayi BEC (S)-(2-Boronoethyl)-L-cysteine BSA Bovine serum albumin CAM Classically activated macrophage CARD Caspase recruitment domain CCR Chemokine receptor CD Cluster of differentiation cdna Complementary DNA Chi3l3 Chitinase 3-like 3 CP Colonic patch DAMPS Damage associated molecular patterns DC Dendritic cell DSS Dextran sodium sulphate E/S Excretory/secretory ELISA Enzyme linked immunosorbant assay FAE Follicle associated epithelium Fizz1 Found in inflammatory zone 1 FoxP3 Forkhead box P3 GMCSF Granulocyte-macrophage colony-stimulating factor H. polygyrus Heligmosoides polygyrus IBD Inflammatory bowel disease IEC Intestinal epithelial cell IEL intraepithelial lymphocyte IFN Interfer on Ig Immunoglobulin IKK IκB kinase IL Interleukin ILF Isolated lympoid follicle Abbreviations 14

15 inos Inducible nitric oxide synthase IκB Inhibitor of kappa B KO Knock out L. sigmodontis Litmosoides sigmodontis LP Lamina propria LPL Lamina propria lymphocyte LPS Lipopolysaccharide LRR Leucine rich repeat mciita MHC Class II transactivator MDP muramyl dipeptide MHC Major histocompatibility complex Mip-2 Macrophage inflammatory protein 2 MLN Mesenteric lymph node MR Mannose receptor MZ Marginal Zone N.brasiliensis Nippostrongylus brasiliensis NACHT Domain present in NAIP, CIITA, HET-E and TP-1 NBF Neutral buffered formalin NeMφ Nematode induced macrophage NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells NLR Nod-like receptor NO Nitric oxide NOD Nucleotide Oligomerization Domain Nod2 Nucleotide-binding oligomerization domain-containing protein 2 NOHA N ω -hydroxy-l-arginine Nor-NOHA Nor- N ω -hydroxy-l-arginine OAT Ornithine amino transferase OCT Optimal cutting temperature ODC Ornithine decarboxylase OX40L OX40 Ligand p.i. Post infection PALS Periarteriolar lymphoid sheath PAMPS Pathogen associated molecular patterns PAS Periodic acid-schiff s Abbreviations 15

16 PBS Phosphate buffered saline PBS-T Phosphate buffered saline with 0.5% Tween 20 PCR Polymerase chain reaction PD Programmed death ligand pdc plasmocytoid Dendritic cell PEPT1 Peptide transporter 1 PGN Peptidoglycan PP Peyer s Patches PPARγ Peroxisome proliferator-activated receptor PRR Pattern recognition receptor qpcr Quantitative PCR RAR Retinoic acid receptor RELMα Resistin-like molecule alpha RLR Rig-like receptor SCID Severe combined immunodeficiency SEA Soluble egg antigen SED Subepithelial dome SPF Specific pathogen free STAT Signal Transducers and Activators of Transcription T. muris Trichuris muris T. trichiura Trichuris trichiura TDS Trichuris dysentery syndrome TGFβ Transforming growth factor beta Th T helper TLR Toll-like receptor TNF Tumor necrosis factor Treg T regulatory cell TSLP Thymic stromal lymphopoietin WHO World Health Organisation WT Wildtype Abbreviations 16

17 Chapter One Introduction Chapter One Introduction 17

18 1. Introduction Mucosal surfaces are highly populated with immune cells and none more than the gastrointestinal tract. The main role of the intestine is digestion of food, however, the oral intake of food provides a means of entry for pathogenic threats. In addition to threats from the external environment, the intestine boasts an extensive number of commensal bacteria to which tolerance needs to be maintained. It is therefore paramount that an adequate immunological system is in place that is sensitive enough to strike an effective balance between tolerance and immunity. The gastrointestinal tract has the potential to be infected by bacteria, viruses and importantly for this thesis, parasites such as helminths. Helminths are highly specialized pathogens that have evolved with humans and therefore are able to employ mechanisms to evade the host immune system. Nevertheless, the immune system does attempt (sometimes successfully and sometime not) to eradicate the infection. There is a wealth of knowledge surrounding the specific adaptive T cell mediated mechanisms governing immunity or susceptibility to infection. However, very little is known about how the immune system is initiated in response to helminth threat. Furthermore, an overtly robust immune response has the potential to cause damage to the host, so specific regulatory mechanisms are needed to control and resolve pathogen-mediated pathology. However, again this is not widely understood in all helminth infections. This thesis aims to address the important unanswered questions surrounding how the immune response is initiated against gastrointestinal parasites as well as the resolution of immunity to helminths. The aim of this thesis is to define the role of innate immune cells namely dendritic cells (DCs) and macrophages in helminth infection in order to test the hypothesis that DCs and macrophages are critical regulators of helminth immunity. I will analyse the migration of innate immune cells and the involvement of the epithelium in initiating immunity as well as the role of macrophages and DCs in resolving pathology in helminth infection using the mouse helminth Trichuris muris. Chapter One Introduction 18

19 1.1 Gastrointestinal Helminth Infections With over 10 percent of the world s population infected, there is no question that gastrointestinal helminthiases are one of the most prevalent, chronic human infections [1]. Helminth infections are most prevalent in developing countries, where they are described as neglected tropical diseases [2]. Whereas infection rarely causes death to the host, when coupled with poor health and nutrition, infection can cause chronic morbidity [2]. Morbidity is dependent on the level and intensity of infection, indeed, people that harbour a high worm burden generally have worsened helminth-induced pathology. One such helminth is Trichuris trichiura (T. trichiura) which affects over 1 billion people worldwide, with the majority of those infected being young children [3]. Chronic T. Trichiura infection is associated with high morbidity for example; dysentery, rectal prolapse, anaemia and poor growth [3]. To date, there is no vaccine to provide immunity to helminth parasites, and much of the treatment depends on post-infection therapeutics [4]. Antihelminthic drugs such as albendazole and mebendazole have toxic effects to the parasite cytoskeleton [4]. In the case of hookworm infection, these drugs also are able to kill parasite ova, however, this is not the case with T. trichiura infection and despite altering ova shape T. trichiura remain infective [5]. Furthermore, there is growing concern that treatment with anti-helmintic drugs is selecting for resistant parasite strains [6]. As a result, a great deal of effort is now focused on the development of improved therapeutics and alternative infection management strategies. In order to develop such therapies we need a better understanding of the host immune response to infection, and to date, a large degree of our knowledge has come from the study of mouse models. Trichuris muris (T. muris) is a gastrointestinal dwelling whipworm whose system has been readily exploited in the lab as a tool for researching host responses to infection. In addition to its ease of maintenance in the lab, it has a good immunological homology to its human counterpart T. trichiura, and as a result, is now one of the most extensively studied helminths in the laboratory [7]. 1.2 Trichuris muris The whipworm T. muris is a natural infection of mice and has proven an important model system in deciphering the mechanisms surrounding resistance and immunity to helminth disease. Like T. trichiura, the T. muris lifecycle is sustained via faecal-oral transmission [7] (Figure 1). The host ingests infective, embryonated eggs which travel to the caecum where they hatch. Evidence has shown that the time from ingestion to hatching is quick, happening within 90 minutes of ingestion [8]. Furthermore, larvae appear to be primed to hatch only when they reach the caecum [9], where it has been shown that the host micro-biome has a major role [10]. Once hatched, larvae exclusively penetrate the epithelial layer at the base of the crypts [7, 11] in the large intestine Chapter One Introduction 19

20 (caecum and proximal colon). It has been suggested that the larvae secrete antigen with poreforming properties which aid the penetration of the epithelial layer and the maintenance of the parasite s syncytial tunnel environment [12, 13]. Within the large intestine the larvae undergo four moults during their life cycle [7]. At approximately day 35 post infection (p.i.) they reach sexual maturity and worms are visible by the naked eye. In accordance with the moults, the larvae move up the crypt axis so by D35 p.i. they are observed near the top of the crypt with their anterior ends burrowed into the epithelium and their posterior end extending out into the lumen to allow mating. Females release their eggs into the lumen which are excreted with the faeces [7]. Within 2 months the eggs have embryonated within the soil and are able to infect another host [7]. Chapter One Introduction 20

21 Figure 1 Trichuris muris lifecycle Embryonated eggs are ingested by the host and travel to the caecum where they hatch. The hatched larvae burrow to the base of the epithelial crypts. The larvae go through a series of four moults until they reach adult worms. Adult worms have their head ends burrowed in the epithelium with their tail ends free in the lumen for mating. Females release eggs into the lumen which then get passed out in the faeces. Eggs embryonate in the soil for between 6-8 weeks before they are infective and can be transmitted to another host. Chapter One Introduction 21

22 1.2.1 Immune response to T. muris Initial studies using outbred Schofield mice propelled the development of research in the T. muris field. Wakelin observed that over 70% of mice expelled infection with the other 30% being susceptible [8]. Further investigations with five more strains of outbred mice and one strain of inbred mice confirmed variation to resistance was dependent on host genetics [14]. Investigations then lead to defining the importance of T cell-driven host immunity to T. muris. Adoptive transfer of T cells from immune mice was able to transfer immunity to recipient mice [15]. In addition, thymectomised mice, lacking T cells, were susceptible to infection [16]. The treatment of mice with monoclonal antibodies either for the CD4 + or the CD8 + T cell populations, clearly defined a role for CD4 + T cells in protective immunity in T. muris infection [17]. Further experiments by Else and Grencis showed that CD4 + T cells alone were sufficient at mediating resistance in immunocompromised SCID mice [18]. Since the initial studies of the 70 s, the T. muris mouse model has been well characterised. It is now clear that there is definite variation in resistance and susceptibility to infection in inbred mouse strains. In the laboratory mice a spectral immune response is observed, with some mice being resistant to infection such as BALB/c, BALB/k, and NIH strains. Interestingly, C57BL/6 mice are termed slow responders [19] with mice exhibiting slower expulsion kinetics of infection compared to the fast responder BALB/c mice. Furthermore, within a group of C57BL/6 mice 10-20% of mice fail to expel which is likely due to the mixed cytokine responses observed during infection. Other strains, such as AKR and B10.BR mice, are completely susceptible to infection. Resistance and susceptibility are governed by the polarisation of the CD4 T helper cell response, such that, susceptibility is not caused by the total lack of an immune response, but rather, by the induction of an inappropriate immune response [20, 21]. A polarised T helper (Th) 1 cell response confers susceptibility, characterised by the production of the cytokines Interferon gamma (IFN-γ), Interleukin (IL)-12 and IL-18 [20-22] (section 1.2.2). A strong Th2 response is governed by the cytokines, IL-4, IL-13, IL-5, IL-9, and IL-10 [20-22] (section 1.2.3) and somewhat by the cytokine tumour necrosis factor alpha (TNFα). In addition to cytokine levels, the immunoglobulins produced during infection differs, with resistant mice producing high levels of IgG1 and susceptible mice IgG2a [22]. BALB/K mice initiate worm expulsion around D10-18 post infection (p.i.), whereas this happens a little later in C57BL/6 mice at around D12-D21 p.i., however, both strains fully clear infection by D35 p.i. Contrary to this, susceptible mice do not clear infection and go on to harbour chronic infection which is coupled by increased pathology. Chapter One Introduction 22

23 We can further manipulate the host immune response depending on the dosage of infective eggs administered. Wakelin made the first observations that low level infections of about 10 eggs rendered normally resistant mice susceptible to infection [23]. Since then further investigations have supported these finding by showing that in BALB/K mice infected with <40 eggs, worms can survive and reach sexual maturity [24] which is characterised by a down regulation of the Th2 cytokines IL-4, IL-5 and IL-9 and up-regulation of Th1 responses [24]. Interestingly, the immune response can be primed in a primary infection which later then determines the outcome of a secondary infection. Where resistant mice are given a primary high dose infection (~ eggs), followed by treatment with anti-helminthic drugs and subsequently challenged with a high dose infection, the mice were able to expel infection at an increased rate [19]. However, if the primary infection was a low dose infection, the host was unable to expel the subsequent high dose infection [19]. The administration of high dose is a relatively artificial infection dosage. It is more likely that repeated small infections are more representative of how the human population is infected with T. trichiura. Such an experiment was done in T. muris infection using repeated low level trickle infections. In this study, resistance could be initiated but to a lesser effect that if the mice were given one high dose infection [19]. This is more readily seen in BALB/K mice compared with C57BL/6 mice, highlighting differences in host genetics and the influence on immunity [19]. There are currently three main laboratory isolates of T. muris; the E (Edinburgh) isolate, which is the most extensively studied, the J (Japan) isolate and the S isolate (discovered in Sobreda, Portugal). Interestingly the outcome of infection can be determined by the isolate used [25]. The C57BL/6 mice is resistant to infection with the E isolate, but develops long term infection with the S isolate [25]. S isolate susceptibility has been correlated to reduced IL-4 and increased IFN-γ levels [26]. The ability of the S isolate to survive has been suggested to be due to its ability to prime macrophages and DCs to produce more IL-6 and IL-10 in comparison to the E and J isolates [27]. However, this T. muris-isolate-specific response is only observed in some mouse strains, as BALB/c mice are able to mount a strong Th2 response to both J and S isolates and expel infection suggesting that host genetic background is more significant in resistance than parasite strain [28] Chapter One Introduction 23

24 1.2.2 Cytokines associated with susceptibility to T. muris IFN-γ and IL-12 The Th1 immune response is associated with the cytokines IFN-γ and IL-12 which are strongly associated with a susceptible phenotype in T. muris infection [20, 21]. Evidence for IFN-γ involvement in susceptibility came from work done by Else et al who showed that depleting IFN-γ in susceptible mice conferred resistance with mice showing a switch to a Th2 polarised response [29]. In concordance with this, administration of recombinant IL-12 resulted in a chronic, susceptible phenotype [30] which correlated with up-regulation of parasite specific IgG2a. Interestingly, IL-12 administration could be delayed up to a week post infection and still revert the host to a susceptible phenotype [30]. Consistent with the knowledge that IL-12 induces IFN-γ [31] is the finding that the administration of IL-12 in conjunction with anti-ifn-γ monoclonal antibody completely abrogates the induction of a susceptible phenotype in T. muris infection [30]. IL-18 IL-18 belongs to the IL-1 cytokine family and binds the IL-18 receptor (IL-18R) to promote IFN-γ production. It is therefore unsurprising that IL-18 also has a role in susceptibility to infection. IL-18 deficient mice are resistant to infection, including low dose infections which are normally Th1 driven [32] suggesting that IL-18 plays a role in polarising the Th1 response. Indeed, IL-18 mrna in the large intestine is up-regulated early on in infection, before IL-12 and IFN-γ. IL-18 is thought to promote Th1 immunity by down regulating the Th2 cytokine IL-13 [32]. In addition, the administration of recombinant IL-18 to resistant mice renders the mice susceptible which is correlated with a down regulation in IL-4 and IL-13 production [32] Cytokines associated with resistance to T. muris infection IL-4 IL-4 has been shown to be a key mediator in host immunity to T. muris as shown by numerous experiments using blocking antibodies or knockout mice. Treatment of mice with monoclonal antibodies against the IL-4 receptor (IL-4R) rendered mice susceptible to infection [29]. Furthermore, treatment of normally susceptible AKR mice with an IL-4 complex designed to increase the magnitude and duration of IL-4 activity, conferred resistance in these animals [29]. Similarly, IL-4 deficient mice are highly susceptible to T. muris infection with decreased levels of Chapter One Introduction 24

25 IL-5, IL-9 and IL-13 [33]. Interestingly, female IL-4KO mice on a BALB/c background are resistant to infection whereas male IL-4 KO on the same background are susceptible [34] suggesting sexdetermined resistance to infection. However, unlike female IL-4 KO mice on the BALB/c background, female IL-4 KO mice on a C57BL/6 background are susceptible to infection thus, highlighting the effect of strain background on parasite expulsion [34]. IL-13 In addition to IL-4, IL-13 has also been shown to have an important role in T. muris expulsion. IL- 13 is part of the IL-4 family of cytokines and binds to the IL-4 receptor alpha chain, which, most likely explains why it also has a strong role in host immunity to helminths [33, 35]. Like IL-4 KO mice, IL-13 KO mice are unable to expel parasite infection, regardless of being able to develop a Th2 cytokine profile [33]. Moreover, IL-13 treatment can enable male IL-4 KO mice to expel T. muris infection [33]. The observation that female IL-4 KO mice on a BALB/c background were resistant to infection was subsequently shown to be due to production of IL-13 [33] TNFα Interestingly the cytokine TNFα, although not a Th2 cytokine, has also been shown to have a role in mediating host resistance to T. muris although the data is somewhat controversial. Administration of anti-tnfα monoclonal antibody to normally resistant mice caused a significant delay in worm expulsion, although complete susceptibility was not confirmed, and the Th2 cytokine production was not dramatically hindered [36]. Further work from the same group showed that mice lacking the TNFα receptors, p55 and p75, had reduced Th2 cytokines in response to T. muris infection and were unable to expel the parasites [36]. However, later experiments showed that of the p75 -/- and p55 -/- mouse strains p55 -/- mice were more susceptible to T. muris infection [37]. Interestingly, female p55 -/- and p75 -/- mice were resistant to infection unlike their male counterparts, thus again highlighting gender differences in resistance to infection [37]. As IL- 13 was previously shown to be involved in female resistance to infection [33], experiments assessed IL-13 levels in female and male p55 -/- and p75 -/- mice. Both sexes produced IL-13 in response to T. muris, however females produced it earlier and at higher levels. Males produced equivalent amounts of IL-13 compared to male WT animals but higher levels of IFN-γ suggesting that the overall balance of the cytokine environment is the most critical factor in conferring resistance to infection [37]. This work further supports the hypothesis that TNF-α receptor signalling is important in resistance to T. muris with either p55 or p75 being sufficient to confer parasite expulsion [37]. However, the p55 receptor seems the more dominant TNF-α receptor in resistance [37] Further Chapter One Introduction 25

26 experiments have shown that blocking TNFα function impeded resistance to infection [36], however, paradoxically, administration of recombinant TNFα (rtnfα) does not promote worm expulsion in susceptible mice [38]. In fact, rtnfα promoted Th1 cytokine induction in susceptible mice and Th2 cytokine induction in resistant mice. In addition, blocking TNFα in mice that are already able to mount a strong Th2 response, such as a BALB/c, does not render them susceptible [38] contrary to previous findings in C57BL/6 mice that lacked TNF receptors [36]. These conflicting results may reflect the differences in the susceptibility and immune response of different mouse strains to T. muris. In addition, the data also suggested that TNFα acts to potentiate the on-going immune response and does not preferentially drive Th1 or Th2 [38]. This may be true when the immune response will be highly polarised towards either a Th1 or Th2 response as seen in AKR and BALB/c mice [20, 21], However, where the immune response is a mixed Th1/Th2 profile, such as in the C57BL/6 mouse, the role of TNF-α may be more crucial in governing host resistance to infection. IL-9 CD4 T cells also produce IL-9 which has been linked to parasite resistance. It is thought that IL-9 functions early on in infection to promote Th2 induction. IL-9 gene expression in the mesenteric lymph nodes (MLN) is observed only in resistant mice. Administration of IL-9 to C57BL/6 mice prior to infection was shown to reduce parasite burden and promoted Th2 induction [39]. Furthermore, IL-9 over-expressing transgenic mice display accelerated T. muris expulsion [39]. Blocking IL-9 in normally resistant mice prior to infection rendered mice susceptible [40]. Collectively, these data imply that IL-9 is a strong promoter of T. muris immunity. IL-10 Primarily, IL-10 appears to regulate inflammatory responses as shown by the observation that IL- 10KO mice spontaneously develop colitis when kept in specific pathogen free (SPF) conditions [41]. However, IL-10 has also been shown to control growth and differentiation of numerous cell types and promote resistance to infection [42]. IL-10 is a fundamental cytokine in helminth immunity and has been implicated in host resistance and survival in T. muris infection. IL-10 KO and IL-10/IL-4 KO mice infected with T. muris developed a chronic infection. Furthermore, infected IL-10 KO animals exhibited striking pathology akin to inflammatory bowel disease and host survival was impaired [43]. A marked increase in Th1 cytokines was observed in infected IL-10 KO and IL-10/IL- 4KO mice which is the likely cause of susceptibility in these animals [43]. The mortality observed in IL-10 KO and IL-10/IL-4KO mice was associated with increased inflammation, a decrease in Paneth Chapter One Introduction 26

27 cell numbers, and impaired mucus production [43]. In contrast, the authors used a further KO strain that was deficient in IL-10 and IL-12 (IL-10/IL-12) and these mice were resistant to infection mounting a strong Th2 response which implies that the increased susceptibility of IL-10 KO mice was dependent on IL-12 [43]. A role for DCs in IL-10 mediated immunity of T. muris infection has been postulated. Data from different investigations showed CD11c + cells in the MLN of mice infected with T. muris were making IL-10 with a peak at D20 [44] resistance to infection [45]. IL-10 produced by DCs is thought to drive Th2 responses by down-regulating Th1 responses [44]. In contrast to the hypothesis that DCs produce IL-10 to promote host resistance, D Elia et al showed that marked increased levels of IL- 10 in response to T. muris actually aids parasite survival [27]. However, it should be noted that this was only observed for one isolate of T. muris, (the S isolate), but not for the other two lab isolates of T. muris thereby implicating parasite-strain-specific differences in immunity. Thus, the role of DC mediated IL-10 production in T. muris infection remains unclear. By using IL-10 floxed -CD11c-Cre mice this thesis aims to determine the role of DC mediated IL-10 production in the regulation of infection-induced pathology Effector mechanisms associated with resistance to T. muris infection There are a plethora of effector mechanisms involving numerous cells types which aid T. muris expulsion. This thesis focuses on the role of macrophages and DCs and their interaction with epithelial cells. However, I will first give an overview of other cells and mechanisms that are associated with the induction of Th2 driven immunity and resistance to helminth infection Granulocytes: Eosinophils and basophils Eosinophilia is associated with many helminth infections and eosinophils have critical effector functions such as the release of toxic mediators, phagocytosis and antigen presentation [46]. However, the role of eosinophils in host resistance is somewhat unclear as ablating eosinophilia during infection does not necessarily impact on host immunity [47-49]. Mouse strains resistant to T. muris develop eosinophilia in the large intestine [50] and draining lymph nodes [51] whereas susceptible AKR mice only develop a weak and delayed eosinophilia in the MLN [51]. The Th2 cytokine IL-5 promotes eosinophilia [52, 53] but blocking IL-5 in vivo does not render resistant mice susceptible to T. muris infection [50]. Furthermore, IL-5 transgenic mice lacking eosinophils were able to mount an IL-4 driven Th2 response and expel T. muris infection [51]. These combined findings suggest eosinophils do not play a crucial role in host resistance to T. muris infection. Chapter One Introduction 27

28 [54, 55] Basophils are recruited to tissues and secondary lymphoid organs during helminth infections and clearly help the development of a Th2 response, however, the dependence of the immune system on basophils to govern resistance to infection is controversial. In Nippostrongylus brasiliensis (N. brasiliensis) infection, basophils are involved in the promotion of systemic eosinophilia and effective worm expulsion [55]. Indeed, the majority of basophil deficient mice, but not all, showed impaired expulsion of N. brasiliensis [55]. However, as some basophil deficient mice did not have impaired explusion of N. brasiliensis, there may be other effector mechanisms at play. Work from two other groups suggested a more significant role for basophils in immunity than originally thought with studies suggesting they acted as professional antigen presenting cells. [56, 57] Basophils were capable of promoting CD4 + T cell proliferation in vitro and in vivo in response to S. mansoni egg injection [56]. Further work by a different lab demonstrated that basophils express the necessary machinery to activate T cells (MHCII and CD40 and CD86) and indeed were able to induce Th2 differentiation in vitro and in vivo using a model allergy antigen papain. [57]. Basophil depletion was shown to impair resistance to T. muris infection and was associated with a reduction in Th2 cytokines such as Il4 mrna in the colon [56]. Nevertheless, levels of IL-4 in the colon were still increased over naïve, suggesting basophils are not the only driver of IL-4 production. With regards to a role for basophils in host resistance to infection with T. muris, worm burdens were found to be higher in basophil deficient animals but not to any significance. Furthermore, worm burdens were only assessed at D21 post infection, and analysis at D35 post infection would need to be done to conclude full susceptibility to T. muris as worm burden analysis at D21 post infection may only indicate delayed expulsion. The role of basophils was further addressed in N. brasiliensis infection. Basophils were rapidly recruited to the MLN of mice during N. brasiliensis infection via an IL-3 dependent mechanism [58]. However, although IL-3 -/- mice infected with N. brasiliensis had dramatically reduced basophil numbers in the MLN, the development of the Th2 response was unimpaired [58]. The work did not show whether the IL-3 -/- mice were susceptible to N. brasiliensis infection, however, given the fact that the resistant Th2 response was still present you would hypothesise not. Given the somewhat ambiguous role of basophils in N. brasiliensis and T. muris infection, collectively, the studies to date may indicate that basophils act as potent accessory cells in driving the immune system towards Th2, so where absent Th2 responses are, to a degree, impaired and where present Th2 responses are augmented. Work supporting this hypothesis was recently done which demonstrated that although basophilia was associated with Litmosoides sigmodontis infection, Chapter One Introduction 28

29 basophil depletion dampened the Th2 response but did not impact on host susceptibility to infection [59] Mast Cells Mast cells are major effector cells in the immune response to infection, driving pro-inflammatory responses via the release of inflammatory mediators [60]. They are widely distributed throughout tissues but most frequent at barrier surfaces such as the skin and intestinal mucosa [60] making them key candidates in mediating the expulsion of gastrointestinal helminths as shown for the small-intestinal dwelling parasite Trichinella spiralis [61]. Irrespective of resistance to infection, all mice infected with T. muris develop an identifiable mastocytosis in the colon [62]. Furthermore, in vivo administration of anti-c-kit antibody, that blocks mast cell precursor migration from the bone marrow and thus accumulation in the gut, did not render mice susceptible to T. muris infection [50]. However, mice that lack mast cells have diminished Th2 responses and increased parasite burdens compared to wild type animals in response to T. muris infection [63]. Furthermore, early production of the tissue-derived cytokines IL-25, IL-33 and thymic stromal lymphopoietin (TSLP) all of which have been shown to have role in Th2 polarisation (Section ), was impaired in colonic intestinal tissue following T. muris infection in mast cell deficient animals [63]. Finally, adoptive transfer of bone marrow from wild-type mice to repair MC deficiency increased production of tissue-derived cytokine and restored mast cell progenitor cell numbers. Furthermore, Th2 priming was restored suggesting that mast cells can prime type 2 immune responses via the regulation of IL-25, IL-33, and TSLP [63] Adaptive immunity: Antibody Production and B cells The role of antibody in T. muris infection is somewhat controversial. Observations in resistant mice have shown that B cells and antibody levels peaked at D14 post infection [64]. Furthermore, µmt mice, that lack B cells, are susceptible to infection [65]. Coupled together these findings prompted suggestions that B cells played a critical role in mediating resistance to infection. Furthermore, some studies showed that the transfer of serum from immune mice could confer immunity and accelerate worm expulsion [66, 67]. However, accelerated expulsion was only observed if the serum was transferred immediately before infection or early in infection (D3 p.i.) [68] However, conflicting studies have suggested B cells are not mediators of resistance. Lee et al showed the transfer of B cell enriched populations from MLNs of donor mice (infected and taken at D21p.i.) into recipient mice failed to promote parasite expulsion [15]. In addition, mice lacking the FcγR, and therefore cannot bind IgE or IgG nor generate antibody mediated cytotoxicity, are resistant to T. muris infection. Thus, the role of B cells in T. muris infection is somewhat confusing. The data, in part, points towards B cells and antibody not being crucial Chapter One Introduction 29

30 effector mechanisms in T. muris expulsion but more of an accessory component facilitating the resistant immune response The intestinal epithelium In addition to the cells which lie within in the epithelium, intestinal epithelial cells (IECs) themselves have been shown to have an important role in immunity to helminths. Primarily the epithelium acts as a physical barrier, linked to neighbouring cells by an array of proteins that make up tight junctions and desmosomes and thus creating a close knit, albeit dynamic, barrier [69]. In addition to barrier immunity, IECs can orchestrate a range of innate immune mechanisms to thwart pathogenic colonization. For example, the production of mucus from goblet cells and antimicrobial peptides such as defensins and cathelicidins from Paneth cells are all factors contributing to host immunity [70]. Intestinal epithelial cells (IEC) originate from stem cells found at the base of the crypt, these cells then move up the crypt until they reach the top where they are sloughed off into the lumen [71]. T. muris infection is associated with enhanced proliferation of epithelial stem cells [72]. A novel mechanism governing resistance to T. muris has been proposed, termed the epithelial escalator [71]. The findings came from the observation that resistant mice have increased colonic epithelial cell turnover which is hypothesised to prevent the parasite remaining in the epithelium. This mode of parasite expulsion is mediated by IL-13 [71]. Furthermore, in susceptible mice where a Th1 response dominates, IFN-y acting via CXCL10 induction serves to slow down epithelial turnover and promotes epithelial cell proliferation causing massive crypt hyperplasia [71]. How IECs respond to helminth infection and the mediators that enable their effective contribution to host immunity are still being investigated. T. muris has been shown to induce NF-κB activation in IECs in vitro [73] and in vivo [74]. The activation of NF-κB within IECs has been shown to be important in T. muris infection as mice with an IEC-specific deletion of the gene encoding IKKβ, and thus unable to activate NF-κB, were susceptible to T. muris infection [74]. The susceptibility was correlated with a poor Th2 induction, increased IFN-γ and IL-17 and colonic inflammation [74]. In addition, IECs secrete various chemokines and cytokines that have been suggested to play a role in the innate and adaptive immune responses. The interaction of epithelial cells with DCs is of particular significance and will be discussed later (section ) Goblet cell hyperplasia The mucus barrier in the intestine is one of the primary innate defences against invading pathogens. Goblet cell hyperplasia is seen in both susceptible and resistant mouse strains during Chapter One Introduction 30

31 T. muris infection [75]. The mucus secreted by goblet cells has been suggested to interfere with the parasite s ability to embed into the epithelium. The transcription factor NF-ĸB has been implicated as having an important role in not only the generation of Th2 responses in T. muris infection but also goblet cell hyperplasia [76]. NF-ĸB1 -/- mice are susceptible to infection and show a markedly impaired generation of intestinal goblet cells compared to wild type animals. However, NF-ĸB2 -/- mice, that are also susceptible to infection, mount a significantly higher goblet cell hyperplasia than that of NF-ĸB1 -/- suggesting that susceptibility is not solely down to goblet cell hyperplasia. In addition, whether or not NF-ĸB1 has a direct role on goblet cell hyperplasia is questionable as NF-ĸB1 -/- mice exhibited other markers of profound pathology, indicating that the reduced goblet cell hyperplasia could be secondary to other facets of the inflammatory response [76]. Recently, more convincing data implicating a role for the goblet cells and mucin production in resistance to infection has been shown. Muc2 deficient mice have a delayed goblet cell hyperplasia coupled with impaired T. muris expulsion [77]. Muc5ac, a mucin normally absent from intestinal mucosa, is up-regulated in T. muris infection and is a critical mediator in parasite expulsion [78]. Muc5ac KO mice are susceptible to T. muris infection despite having adequate levels of Muc2 and a strong Th2 effector response [78] Smooth Muscle Contractility It is hypothesised that increased contractility of the gastrointestinal mucosa would increase movement throughout the intestine and therefore create a more hostile environment for parasitic worms. There is evidence that the immune system influences muscle contractility such that mice that are deficient for CD4 and MHC-II have reduced muscle contractility during Trichinella spiralis infection [79]. Furthermore, alternatively activated macrophages (discussed in depth in section ) have been shown to influence the smooth muscle changes in helminth infection [80]. Investigations in T. muris infection have observed increased contractility of the intestine [81] which is thought to be IL-9-mediated [81]. 1.3 Macrophages and Dendritic Cells This thesis addresses the role of macrophages and DCs in two aspects of the immune response to T. muris. First of all I aim to address the role of macrophages and DCs in initiation of immunity to infection followed by their role in regulating infection induced pathology. As macrophages and dendritic cells are central to this thesis they will be discussed in depth in the following sections, and where possible relevance to T. muris infection discussed. Chapter One Introduction 31

32 1.3.1 Macrophages Since their first discovery in 1908 by Élie Metchnikoff, macrophages have been shown to be pleiotrophic cells with a critical role in the immune system. Macrophages are derived from monocytes in the bone marrow and are shown to populate almost all tissues in the body. Resident tissue macrophages are long lived and are actively involved in tissue homeostasis by the clearance of apoptotic cells and production of growth factors that they themselves can also react to [82]. Macrophages are generally typified by the expression of F4/80, Cd11b and low to intermediate levels of CD11c [83]. In addition a further subtype of macrophage expressing the marker CX3CR1 have been shown to be important in intestinal immunity, however the classification of them as macrophages instead of DCs is much debated (section ). Macrophages also express a wide range of PRRs that facilitate pathogen detection and initiate production of pro-inflammatory cytokines [84] In addition, to the direct elimination of pathogens through phagocytosis, macrophages can process and present antigen to primed T cells to orchestrate the adaptive immune response [84] Furthermore, macrophages have been shown to play roles as regulatory cells, the maintenance of tissue homeostasis and the resolution of pathology and tissue repair [85]. Resident tissue macrophages are inherently anergic as they do not produce proinflammatory cytokines in response to TLR ligands, however they retain the ability to actively scavenge for pathogenic threats thus maintaining and host defence function while maintaining homeostatic conditions [82]. However, tissue resident macrophages represent one subset in a heterogeneous pool that show a high degree of plasticity with an ability to develop functional properties that are specific to the infection-driven cytokine milieu [86]. In response to infection or injury induced stimuli there are thought to be two main types of macrophages; classically activated macrophages (CAM) and alternatively activated macrophages (AAM). However this classification system may be over simplified and three further subdivisions of macrophages have been described based on the cytokines that activate them. M1 macrophages (CAM) remain the classically activated group, however M2 macrophages are divided into M2a which reflect the typical AAM, M2b which are induced by immune complexes and release IL-10, and M2c which are induced by IL-10 and are termed deactivated macrophages [87] Classical macrophage activation Classical macrophage activation was the first branch of macrophage activation to be described [88]. Classically activated macrophage induction is promoted in a Th1 environment with IFN-γ playing a significant activation role [89]. In addition, TNFα, IL-12, IL-18 and microbial products such as lipopolysaccharide (LPS) promote classical activation [90]. Furthermore, CAMs are identified by the high level production of pro-inflammatory cytokines such as IL-1β, IL-12, IL-23, TNFα, CXCL-9, Chapter One Introduction 32

33 CXCL-10, CXCL-11, CXCL-16 [89], and low amounts of IL-10. CAMs exert their protective role against intracellular pathogens and tumours through L-arginine metabolism and the subsequent production of reactive oxygen and nitrogen intermediates such as nitric oxide (Figure 2) [90] AAM Murine alternatively activated macrophages (AAMs) are characterized by the up-regulation of the cell surface receptors IL-4Rα chain, mannose receptor (MR, CD206) and scavenger receptor, the expression of the genes Arg1 (encoding arginase), Retnla (encoding Fizz1/RELMα) and Chi3l3 (Ym1), and the transcription factor PPARγ (peroxisome proliferator-activated receptor) [90]. AAM and CAMs express similar levels of CD11a, CD40, CD54, CD58, CD80 and CD86 [86]. In contrast to CAMs, STAT6-dependent alternative activation most commonly occurs in the presence of IL-4 or IL-13, produced by Th2 cells and innate immune cells such as mast cells [90]. IL-4 inhibits the oxidative burst in macrophages that is important for killing intracellular pathogens [91]. Furthermore, IL-4 inhibits the production of the pro-inflammatory cytokines IL-8 [92], TNF [93] and IL- 1β [94] by macrophages and enhances up-regulation of the mannose receptor [95]. Further research demonstrated a role for IL-13 as well as IL-4 in the development of AAM [96]. IL-21 is another Th2 cytokine which has also been implicated in both the generation of Th2 immunity and the augmentation of AAM generation [97]. IL21R -/- mice have diminished Th2 responses to Nippostrongylus brasiliensis (N. Brasiliensis) [97, 98], Heligmosomoides polygyrus (H. Polygyrus) [98] and Schistosoma mansoni (S. mansoni) [97] along with decreased expression of genes for AAM [97]. In addition, AAM activation has been shown to be induced by IL-10 and glucocorticoids [99], apoptotic cells [100], tyrosine kinase receptors and parasite-derived glycoconjugate moieties [101]. AAMs and CAMs differ at the biochemical level in the way they metabolise the amino acid arginine. In CAM, IL-12 and IFN-γ promote the production of inducible nitric oxide synthase (inos) which generates nitric oxide (NO) through the metabolism of arginine [102]. AAM, however, produce the enzyme arginase which competes with inos for arginine. Arginase converts L- arginine into ornithine and urea. Ornithine is then metabolised into proline and polyamines by ornithine amino transferase (OAT) and ornithine decarboxylase (ODC) respectively [102]. Proline is involved in collagen deposition whereas polyamines are important in cell proliferation thus implicating AAM in fibrosis and wound healing [ ]. Chapter One Introduction 33

34 Figure 2 Differential cell surface expression and arginine metabolism of classically and alternatively activated macrophages. Classically activated macrophages (CAM) arise in a Th1 environment, express IFN-γR, and produce inflammatory cytokines such as IL-1β, IL-12, IL-23, TNFα, CXCL-9, CXCL-10, CXCL-11, CXCL-16 [89]. AAM usually arise in a Th2 environment, express mannose receptor and IL-4Rα and produce arginase and IL-10. AAMs and CAMs differ in the way they metabolise the amino acid arginine. CAM metabolised arginine via inducible nitric oxide synthase (inos) which generates nitric oxide (NO) and is important for killing intracellular parasites. AAM produce the enzyme arginase which converts L-arginine into ornithine and urea. Ornithine is then metabolised into proline and polyamines by ornithine amino transferase (OAT) and ornithine decarboxylase (ODC) respectively [102]. Chapter One Introduction 34

35 Alternatively activated macrophages in helminth infections Immunity to helminths is mediated by a strong CD4 + Th2 response with the cytokines IL-4 and IL- 13 playing a pivotal role. Thus, due to their development in a Th2 environment, AAMs have been shown to play an important role in immunity to extracellular pathogens such as helminths. Infection with the filarial parasites Brugia malayi (B. malayi) and Litmosoides sigmodontis (L. sigmodontis) elicits the recruitment of F4/80 + macrophages with AAM characteristics [ ] although at the time, these macrophages were termed NeMφ (nematode induced macrophages). Furthermore, IL-4 -/- mice were unable to induce NeMφ in B. malayi infection [113]. AAM have also been suggested to be important in N. brasiliensis infection by promoting parasite expulsion. Total macrophage depletion (via the administration of chlodronate loaded liposomes) or blocking arginase function (via pharmacological inhibitors) were shown to impair N. brasiliensis expulsion [80]. However, neither method truly addresses the AAM as chlodronate depletes all macrophages and pharmaceutical inhibitors deplete arginase 1 and arginase 2 function in all cells. During N. brasiliensis infection AAM have been detected as early as 4 days post infection in both SCID and wildtype mice, suggesting that AAM can be induced without the need for CD4 + T cell derived cytokines [114]. However, in SCID mice the levels of ym1, fizz1, and mrc1 dropped after D4 post infection suggesting the innate source of alternative activation was not sufficient to maintain AAM induction. Furthermore, SCID mice showed exacerbated inflammation after D8 post infection suggesting a role for AAM in the regulation of pathology in N. brasiliensis infection [114]. However, mice lacking the IL-4Rα chain on macrophages, and thus not able to respond to IL-4 or IL-13 and induce alternative activation are resistant to N. brasiliensis but susceptible to infection with S. mansoni [115]. In addition, the increased susceptibility was coupled by an increase in the number of CAM [115]. Several studies have highlighted a suppressive effect of AAM on lymphocyte proliferation in vitro [109] and in vivo in response to N. brasiliensis [116]. The suppressive effects were thought to be mediated by programmed death ligand-2 [116]. This observation was corroborated in B. malayi and L. sigmondontis [ ] infections, where NeMφ (AAM) inhibited T cell proliferation in vitro, via a cell-contact dependent mechanisms. Furthermore, during S. mansoni infection, F4/80 + macrophages induce CD4 + and CD8 + T cell anergy [117] also via a programmed death ligand, in this case PD1. [237]. Macrophages expressing the alternative activation marker arg1 have been shown to downregulate Th1-driven infection-induced pathology in a number of models [118, 119]. It has been suggested that the anti-inflammatory mechanisms of AAM only extends to Th1 cytokine driven Chapter One Introduction 35

36 inflammation as there is some evidence for AAM being pro-inflammatory in Th2 driven disease [102, 120]. However, contrary to this notion, Arg1-expressing macrophages were shown to act as suppressors of Th2 driven inflammation in S. mansoni infection [121, 122]. In the Arg1 flox/flox tie2-cre transgenic mouse, a marked inhibition of T-cell proliferation was demonstrated in response to S. mansoni, which was rescued by the addition of exogenous arginase. This work suggested that AAM locally deplete arginine within the granuloma environment and thereby inhibit Th2- mediated immune responses [122]. Thus, in this model AAM act as suppressors of Th2-driven inflammation and fibrosis. Thus far, AAM have been shown to be important in host resistance and the maintenance of pathogen induced pathology in helminth infections and one aspect of AAM function (arginase expression) during T. muris infection was investigated in this thesis. The over expression of arginase by AAM is beneficial to the host in Th2 infections, however, can be detrimental to the host in Th1 driven infections, such that, in leishmaniasis where a strong Th1 response is necessary for host protection, high expression of arginase is associated with the formation of chronic non-healing lesions [119]. It is thought that the expression of arginase causes the local depletion of L-arginine, thus inhibiting local Th1 and CAM activity [119]. Similarly in T. gondii infection, induction of Arg1 inhibited nitric oxide (NO) production by macrophages and thus promoted parasite survival [123]. Interestingly, it was shown that alternative activation of macrophages may have a detrimental role when it comes to concomitant infections. In cases where the helminth is the primary infection and induces the alternative activation of macrophages, the survival of a secondary bacterial infection can be promoted due to the enhanced phagocytic and decreased microbiocidal activity of the AAM. This has been shown in vivo with S. mansoni and L. major co-infections [124] and in vitro with AAM infected with Mycobacterium tuberculosis [125]. Furthermore, when mice suffering from Citrobacter rodentium-induced colitis were infected with H. Polygyrus they experienced exacerbated bacteria-induced colitis [126] AAM and T. muris Large numbers of macrophages infiltrate the gut in T. muris infection with higher numbers found in resistant BALB/C mice compared to susceptible AKR mice at D12 p.i [127]. Furthermore, mice deficient for the chemokine, CCL2 are more susceptible to T. muris infection which correlated with decreased macrophage infiltration into the gut [128]. However, these studies did not extensively characterise macrophages phenotypically or functionally and only used F4/80 and Chapter One Introduction 36

37 CD11b to define macrophages. Given the existence of different macrophage subsets with differing cell surface marker expression further examination is needed. Nevertheless, macrophage numbers do increase in T. muris infection which suggests macrophages may have a role in host resistance. As Arg1 expression is a key marker of AAM we set out to address whether arginase/arg1 gene expression was important during T. muris infection, however despite AAM numbers increasing upon infection with T. muris [129, 130], our published work showed that arginase and arg1-expressing macrophages are dispensable in T. muris infection (Chapter three) Dendritic cells Dendritic cells (DCs) are professional antigen presenting cells that are able to migrate to the site of infection, process antigen then prime naïve T cells in the lymph nodes. DCs are critical effector cells in many infections and as the study of DC function is central to this thesis, their function in the intestine will be examined in depth, before their role in T. muris infection are discussed Dendritic cell subsets in the gastrointestinal tract DCs are heterogeneous, such that, several DC subsets have been described in mice classified by an array of different markers based on surface markers, developmental pathways, maturation status and their functional involvement in immunity. CD11c was once regarded as an exclusive DC marker; however now it is clear that CD11c is expressed at low levels on other cell types such as macrophages and eosinophils [131]. It is generally accepted that there are three main classes of DC; conventional, inflammatory and plasmacytoid dendritic cells. Conventional DCs are CD11c high expressing cells that can be further divided into migratory DC subtype and lymphoid resident DCs based on the absence or expression of CD8α, CD11b and CD103. Conventional lymphoid resident DCs don t migrate and serve to present antigen to T cells within their respective lymph organ. In addition, lymphoid resident DCs display an immature phenotype, expressing low levels of surface MHC-II and CD86 contrasting with their migratory counterparts [132]. Lymphoid resident DCs are grouped into CD8α +, CD11b + and CD8α - CD11b - double negative DCs all of which have been identified in the Peyers Patch (PP) of the small intestine [133, 134]. As described in the small intestine, there are also CD8α - CD11b + and CD8α - CD11b - and DCs in the colon [135] which, unlike the small intestine, are more usually associated with the isolated lymphoid follicles (ILF) and colonic patches (CP) [136]. CD11c hi CD8α + CD11b - lymphoid DCs, although found in the small intestine, are not readily detected in the colon, although, some strains of mice have been shown to have very low numbers [136, 137]. Within the lamina propria (LP) of the small intestine, the majority of Chapter One Introduction 37

38 conventional DCs are CD11b + CD8α -[137], furthermore, approximately 80% of the CD11c hi LP DCs express CD103 (α E integrin) [137]. The CD103 + CD11b + CD8α - DCs, belong to the conventional DC populations group, but display a more migratory phenotype typical of a classical dendritic cell and are thought to sample antigen in steady state and be involved in the induction of tolerance. CD103 + DCs arise from DC committed precursors termed predcs [138] and are located in the LP of the small and large intestine, although in much higher numbers in the small intestine with their frequency decreasing further down the intestinal tract. Intestinal CD103 + DCs have been shown to have the specialised function of inducing gut homing receptors on lymphocytes which is thought to be in part mediated by retinoic acid signalling [ ]. Within the large intestine, the majority of resident DCs are found in small isolated lymphoid follicle structures (ILF) and colonic patches (CP) [144] and DCs are rare within the lamina propria and even more so in the epithelial layer [136, 145] contrasting with the small intestine. Furthermore, the ability to induce the gut homing receptor CCR9 on T cells was shown to be a preferential function of CD103 + DCs from the small intestine and not the colon. However, colonic DCs were able to induce α4β7 (another gut homing receptor) on T cells equivalent to DCs from the small intestine [146]. To add further complexity CD103 + DCs can be divided into CD103 + CD11b + and CD103 + CD11b - of which the latter are more abundant in the colon [147]. DCs that are not normally present in steady state have been shown to accumulate from monocytes in response to inflammatory stimulus. These are known as inflammatory DCs, monocyte derived DCs and TNF-iNOS DC (Tip DC) [148]. Some sources state that inflammatory DCs have been defined as expressing Gr1 stemming from their Gr1 + monocyte precursors. However, a more recent study has claimed that Gr1 is actually down regulated on monocytes as they take on the inflammatory DC phenotype [149]. Gr-1 + monocyte-derived inflammatory DCs, typified by the expression of E-Cadherin, have been shown to accumulate in the colon and small intestine in a model of T cell mediated colitis [150] and in the small intestine in response to Toxoplasma gondii infection [151]. To date the research surrounding inflammatory DCs shows that in steady state the numbers are low and only upon inflammation do the DC numbers increase to significant levels. However, what we can gather from the research so far is that inflammatory DC behaviour seems to be fairly comparable in both the small and large intestine. Plasmacytoid dendritic cells (pdcs) are completely distinguishable from conventional DCs. They express intermediate levels of CD11c along with B220. Plasmacytoid DCs produce high levels of interferon. Plasmacytoid DCs in the colon have been shown to be associated with ILFs [136], Chapter One Introduction 38

39 however, they are rare representing less than 5% of DCs. pdc populations in the small intestine expressing CD11c intermediate MHCII lo B220 + have also been shown in small populations within the LP [137]. Although, pdcs show different functionality to conventional DCs, CCR9 - pdc precursors are able to differentiate along a cdc pathway under the influence of GMCSF and other soluble factors that can be produced by the intestinal epithelium, which suggests some pdcs can develop from common DC precursors within the tissue [152]. Originally described as a DC, the exact classification of the CX3CR1 + cell type is much debated as due to their developmental pathway and non migratory ability it is argued that they would be better described as a macrophage [153]. Furthermore, CX 3 CR 1 expression has been shown to be limited to CD11c - CD11b + CD103 - F4/80 + and CD11c + CD11b + CD103 - F4/80+ macrophages in both the small and large intestine [154]. However, more recently it has been shown that CX3CR1 expressing cells are a heterogeneous population of cells that express varying levels of CX3CR1 [155]. Indeed, a population of DCs, so termed for their ability to present antigen to CD4 + T cells, are CD11b + CD103 - CX3CR1 intermediate and have been identified in the colon as being distinct from their CX3CR1 high F4/80 hi macrophage counterparts [155]. Such observations calls for the re-evaluation of the data surrounding CX3CR1 + cells, in particular, analysis of the expression levels of CX3CR1 to distinguish between macrophages and DCs. Nevertheless, in the small intestine CX3CR1 + cells have the unique ability to produce transepithelial dendrites that are able to extend through the [156, 157] epithelial barrier and directly sample the luminal contents at least in some strains of mice and the expression of CX3CR1 + is essential for this process. Furthermore, additional studies have shown that the CX3CR1-CX3CL1 axis is important in the retention of CD11b + F4/80 + cells in the small and large intestine [154]. Given the notion that these cells do not migrate they were termed macrophages rather than DCs and it is postulated that they sample the luminal contents and then pass on the antigen to other cells. The frequency of these CX3CR1 + cells varies along the intestine, with higher frequencies found in the jejunum and fewer numbers in the ileum, however numbers can be induced upon infection [158]. In comparison to the small intestine, the production of transepithelial dendrites in the colon is a rare event although has been observed [145]. However, the cells in this study were only identified with CD11c staining by immunohistochemistry so whether or not they express CX3CR1 + is uncertain. Furthermore, the large increase in CD11c + cell numbers observed post infection in the colon is likely to be due to epithelial-derived chemokine recruitment [145], and thus, it can be argued that these cells are characteristically a DC and not a macrophage due to their migratory behaviour. Interestingly, in a separate study, CX3CR1 + CD11c + cells have been identified in the large intestine, although the researchers were unable to identify Chapter One Introduction 39

40 the production of transepithelial dendrites by the CX3CR1 + CD11c + cells, nevertheless it can be hypothesised that the production of transepithelial dendrites does occur due to the involvement of in the transepithelial migration of salmonella to the caecal lamina propria [159] Dendritic cell migration In order to effectively orchestrate immune responses DCs need to be able to migrate. DC migration can take many forms. DC progenitors need to leave the bone marrow and enter the blood and tissue, circulating DCs move into tissue in response to chemotactic cues in steady state and inflammation, and within tissues DCs also have to display a certain level of motility to enable effective antigen sampling. Once antigen has been sampled and processed the primed DCs need to leave the tissue and enter lymphatics to enable migration to the draining lymph nodes to prime T cells [160]. DC migration has been extensively review by Alvarez et al [160] so for the purposes of this thesis I will only address DC recruitment to the tissue and their subsequent exit into the lymphatics, focussing primarily on the intestine Migration of DCs Under steady state conditions, DCs migrate constitutively to the intestinal lamina propria and subsequently to the draining lymph nodes. It is thought that under steady state conditions these DCs are involved in tolerance induction to commensal organisms and food antigens [160]. DCs induced to migrate in response to infection/inflammation are inducers of effector T cells [160]. In the PP of the small intestine a number of chemokines have been implicated in the recruitment of DCs under steady state conditions [161]. The factors that govern DC migration to the PP is, in part, dependent on the DC subset and the region of the PP. CD11b + DCs are attracted to the subepithelial dome (SED) by CCL9 [162] and CCL20 [133] whereas CCR7 up-regulation on these DCs correlates with their migration out of the SED and into the interfollicular regions IFR [133]. DCs that encounter antigen within the LP then need to migrate to the draining lymph nodes. In addition to DCs in the IFR of PP, DCs in the LP also express CCR7 which is needed for the entry of DCs into the afferent lymphatics suggesting that this chemokine receptor is crucial for the migration to lymph nodes [163]. Much of the data on DC migration is focussed on the migration of DCs away from the LP of the intestine towards the draining lymph nodes with very little being known about the exact mechanisms whereby DCs migrate out of the blood and into tissues. It is thought that circulating DCs respond to tissue-specific recruitment signals to either maintain resident populations in homeostasis or conditions of infection and/or inflammation [160]. DCs engage in integrin-mediated Chapter One Introduction 40

41 interactions with the vasculature that aids their translocation to the target tissue [164]. In addition, circulating inflammatory monocytes are able to differentiate into DCs and are hypothesised as one way in which DCs enter tissue [155, 165]. Effective DC migration to the large intestine has been shown to be associated with resistance to T. muris infection [145]. Resistant BALB/c mice exhibited a rapid DC migration to the large intestine within 24 hours post infection. Early DC recruitment was not observed in susceptible AKR mice or BALB/c mice rendered susceptible with a low dose T. muris infection [145]. Recruitment of DCs was dependent on epithelial derived CCL5 and CCL20 [145]. This highlights the importance for DC migration to the epithelium during T.muris infection. Effective recruitment to the epithelium may allow DCs to rapidly uptake antigens derived from the parasite or damage and then once matured, the DCs can migrate to lymph nodes to initiate immune responses. Indeed, this study showed that early recruitment was associated with earlier maturation of DCs [145]. In addition, to DC migration to the site of infection, DC migration to the MLN is also a factor associated with immunity to T. muris. Koyami et al observed expansion of CD11c + B220 - DCs in the MLN of resistant B10.BR mice at D20 post infection correlating with increased IL-4 and IL-13 levels and worm expulsion [45] Detection of helminth infection by DCs DCs are important in the induction of Th2 responses with the factors that initiate the DCmediated Th2 induction during helminth infection only just coming to light. There is evidence that parasitic products/antigen, host-derived factors and also response to damage caused by the parasites are able to drive Th2 induction via DCs [166]. Helminth derived molecules have been shown to mediate Th2 immunity via the ligation of pattern recognition receptors (PRRs), namely Toll Like Receptors (TLR, section 1.4). However, the validity of TLR engagement as a mechanism of Th2 induction via DCs is somewhat confusing with evidence for TLR dependent and independent mechanisms. One group showed that carbohydrate epitopes found in soluble egg antigen (SEA) from S. mansoni mediated Th2 immunity via TLR4 [167] whereas, contrary to this, other researchers found it induced Th2 immunity via mechanisms independent of TLR2, TLR4 and MyD88 [168]. There is also evidence for other PRRs, such as C-type lectins [ ] and scavenger receptors [172], in the initiation of Th2 immunity via DCs. PRR-independent mechanisms of DC modulation have also been investigated with evidence for the glycosylated RNase, omega-1, that is secreted by the schistosoma egg in driving DC-dependent Th2 responses [173]. Work with T. muris has provided evidence that signalling through TLR-4 or the MyD88 pathway actually promotes chronic helminth infection [174]. Thus, it may be that T. muris secretes products that can bind to TLR4 and activate Chapter One Introduction 41

42 the innate response in order to promote its own survival [174]. To further support this, it was previously shown that S. mansoni, secretes a phosphatidylserine molecule that is able to activate and alter DC function through TLR2 and pro-long parasitic infection [175]. Combined these data suggest both PRR dependent and independent mechanisms of Th2 induction via helminths. The PRRs studied so far are surface molecules, to date and importantly for this thesis no one has looked at the role of intracellular PRR in the initiation of type 2 immunity during helminth infection. Given that Trichuris muris can inhabit a partially intracellular niche, intracellular PRR could have some biological significance in this infection Driving Th2 responses by helminth-primed DCs DCs can respond to helminth-derived products by promoting Th2 cell differentiation both in vitro and in vivo. However, the mechanisms involved in enabling DCs to prime T cells towards Th2 are still unclear [176]. CD40 expression on DCs has been shown to be an important candidate for inducing Th2 responses to S. mansoni soluble egg antigen (SEA) both in vitro [177] and in vivo [178], The expression of Notch 1 and 2 by CD4 T cells prompted the notion that Notch signalling may mediate effector T cell function [179]. Indeed, the differential expression of the Notch ligands, Delta and Jagged, by DCs has been proposed to drive Th1 and Th2 differentiation respectively [179]. These findings were supported in vitro by the inability of jagged2 / DCs to polarise CD4 T cells towards Th2 [180]. However, it should be noted that when SEA-pulsed jagged2 / DCs were transferred into the footpads of recipient mice the ability of these DCs to induce a Th2 response was unimpaired, suggesting that other environmental factors exist in vivo [180]. Nevertheless, work using conditional inhibition of Notch signalling in CD4 + T cells, supported a role for Notch signalling in T cells for Th2 differentiation. Mice lacking Notch on CD4 T cells were unable to mount a protective Th2 response to T. muris and were therefore susceptible to infection [181]. An additional candidate in driving Th2 induction by DCs is OX40L. Conditioning of DCs by SEA induced OX40L expression on the surface of the DC in vitro which has been implicated as having a role in Th2 responses [182]. It has been shown that parasites induce TSLP and this has an important role in priming of Th2 immunity (section ). Interestingly, TSLP was shown to induce OX40L expression on DCs and that the expression of OX40L was utilised to promote proinflammatory responses mediated through TNF-α. However these experiments were done in vitro and it seems that OX40L expression on DCs drives full Th2 development, rather than Th2-polarisation in vivo [166, 183, 184] Regulation of the immune response by DCs As mentioned earlier (section ), DCs that migrate in steady state conditions are thought to mediate tolerance. DCs that traffic to the lymph nodes in steady state conditions have been shown to deliver antigen from commensal organisms [185]. In addition, CCR7 -/- mice, in which DCs Chapter One Introduction 42

43 can t exit the intestine, cannot induce oral tolerance [186]. An additional way of inducing regulatory mechanisms is via promoting the development of T regulatory (Treg) cells. Gut CD103 + DCs have an enhanced ability to induce FoxP3 + Treg cells, which in part has been shown to be dependent on retinoic acid and TGF-β [187]. However, later experiments showed that DCs expressing αvβ8 integrin activate TGF-β and to induced enhanced Treg development by CD103 + DCs independently of retinoic acid [188]. Indeed, the importance of αvβ8 integrin on DCs was shown in earlier experiments detailing that loss of αvβ8 integrin caused inflammatory bowel disease and agerelated autoimmunity in mice [189]. Thus lack of αvβ8 integrin caused an inability to activate latent TGF-β which subsequently resulted in a reduction in the frequency of Tregs [189]. An additional subset of DCs, termed regulatory DCs typified by low expression of CD11c, MHCII and co-stimulatory molecules [190] can promote anti-inflammatory immune responses via the production of IL-10 and TGF- [137, 191]. This thesis will address the role of IL-10 responses by DCs in the regulation of helminth-induced pathology DCs and T. muris The work on the importance of DCs in T. muris infection is conflicting. DC-derived IL-10 has been correlated with T. muris expulsion [44] which may be linked to the observations that IL-10 is an important driver of Th2 responses in T. muris infection [43] (section 1.2.3). The importance of the different subsets of DCs in T. muris infection is not well defined, in fact the importance of DCs in T. muris infection has been questioned. Indeed, CD103 -/- mice are resistant to infection with T. muris. [192] Furthermore, work by another group also suggested that DCs are of limited importance in resistance to T. muris infection. Studies using mice where MHC-II expression was restricted to CD11c + cells (MHC CDllC ) demonstrated that, in T. muris infection, there was a reduction in the magnitude of the Th2 cytokines produced by parasite antigen (ES) restimulated MLN cells [56]. IL-4, IL-13 and IL-5 production by restimulated MLN cells were reduced, however, it should be noted that only IL-5 showed reduction to significance [56]. Furthermore, the reduced Th2 response in MHC CDllC mice was associated with higher worm burdens compared to control animals. Thus, this data suggest that DCs alone are not sufficient for mounting an effective Th2 response. Interestingly, however, when MHC CDllC mice infected with T. muris were treated with a monoclonal antibody against IFN-γ, the Th2 cytokine response was restored [56]. This suggests that MHC class II positive DCs are regulated by Th1 cytokines and are only able to mount Th2 responses when the Th1 message is removed [193]. Chapter One Introduction 43

44 IECs have been show to be able to condition DCs through the release of mediators such as TSLP [194], which promotes specific Th2 responses. Therefore, the role of epithelial TSLP has been assessed in T. muris infection. T. muris induces up-regulation of TSLP mrna expression by IECs [74]. Epithelial expression of NFkβ is unsurprisingly involved in the production of TSLP and studies using mice lacking epithelial IKKb had lower levels of TSLP in response to T. muris. The lack of TSLP was hypothesised to be the main driver of the increased pro-inflammatory cytokine production by DCs in response to T. muris. [74] Moreover, deletion of the TSLPR in mice resulted in an over-expression of the pro-inflammatory cytokines IL12/23p40 in intestinal DCs and an inability to mount Th2 responses in T. muris infection [195]. As well as TSLP production, IECs have been shown to be potent producers of the IL-1 family member, IL-33 [196, 197]. IL-33 expression has since been shown to be up-regulated in IECs in early T.muris infection, and the administration of endogenous IL-33 promotes intestinal TSLP expression [196]. However, colonic epithelial cells (CECs) also produce TNFα and IFN-γ in response to T. muris with no clear differences observed between resistant and susceptible strains. [198] Thus, although much of the evidence supports the importance of epithelial cells in the induction of the Th2 response, it seems probable that epithelial cells also contribute to Th1 immunity. One possibility that may be important in priming Th2 immunity is the magnitude of the epithelial/dc response. DCs in the colon are scarce, but the few DCs that are present are located within the LP. This means that upon infection DCs must migrate to the epithelial layer in order to get the epithelial-derived signals. As mentioned previously (section ), IEC derived CCL2, CCL3, CCL5 and CCL20 were shown to promote rapid DC recruitment to the intestinal epithelium of resistant mice in T. muris infection [145]. Susceptible mice showed a reduced ability to mobilise DCs to the large intestine mediated through impaired epithelial chemokine secretion [145]. These data provide a mechanism by which the IECs recruit cells of the immune system to the site of infection. It is apparent that IECs actively respond to intestinal nematode infection but what is less clear is how IECs recognise parasites in order to orchestrate type 2 immunity. Some important candidates are the pattern recognition receptors. 1.4 Pattern Recognition Receptors Epithelial cells, as well antigen presenting cells, express several evolutionarily conserved and structurally related proteins called pattern recognition receptors (PRRs) that recognize specific pathogen associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS) or Chapter One Introduction 44

45 peptidoglycan (PGN) that are found on/in pathogenic and commensal bacteria. In addition, PRRs can also detect damage associated molecular patters (DAMPS) that are associated with tissue injury or cell death caused by inflammation and infection [199]. PRRs are an extensive family including Toll like receptors (TLRs), RIG-I-like receptors (RLRs), mannose receptors and Nod-like receptors (NLRs)l [200]. In the context of T. muris infection, the role of TLRs has been partially investigated (section ). This thesis will focus particularly on the cytosolic Nod-like receptors (NLRs). Nucleotide oligomerisation domain (NOD) proteins are members of the NACHT (domain present in NAIP, CIITA, HET-E and TP-1)-LRR (leucine-rich repeat) family (the NLR) of proteins [201]. The NLR family contains 22 proteins with the first and best characterized being Nod1 and Nod2 [202] both of which have important roles in immune responses [203]. However, for the purposes of this thesis I will only address Nod2 in detail PRRS and Trichuris muris Several helminth-derived products have been shown to signal through TLRS activating NF-κB [76, 204], however, no specific nematode PRR has been found. Importantly, MyD88 deficient mice are resistant to infection with T. muris and generate a strong Th2 response thus suggesting signalling through MyD88 is not essential for resistance to T. muris [174]. However, this does not rule out the possibility of other signalling pathways and other PRRs. In addition to PRRs recognising bacterial derived peptides, PRRs can also detect viruses and damage associated with infection, this then poses the question that they could also be involved in the recognition of parasitic helminths, either directly via parasite derived proteins or secreted products or indirectly through damage associate molecular patterns (DAMPs). This thesis aims to address this question by looking at the role of the PRR, Nod2 (section 1.4.2) and its role in the immune response to T. muris Nucleotide-binding oligomerization domain-containing protein 2 (Nod2) At least 58 different mutations in the Nod2 gene have been associated with disease, with the majority being linked to the inflammatory disorder, Crohn s disease [205]. However, Nod2 has been implicated in susceptibility to other diseases and infections (section ) The Nod2 protein belongs to the NLR family of proteins. Nod2 is encoded by the gene CARD15 and recognises a component of bacterial PGN, muramyl dipeptide (MDP) [206]. PGN is substantially thicker on gram positive bacteria compared to gram negative bacteria [207]. However, as PGN on the surface of both Gram-negative and Gram-positive contains MDP, Nod2 can recognise and initiate immune responses against most, if not all, bacteria [208]. Chapter One Introduction 45

46 Nod2 is expressed more commonly in epithelial cells and antigen presenting cells [209, 210], although lower expression in T cells [211] and neutrophils [212] have been described. Nod2 expression is higher in mature antigen presenting cells, and expression can be up-regulated in both antigen presenting cells (APCs) and epithelial cells in the presence of pro-inflammatory cytokines such as TNFα [209] and further enhanced with the addition of IFN-γ [213]. The in vivo epithelial expression of Nod2 is less well defined. Whereas mrna expression of Nod2 by epithelial cells is readily detectable, expression at the protein level is low making it hard to detect using antibodies available at present [208, 214]. Furthermore, epithelial expression of Nod2 may decrease over time as is shown in PBMCs [215]. However, the evidence we have to date illustrates that Nod2 is absent from the villus epithelium but present in the Paneth cells of the small intestine [215, 216]. Within the colon, Nod2 expression is thought to be highest in the dividing cells at the base of the crypts and absent or low in the non-dividing epithelial cells further up the crypt [217]. In terms of this thesis, these findings are important when considering the niche of the parasite T. muris which is found preferentially at the base of the colonic crypts. Elucidating the role of Nod2 in mediating responses to T.muris was a major aim of this thesis and is discussed in chapter Structure of Nod2 Nod2 shares a similar structure to other proteins in the NLR family of receptors. Nod2 is composed of a carboxy (C)-terminal LRR domain that is involved in recognition of its ligand MDP; a central NOD domain (also known as a NACHT domain), which facilitates self-oligomerization and has ATPase activity; and an amino (N)-terminal domain that is composed of two CARDs (caspase recruitment domain) that are involved in protein protein interactions for intracellular signalling (Figure 3). Several residues in the LRR region of Nod2 have been shown to be crucial for bacterial recognition, indeed, mutations in these regions result in deficient MDP recognition [218]. The NOD domain is thought to be involved in signalling and/or regulation of Nod2 as mutations in this region cause constitutive activation of Nod2 [218]. Chapter One Introduction 46

47 Figure 3 Structure of Nod2 Nod2 is a cytosolic pattern recognition receptor that is composed of three main domains: a Leucine rich repeat (LRR) domain, which is involved in the recognition of its ligand, MDP; a central Nod domain which facilitates self-oligomerization and thus Nod2 activity; and two CARDs (caspase recruitment domains) which are involved in protein protein interactions for intracellular signalling. Chapter One Introduction 47

48 Signalling pathway of Nod2 Initiating Nod2 signalling At present there is little evidence surrounding the mechanics of how cells deliver pathogen components to Nod2. In epithelial cells, however, there is the possibility of the involvement of the peptide transporter, PEPT1 [219] in the delivery of MDP to Nod2. However, this may not be the method of MDP uptake in APCs [220], instead, an endocytosis mechanism dependent on clathrin and dynamin has been demonstrated [220]. This provides scope to believe that APCs can uptake the entire pathogen and digest them in phagolysosomes generating peptide ligands [208]. Nod2 activation of the NF-κB pathway Nod2 is present in the cytosol, maintained in an inactive state by molecular interactions that cause the LRR region to be folded in such a way that it stops the NOD domain from selfoligomerisation [218]. Indeed, mutations in which these interactions are disturbed result in a form of Nod2 that is constitutively active [218]. Although MDP has been shown to be crucial for Nod2 activation, direct evidence of the binding of the LRR domain to MDP is still to be defined [210, 218]. Thus, at present it is only postulated that the interaction of the LRR region with bacterial components causes conformational changes within Nod2 allowing oligomerisation of the Nod proteins [208, 218]. The idea of this conformational change is inferred from observations with the structurally related NLR family member, APAF1 [221] and the observation that Nod2 undergoes selfoligomerisation [218]. The self-oligomerisation of Nod2 then results in the recruitment of the serine/threonine kinase Rip2 (also known as RICK, CARDIAK) which directly binds to Nod2 through CARD-CARD interactions [222, 223]. Furthermore, Rip2 has been shown to be essential for Nod2 mediated NF-κB activation [218]. Following recruitment, RIP2 directly interacts with, and promotes the polyubiquitination of IKKy which is part of the IκB (inhibitor of NF-κB) kinase (IKK) complex [224, 225]. This subsequently results in the phosphorylation of IKKβ and the IκB subunit causing the release of NF-κB from its inhibitor, IκB allowing NF-κB translocation to the nucleus. Following this, NF-κB activates signalling pathways and the up-regulation of inflammatory gene transcription (Figure 4) [226]. The mechanisms underlying down regulation of this signalling pathway is unclear. Caspase-12 and MEKK4 have been shown to down-regulate Nod2 signalling by disrupting Nod2/RICK CARD-CARD interactions [226]. In addition the cell polarity protein, Erbin, has been shown to inhibit Nod2 activation [226]. Finally, it can be suggested that Nod2 activity can be modulated by the direct NOD-NOD and CARD-CARD interactions between Nod2 and other structurally related proteins [208]. Interestingly, Nod2 contains a NF-κB consensus sequence that is responsive to TNFα which suggests that upon activation Nod2 activates NF-κB which in turn Chapter One Introduction 48

49 promotes the further up-regulation of Nod2 itself through TNFα production, thus creating a positive feedback loop of Nod2 expression [209]. Furthermore, Nod2 expression has been shown to be regulated by transforming growth factor β-activated kinase 1 (TAK1) with data showing TAK1 as an essential intermediate of NOD2 signalling in keratinocytes [227]. This role of TAK1 was only shown in vitro however, and whether this is also true for intestinal epithelial cells remains to be investigated. Nod2 has also been shown to signal via NF-κB independent mechanisms. Nod2 activation can also result in the activation of MAP kinase pathways resulting in the induction of AP-1 transcription factors as defined in Nod2 deficient macrophages that show an inability to activate ERK and p38mapk [214, 228]. Furthermore Nod2 has been shown to signal through mitochondrial antiviral signalling protein (MAVS upon recognition of viral peptides [229]. Chapter One Introduction 49

50 Figure 4 Nod2 Signalling Pathway Nod2 recognises MDP, a component of peptidoglycan through leucine-rich repeat (LRR) domains. This then activates Nod2 and causes the recruitment of the receptor-interacting serine/threonine kinase (Rip2) which directly binds to Nod2 through caspase-recruitment domain (CARD) CARD interactions. This then leads to the polyubiquitylation of IKKγ, the scaffold protein of the inhibitor of NF-κB (IκB)-kinase complex (the IKK complex). Following this the phosphorylation of IKKβ, as well as the phosphorylation of IκB causes the release of nuclear factor-κb (NF-κB) for translocation to the nucleus and gene transcription. Nod2 signalling can also activate the mitogen-activated protein kinases (MAPKs) signalling pathway which involves molecules such as JUN amino-terminal kinase (JNK). Chapter One Introduction 50

51 Nod2 and TLRs TLR2 recognises PGN and Nod2 recognises the PGN component MDP, it is therefore unsurprising that Nod2 also impacts on TLR signalling. The question is however, whether Nod2 regulates or augments TLR signalling. A number of studies point towards Nod2 as being a negative regulator for TLR responses. Spleen-derived macrophages isolated from Nod2 mutant animals had exacerbated TLR2 responses, furthermore Th1 responses were also enhanced in response to PGN [230]. Additional studies in mouse peritoneal macrophages showed that knock down of Nod2 in macrophages caused cells to secrete more IL-1β than normal macrophages in response to PGN [231]. In addition, macrophages cultured with MDP and PGN were found to secrete less IL-1β, had lower levels of IL-1β mrna and had lower pre-il-1β levels than macrophages stimulated with PGN alone [231]. These data suggest MDP signalling via Nod2 down-regulates TLR2 mediated signalling [230, 231]. Contrary to the above findings other groups have shown a synergistic effect of Nod2 with other TLRs. Wild-type and Nod2 / bone marrow derived macrophages were stimulated with the TLR agonists LPS (TLR4 ligand), Pam3CS(K) 4 (TLR2 ligand) and polyinosinic:polycytidylic acid (TLR3 ligand) in the presence or absence of MDP [228]. The synergistic effect of MDP and TLR ligands was absent in Nod2 / macrophages suggesting that Nod2 signalling is necessary [228]. Additional experiments observed that Nod2 synergises with TLR2 in response to MDP and PGN and enhances TNF, IL-1β, and IL-10 production [232]. Furthermore, peripheral blood mononuclear cells from patients with Nod2 mutations did not show any synergy with TLR2 ligands and had impaired cytokine secretion in response to the TLR2 agonists Pam3Cys and MALP2 [232, 233]. Thus, data surrounding the effects of Nod2 on TLR signalling remains disputed Nod2 in Intestinal epithelial cells Nod2 has also been shown to play a significant role in intestinal epithelial cell function. There is evidence that Nod2 mediates host protection to invasive bacteria via limiting bacterial survival inside epithelial cells [234]. Nod2 expression in the small intestine has been shown to be highest in Paneth cells and it has been suggested to regulate bactericidal secretions [215, 235, 236]. Nod2 [237, 238] deficient mice have been shown to have altered commensal bacterial populations compared to wildtype animals and an increased faecal bacterial load [236]. The increased bacterial content could therefore provide increased levels of PGN for TLR stimulation and thus contribute to the development of Crohn s disease. However, it should be noted that Nod2 -/- mice do not spontaneously develop Crohn s disease [214, 228] and therefore it is likely that there are additional factors at play other than an altered microbiota populations. Chapter One Introduction 51

52 Within the large intestine, Nod2 has been shown to be most highly expressed on epithelial cells at the base of the colonic crypts [217]. Moreover, the expression of Nod2 in colonic epithelial cells was shown to have an anti-apoptotic role and mediate cell survival [217]. Further studies suggested a role for Nod2 in epithelial cell homeostasis and that the integrity of epithelial barrier function may be altered in the absence of Nod2 [239]. With regards to my thesis, the location of Nod2 in the epithelial crypts suggests that Nod2 has potential to be involved in the recognition of the parasite T. muris. When larvae hatch in the colon they burrow into the base of the colonic crypts and form a syncitial tunnel within the epithelial cells. Thus, as the early stages of the parasite are intracellular, this may implicate a role for Nod2 in as a potential mediator in the initiation of the immune response to T. muris. Furthermore, epithelial cell turnover [71], which is reduced in Nod2 -/- mice, is important for host resistance to the parasite, implying that Nod2 -/- mice may be more susceptible to infection Nod2 in infection and disease Crohn s disease is the most common disease associated with mutations in Nod2 [240, 241], in addition, Blau syndrome [242], early onset sarcoidosis [243], graft versus host disease [244] and tissue transplant rejection [ ] have also been shown to be linked with Nod2 mutations. In the case of Crohn s disease, the mutations within Nod2 have been shown to be within the LRR region which then impacts on Nod2 s ability to recognise MDP effectively [240]. However, the downstream impact of impaired MDP recognition is debated, with there being several hypotheses to how Nod2 mutations then lead to the observed pathologies of Crohn s disease. One hypothesis involves the connection with Nod2 and autophagy. Autophagy is a process whereby cells internally degrade damaged organelles, long-lived proteins, and importantly intracellular bacteria [248]. Cooney et al provided data that showed that ligation of Nod2 by MDP induced autophagy in DCs and thus aided bacterial clearance [249]. Furthermore, they showed that Nod2 facilitates antigen presentation by DCs. Nod2 mediated autophagy by DCs is dependent on receptor-interacting serine-threonine kinase-2 (RIPK-2), autophagy-related protein-5 (ATG5), ATG7 and ATG16L1 [249]. DCs taken from individuals with the Crohn s disease-associated polymorphisms in NOD2 or the autophagy protein, ATG16L1, were unable to induce autophagy, and displayed impaired bacterial trafficking and antigen presentation [249]. Linking the ATG16L1 gene with Nod2 and autophagy, Travassos et al showed that Nod2 ligation recruits ATG16L1 to the plasma membrane at the site of bacterial entry [250]. In cells carrying a mutation for NOD2, defective recruitment of ATG16L to the plasma membrane was observed, coupled with impaired autophagy of bacteria [250] Taken together, these studies provide supporting evidence for the Chapter One Introduction 52

53 argument that Crohn s disease is mediated by a defect in bacterial processing and clearance, resulting in increased bacterial load and mucosal inflammation [251]. The possible role of Nod2 mediating autophagy in intestinal epithelial cells is an important question that remains to be investigated. As Nod2 is a sensor of bacterial derived MDP it is not surprising that Nod2 -/- mice have increased susceptibility to various bacterial pathogens such as Salmonella typhimurium [217], Citrobacter rodentium [252] and Listeria monocytogenes [203]. One mechanism by which Nod2 is involved in bacterial clearance could be via the induction of chemokines by cells of the intestine. This would subsequently cause the recruitment of inflammatory cells to the site of infection and mediate pathogen eradication. Indeed, during Citrobacter rodentium infection, Nod2 is responsible for mediating the production of CCL2 which in turn caused the recruitment of monocytes [252], such that Nod2 -/- mice had impaired recruitment of monocytes to the intestine and defective bacterial clearance [252]. However in these experiments the stromal compartment rather than the epithelium was the source of CCL2. Interestingly however, the role for Nod2 does not stop at bacterial detection with studies suggesting a role for Nod2 in the recognition of viral peptides [229]. Upon interaction of ssrna virus with Nod2 [229], Nod2 binds MAVS via its LRR region leading to interferon regulatory factor 3 (IRF3) activation and interferon gene expression [229]. However, how MAVs induces IRF3 expression is unknown to date. NF-κB has been shown to act synergistically with IRF3 therefore it is postulated that interferon production via Nod2-MAV interaction is augmented by NF-κB [229]. Thus, Nod2 deficient mice showed increased susceptibility to viral infection which was mediated via reduced IFNβ production. Furthermore, in a separate study, viral infection was shown to augment Nod2 signalling, which then impacted on the antibacterial responses in macrophages and host survival to secondary bacterial infection [253]. The function of Nod2 in parasitic infection is less clear, in Toxoplasma gondii infection two separate groups have shown a role for [254] and against [211] Nod2 in T cells in mediating host resistance to the parasite. One of the aims of this thesis is to address the factors that initiate the immune response to parasites, in particular the gastro-intestinal dwelling helminth T. muris. As T. muris physically burrows into the epithelium, the damage caused or the presence of the worm could trigger intracellular PRRs such as Nod2. Indeed, cellular membrane damage has been shown to be important in the activation of Nod2 [255]. If this is the case, Nod2 could be a key component of the innate immune response to T. muris. Chapter One Introduction 53

54 1.5 Conclusions and aims of the project Gastrointestinal helminths such as T. muris have a high global prevalence. Within the human population there are some people that, despite being in a parasite endemic country, are parasite free. On the other hand, some people are unable to expel the parasite and go on to harbour longer term chronic infection. In the laboratory, this spectrum of immune responses is replicated in in-bred mouse strains. The T cell responses to T. muris have been well characterised, however, knowledge surrounding how the immune response is initiated in response to T. muris is rather limited. PRRs, such as Nod2, have been shown to recognise both bacterial and viral products, and be involved in the chemokine mediated recruitment of inflammatory cells. Nod2 s location at the base of the crypts provided optimal positioning for the recognition of T. muris. Therefore, it is reasonable to suggest that Nod2 may have a role in the initiation of the immune response to T. muris. Following on from this, once the immune response has been initiated, highly orchestrated regulatory mechanisms need to be implemented to avoid overt damage to the host. DCs and macrophages are highly heterogeneous cell types with a plethora of roles in the immune system. AAM are not only involved in immunity to infection, but also in the regulation of pathogen induced pathology. DCs have also been shown to have regulatory functions via the generation of T-regulatory cells. As IL-10 is a potent regulatory chemokine, it is reasonable to suggest that the regulatory DC subset is able to manage parasite-induced pathology in T. muris infection via IL-10 mediated mechanisms. The global aim of the project is to investigate how the immune response is initiated during T. muris infection and then subsequently what factors mediate the resolution of infection-induced pathology. To address this, three key objectives have been set: 1. To investigate the initiation of the immune response to Trichuris muris and the factors that induce recruitment of immune cells to the site of infection. This aim is addressed using Nod2 -/- mice infected with T. muris (Chapter 2). The effects of Nod2 deficiency was assessed by analysis of the immune cell populations infiltrating the large intestine early on in infection. In addition, early expression of epithelial-derived chemokines were analysed and compared to infected wild-type control responses. Further analysis with in vitro colonic epithelial cell cultures were done to support the in vivo data. 2. To investigate the role of arginase and Arg1-expressing macrophages in resistance to T. muris infection Chapter One Introduction 54

55 This aim was addressed in chapter 3 using two methods to block arginase function to examine host resistance to T. muris infection. I used Arg1 flox/flox tie2cre mice and C57BL/6 mice treated with the arginase inhibitor, nor-noha, to investigate this aim (chapter 3). Several parameters were assessed including worm burden, parasite-specific antibodies, cytokine production by MLN restimulations and pathological parameters. 3. To investigate the role of DCs in the resolution of pathology in T. muris infection. This aim was addressed in chapter 4 using mice that had DCs that lacked the ability to produce IL- 10 production via dendritic cells as a regulator of chronic T. muris infection. Several parameters were assessed including worm burden, parasite-specific antibodies, cytokine production via MLN re-stimulations and histological parameters. Chapter One Introduction 55

56 References 1. Crompton, D.W.T., (1999), How Much Human Helminthiasis Is There in the World? The Journal of Parasitology. 85 3: p Bundy, D.A.P., (1988), Population Ecology of Intestinal Helminth Infections in Human Communities. Philosophical Transactions of the Royal Society of London. B, Biological Sciences : p Stephenson, L.S., Holland, C.V., and Cooper, E.S., (2000), The public health significance of Trichuris trichiura. Parasitology. 121 Suppl: p. S Abbas, A. and Newsholme, W., (2009), Diagnosis and recommended treatment of helminth infections. Prescriber. 20 6: p Maipanich, W., Pubampen, S., Sa-nguankiat, S., Nontasut, P., and Waikagul, J., (1997), Effect of albendazole and mebendazole on soil-transmitted helminth eggs. Southeast Asian J Trop Med Public Health. 28 2: p Diawara, A., Drake, L.J., Suswillo, R.R., Kihara, J., Bundy, D.A.P., Scott, M.E., Halpenny, C., Stothard, J.R., et al., (2009), Assays to Detect β-tubulin Codon 200 Polymorphism in Trichuris trichiura and Ascaris lumbricoides. PLoS Negl Trop Dis. 3 3: p. e Cliffe, L.J. and Grencis, R.K., (2004), The Trichuris muris system: a paradigm of resistance and susceptibility to intestinal nematode infection. Adv Parasitol. 57: p Wakelin, D., (1967), Acquired immunity to Trichuris muris in the albino laboratory mouse. Parasitology. 57 3: p Panesar, T.S. and Croll, N.A., (1980), The location of parasites within their hosts: Site selection by Trichuris muris in the laboratory mouse. International Journal for Parasitology. 10 4: p Hayes, K.S., Bancroft, A.J., Goldrick, M., Portsmouth, C., Roberts, I.S., and Grencis, R.K., (2010), Exploitation of the Intestinal Microflora by the Parasitic Nematode Trichuris muris. Science : p Lee, T.D.G. and Wright, K.A., (1978), The morphology of the attachment and probable feeding site of the nematode Trichuris muris Canadian Journal of Zoology. 56 9: p Drake, L., Korchev, Y., Bashford, L., Djamgoz, M., Wakelin, D., Ashall, F., and Bundy, D., (1994), The Major Secreted Product of the Whipworm, Trichuris, is a Pore-Forming Protein. Proceedings: Biological Sciences : p Drake, L.J., Barker, G.C., Korchev, Y., Lab, M., Brooks, H., and Bundy, D.A., (1998), Molecular and functional characterization of a recombinant protein of Trichuris trichiura. Proceedings. Biological sciences / The Royal Society : p Wakelin, D., (1970), The stimulation of immunity and the induction of unresponsiveness to Trichuris muris in various strains of laboratory mice. Parasitology Research. 35 2: p Lee, T.D.G., Wakelin, D., and Grencis, R.K., (1983), Cellular mechanisms of immunity to the nematode Trichuris muris. International Journal for Parasitology. 13 4: p Wakelin, D. and Selby, G.R., (1974), Thymus-dependency of the immune response of mice to a primary infection with the nematode Trichuris muris. International Journal for Parasitology. 4 6: p Koyama, K., Tamauchi, H., and Ito, Y., (1995), The role of CD4+ and CD8+ T cells in protective immunity to the murine nematode parasite Trichuris muris. Parasite Immunol. 17 3: p Else, K.J. and Grencis, R.K., (1996), Antibody-independent effector mechanisms in resistance to the intestinal nematode parasite Trichuris muris. Infection and Immunity. 64 8: p Chapter One Introduction 56

57 19. Bancroft, A.J., Else, K.J., Humphreys, N.E., and Grencis, R.K., (2001), The effect of challenge and trickle Trichuris muris infections on the polarisation of the immune response. Int J Parasitol : p Else, K.J. and Grencis, R.K., (1991), Cellular immune responses to the murine nematode parasite Trichuris muris. I. Differential cytokine production during acute or chronic infection. Immunology. 72 4: p Else, K.J., Hultner, L., and Grencis, R.K., (1992), Cellular immune responses to the murine nematode parasite Trichuris muris. II. Differential induction of TH-cell subsets in resistant versus susceptible mice. Immunology. 75 2: p Else, K.J., Entwistle, G.M., and Grencis, R.K., (1993), Correlations between worm burden and markers of Th1 and Th2 cell subset induction in an inbred strain of mouse infected with Trichuris muris. Parasite immunology : p Wakelin, D., (1973), The stimulation of immunity to Trichuris muris in mice exposed to lowlevel infections. Parasitology. 66 1: p Bancroft, A.J., Else, K.J., and Grencis, R.K., (1994), Low-level infection with Trichuris muris significantly affects the polarization of the CD4 response. Eur J Immunol : p Bellaby, T., Robinson, K., Wakelin, D., and Behnke, J.M., (1995), Isolates of Trichuris muris vary in their ability to elicit protective immune responses to infection in mice. Parasitology. 111 ( Pt 3): p Koyama, K. and Ito, Y., (1996), Comparative studies on immune responses to infection in susceptible B10.BR mice infected with different strains of the murine nematode parasite Trichuris muris. Parasite immunology. 18 5: p D'Elia, R. and Else, K.J., (2009), In vitro antigen presenting cell-derived IL-10 and IL-6 correlate with Trichuris muris isolate-specific survival. Parasite immunology. 31 3: p Johnston, C.E., Bradley, J.E., Behnke, J.M., Matthews, K.R., and Else, K.J., (2005), Isolates of Trichuris muris elicit different adaptive immune responses in their murine host. Parasite immunology. 27 3: p Else, K.J., Finkelman, F.D., Maliszewski, C.R., and Grencis, R.K., (1994), Cytokine-mediated regulation of chronic intestinal helminth infection. J Exp Med : p Bancroft, A.J., Else, K.J., Sypek, J.P., and Grencis, R.K., (1997), Interleukin-12 promotes a chronic intestinal nematode infection. European Journal of Immunology. 27 4: p D'Andrea, A., Rengaraju, M., Valiante, N.M., Chehimi, J., Kubin, M., Aste, M., Chan, S.H., Kobayashi, M., et al., (1992), Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells. J Exp Med : p Helmby, H., Takeda, K., Akira, S., and Grencis, R.K., (2001), Interleukin (Il)-18 Promotes the Development of Chronic Gastrointestinal Helminth Infection by Downregulating IL-13. The Journal of Experimental Medicine : p Bancroft, A.J., McKenzie, A.N.J., and Grencis, R.K., (1998), A Critical Role for IL-13 in Resistance to Intestinal Nematode Infection. The Journal of Immunology : p Bancroft, A.J., Artis, D., Donaldson, D.D., Sypek, J.P., and Grencis, R.K., (2000), Gastrointestinal nematode expulsion in IL-4 knockout mice is IL-13 dependent. European Journal of Immunology. 30 7: p Minty, A., Chalon, P., Derocq, J.M., Dumont, X., Guillemot, J.C., Kaghad, M., Labit, C., Leplatois, P., et al., (1993), lnterleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature : p Artis, D., Humphreys, N.E., Bancroft, A.J., Rothwell, N.J., Potten, C.S., and Grencis, R.K., (1999), Tumor Necrosis Factor α Is a Critical Component of Interleukin 13 Mediated Protective T Helper Cell Type 2 Responses during Helminth Infection. The Journal of Experimental Medicine : p Chapter One Introduction 57

58 37. Hayes, K.S., Bancroft, A.J., and Grencis, R.K., (2007), The role of TNF-α in Trichuris muris infection I: influence of TNF-α receptor usage, gender and IL-13. Parasite immunology : p Hayes, K.S., Bancroft, A.J., and Grencis, R.K., (2007), The role of TNF-α in Trichuris muris infection II: global enhancement of ongoing Th1 or Th2 responses. Parasite immunology : p Faulkner, H., Renauld, J.-C., Van Snick, J., and Grencis, R.K., (1998), Interleukin-9 Enhances Resistance to the Intestinal Nematode Trichuris muris. Infection and Immunity. 66 8: p Richard, M., Grencis, R.K., Humphreys, N.E., Renauld, J.-C., and Van Snick, J., (2000), Anti- IL-9 vaccination prevents worm expulsion and blood eosinophilia in Trichuris murisinfected mice. Proceedings of the National Academy of Sciences. 97 2: p Kuhn, R., Lohler, J., Rennick, D., Rajewsky, K., and Muller, W., (1993), Interleukin-10- Deficient Mice Develop Chronic Enterocolitis. Cell. 75 2: p Moore, K.W., de Waal Malefyt, R., Coffman, R.L., and O'Garra, A., (2001), Interleukin-10 and the interleukin-10 receptor. Annual Review of Immunology. 19 1: p Schopf, L.R., Hoffmann, K.F., Cheever, A.W., Urban, J.F., and Wynn, T.A., (2002), IL-10 Is Critical for Host Resistance and Survival During Gastrointestinal Helminth Infection. The Journal of Immunology : p Koyama, K., (2008), Dendritic cells have a crucial role in the production of cytokines in mesenteric lymph nodes of B10.BR mice infected with <i>trichuris muris</i&gt. Parasitology Research : p Koyama, K., (2005), Dendritic cell expansion occurs in mesenteric lymph nodes of B10.BR mice infected with the murine nematode parasite Trichuris muris. Parasitology Research. 97 3: p Behm, C.A. and Ovington, K.S., (2000), The Role of Eosinophils in Parasitic Helminth Infections: Insights from Genetically Modified Mice. Parasitology Today. 16 5: p Sher, A., Coffman, R., Hieny, S., and Cheever, A., (1990), Ablation of eosinophil and IgE responses with anti-il-5 or anti-il-4 antibodies fails to affect immunity against Schistosoma mansoni in the mouse. The Journal of Immunology : p Herndon, F. and Kayes, S., (1992), Depletion of eosinophils by anti-il-5 monoclonal antibody treatment of mice infected with Trichinella spiralis does not alter parasite burden or immunologic resistance to reinfection. The Journal of Immunology : p Urban, J.F., Katona, I.M., Paul, W.E., and Finkelman, F.D., (1991), Interleukin 4 is important in protective immunity to a gastrointestinal nematode infection in mice. Proceedings of the National Academy of Sciences : p Betts, C.J. and Else, K.J., (1999), Mast cells, eosinophils and antibody-mediated cellular cytotoxicity are not critical in resistance to Trichuris muris. Parasite immunology. 21 1: p Svensson, M., Bell, L., Little, M.C., DeSchoolmeester, M., Locksley, R.M., and Else, K.J., (2011), Accumulation of eosinophils in intestine-draining mesenteric lymph nodes occurs after Trichuris muris infection. Parasite immunology. 33 1: p Coffman, R.L., Seymour, B.W., Hudak, S., Jackson, J., and Rennick, D., (1989), Antibody to interleukin-5 inhibits helminth-induced eosinophilia in mice. Science : p Sher, A., Coffman, R.L., Hieny, S., Scott, P., and Cheever, A.W., (1990), Interleukin 5 is required for the blood and tissue eosinophilia but not granuloma formation induced by infection with Schistosoma mansoni. Proceedings of the National Academy of Sciences. 87 1: p Chapter One Introduction 58

59 54. Min, B., Prout, M., Hu-Li, J., Zhu, J., Jankovic, D., Morgan, E.S., Urban, J.F., Dvorak, A.M., et al., (2004), Basophils Produce IL-4 and Accumulate in Tissues after Infection with a Th2- inducing Parasite. The Journal of Experimental Medicine : p Ohnmacht, C. and Voehringer, D., (2009), Basophil effector function and homeostasis during helminth infection. Blood : p Perrigoue, J.G., Saenz, S.A., Siracusa, M.C., Allenspach, E.J., Taylor, B.C., Giacomin, P.R., Nair, M.G., Du, Y., et al., (2009), MHC class II-dependent basophil-cd4+ T cell interactions promote TH2 cytokine-dependent immunity. Nat Immunol. 10 7: p Sokol, C.L., Chu, N.-Q., Yu, S., Nish, S.A., Laufer, T.M., and Medzhitov, R., (2009), Basophils function as antigen-presenting cells for an allergen-induced T helper type 2 response. Nat Immunol. 10 7: p Kim, S., Prout, M., Ramshaw, H., Lopez, A.F., LeGros, G., and Min, B., (2010), Cutting Edge: Basophils Are Transiently Recruited into the Draining Lymph Nodes during Helminth Infection via IL-3, but Infection-Induced Th2 Immunity Can Develop without Basophil Lymph Node Recruitment or IL-3. The Journal of Immunology : p Torrero, M.N., Hübner, M.P., Larson, D., Karasuyama, H., and Mitre, E., (2010), Basophils Amplify Type 2 Immune Responses, but Do Not Serve a Protective Role, during Chronic Infection of Mice with the Filarial Nematode Litomosoides sigmodontis. The Journal of Immunology : p Galli, S.J. and Tsai, M., (2010), Mast cells in allergy and infection: Versatile effector and regulatory cells in innate and adaptive immunity. European Journal of Immunology. 40 7: p Donaldson, L.E., Schmitt, E., Huntley, J.F., Newlands, G.F.J., and Grencis, R.K., (1996), A critical role for stem cell factor and c-kit in host protective immunity to an intestinal helminth. International Immunology. 8 4: p Lee, T.D. and Wakelin, D., (1982), The use of host strain variation to assess the significance of mucosal mast cells in the spontaneous cure response of mice to the nematode Trichuris muris. International archives of allergy and applied immunology. 67 4: p Hepworth, M.R., DaniÅ owicz-luebert, E., Rausch, S., Metz, M., Klotz, C., Maurer, M., and Hartmann, S., (2012), Mast cells orchestrate type 2 immunity to helminths through regulation of tissue-derived cytokines. Proceedings of the National Academy of Sciences. 64. Koyama, K., Tamauchi, H., Tomita, M., Kitajima, T., and Ito, Y., (1999), B-cell activation in the mesenteric lymph nodes of resistant BALB/c mice infected with the murine nematode parasite Trichuris muris Parasitology Research. 85 3: p Blackwell, N.M. and Else, K.J., (2001), B Cells and Antibodies Are Required for Resistance to the Parasitic Gastrointestinal Nematode Trichuris muris. Infection and Immunity. 69 6: p Else, K.J., Wakelin, D., Wassom, D.L., and Hauda, K.M., (1990), MHC-restricted antibody responses to Trichuris muris excretory/secretory (E/S) antigen. Parasite Immunol. 12 5: p Selby, G.R. and Wakelin, D., (1973), Transfer of immunity against Trichuris muris in the mouse by serum and cells. International Journal for Parasitology. 3 6: p Wakelin, D., (1975), Immune expulsion of Trichuris muris from mice during a primary infection: analysis of the components involved. Parasitology. 70 Part 3: p Shen, T., Kim, S., Do, J.-s., Wang, L., Lantz, C., Urban, J.F., Le Gros, G., and Min, B., (2008), T cell-derived IL-3 plays key role in parasite infection-induced basophil production but is dispensable for in vivo basophil survival. International Immunology. 20 9: p Hecht, G., (1999), Innate mechanisms of epithelial host defense: spotlight on intestine. American Journal of Physiology - Cell Physiology : p. C351-C358. Chapter One Introduction 59

60 71. Cliffe, L.J., Humphreys, N.E., Lane, T.E., Potten, C.S., Booth, C., and Grencis, R.K., (2005), Accelerated intestinal epithelial cell turnover: a new mechanism of parasite expulsion. Science : p Artis, D., Potten, C.S., Else, K.J., Finkelman, F.D., and Grencis, R.K., (1999), Trichuris muris: Host Intestinal Epithelial Cell Hyperproliferation during Chronic Infection Is Regulated by Interferon-γ. Experimental Parasitology. 92 2: p Artis, D. and Grencis, R.K., (2008), The intestinal epithelium: sensors to effectors in nematode infection. Mucosal Immunol. 1 4: p Zaph, C., Troy, A.E., Taylor, B.C., Berman-Booty, L.D., Guild, K.J., Du, Y., Yost, E.A., Gruber, A.D., et al., (2007), Epithelial-cell-intrinsic IKK-beta expression regulates intestinal immune homeostasis. Nature : p Else, K.J. and Finkelman, F.D., (1998), Intestinal nematode parasites, cytokines and effector mechanisms. International Journal for Parasitology. 28 8: p Artis, D., Shapira, S., Mason, N., Speirs, K.M., Goldschmidt, M., Caamaño, J., Liou, H.-C., Hunter, C.A., et al., (2002), Differential Requirement for NF-κB Family Members in Control of Helminth Infection and Intestinal Inflammation. The Journal of Immunology : p Hasnain, S.Z., Wang, H., Ghia, J.E., Haq, N., Deng, Y., Velcich, A., Grencis, R.K., Thornton, D.J., et al., (2010), Mucin Gene Deficiency in Mice Impairs Host Resistance to an Enteric Parasitic Infection. Gastroenterology : p e Hasnain, S., Evans, C., Roy, M., Gallagher, A., Kindrachuk, K., Barron, L., Dickey, B., Wilson, M., et al., (2011), Muc5ac: a critical component mediating the rejection of enteric nematodes. J Exp Med : p Vallance, B.A., Galeazzi, F., Collins, S.M., and Snider, D.P., (1999), CD4 T Cells and Major Histocompatibility Complex Class II Expression Influence Worm Expulsion and Increased Intestinal Muscle Contraction during Trichinella spiralisinfection. Infection and Immunity : p Zhao, A., Urban, J.F., Jr., Anthony, R.M., Sun, R., Stiltz, J., van Rooijen, N., Wynn, T.A., Gause, W.C., et al., (2008), Th2 cytokine-induced alterations in intestinal smooth muscle function depend on alternatively activated macrophages. Gastroenterology : p e Khan, W.I., Richard, M., Akiho, H., Blennerhasset, P.A., Humphreys, N.E., Grencis, R.K., Van Snick, J., and Collins, S.M., (2003), Modulation of Intestinal Muscle Contraction by Interleukin-9 (IL-9) or IL-9 Neutralization: Correlation with Worm Expulsion in Murine Nematode Infections. Infection and Immunity. 71 5: p Smith, P.D., Smythies, L.E., Shen, R., Greenwell-Wild, T., Gliozzi, M., and Wahl, S.M., (2011), Intestinal macrophages and response to microbial encroachment. Mucosal Immunol. 4 1: p Murray, P.J. and Wynn, T.A., (2011), Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol : p Biswas, S.K. and Mantovani, A., (2010), Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm. Nat Immunol : p Lucas, T., Waisman, A., Ranjan, R., Roes, J., Krieg, T., Müller, W., Roers, A., and Eming, S.A., (2010), Differential Roles of Macrophages in Diverse Phases of Skin Repair. The Journal of Immunology : p Reyes, J.L. and Terrazas, L.I., (2007), The divergent roles of alternatively activated macrophages in helminthic infections. Parasite Immunol : p Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M., (2004), The chemokine system in diverse forms of macrophage activation and polarization. Trends in Immunology : p Chapter One Introduction 60

61 88. Gordon, S., (2003), Alternative activation of macrophages. Nat Rev Immunol. 3 1: p Mosser, D.M., (2003), The many faces of macrophage activation. J Leukoc Biol. 73 2: p Fairweather, D. and Cihakova, D., (2009), Alternatively activated macrophages in infection and autoimmunity. J Autoimmun : p Abramson, S.L. and Gallin, J.I., (1990), IL-4 inhibits superoxide production by human mononuclear phagocytes. J Immunol : p Standiford, T.J., Strieter, R.M., Chensue, S.W., Westwick, J., Kasahara, K., and Kunkel, S.L., (1990), IL-4 inhibits the expression of IL-8 from stimulated human monocytes. J Immunol : p McBride, W.H., Economou, J.S., Nayersina, R., Comora, S., and Essner, R., (1990), Influences of interleukins 2 and 4 on tumor necrosis factor production by murine mononuclear phagocytes. Cancer Res : p Donnelly, R.P., Fenton, M.J., Finbloom, D.S., and Gerrard, T.L., (1990), Differential regulation of IL-1 production in human monocytes by IFN-gamma and IL-4. J Immunol : p Stein, M., Keshav, S., Harris, N., and Gordon, S., (1992), Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med : p Doyle, A.G., Herbein, G., Montaner, L.J., Minty, A.J., Caput, D., Ferrara, P., and Gordon, S., (1994), Interleukin-13 alters the activation state of murine macrophages in vitro: Comparison with interleukin-4 and interferon-γ. European Journal of Immunology. 24 6: p Pesce, J., Kaviratne, M., Ramalingam, T.R., Thompson, R.W., Urban, J.F., Jr., Cheever, A.W., Young, D.A., Collins, M., et al., (2006), The IL-21 receptor augments Th2 effector function and alternative macrophage activation. J Clin Invest : p Frohlich, A., Marsland, B.J., Sonderegger, I., Kurrer, M., Hodge, M.R., Harris, N.L., and Kopf, M., (2007), IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo. Blood : p Goerdt, S. and Orfanos, C.E., (1999), Other functions, other genes: alternative activation of antigen-presenting cells. Immunity. 10 2: p Freire-de-Lima, C.G., Nascimento, D.O., Soares, M.B.P., Bozza, P.T., Castro-Faria-Neto, H.C., de Mello, F.G., DosReis, G.A., and Lopes, M.F., (2000), Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages. Nature : p Morrison, A.C. and Correll, P.H., (2002), Activation of the Stem Cell-Derived Tyrosine Kinase/RON Receptor Tyrosine Kinase by Macrophage-Stimulating Protein Results in the Induction of Arginase Activity in Murine Peritoneal Macrophages. The Journal of Immunology : p Noël, W., Raes, G., Hassanzadeh Ghassabeh, G., De Baetselier, P., and Beschin, A., (2004), Alternatively activated macrophages during parasite infections. Trends in Parasitology. 20 3: p Hesse, M., Modolell, M., La Flamme, A.C., Schito, M., Fuentes, J.M., Cheever, A.W., Pearce, E.J., and Wynn, T.A., (2001), Differential Regulation of Nitric Oxide Synthase-2 and Arginase-1 by Type 1/Type 2 Cytokines In Vivo: Granulomatous Pathology Is Shaped by the Pattern of L-Arginine Metabolism. The Journal of Immunology : p Wynn, T.A., (2004), Fibrotic disease and the TH1/TH2 paradigm. Nat Rev Immunol. 4 8: p Chapter One Introduction 61

62 105. Albina, J., Mills, C., Henry, W., and Caldwell, M., (1990), Temporal expression of different pathways of 1-arginine metabolism in healing wounds. The Journal of Immunology : p Kodelja, V., Müller, C., Tenorio, S., Schebesch, C., Orfanos, C.E., and Goerdt, S., (1997), Differences in angiogenic potential of classically vs alternatively activated macrophages. Immunobiology : p Martin, P. and Leibovich, S.J., (2005), Inflammatory cells during wound repair: the good, the bad and the ugly. Trends Cell Biol : p Song, E., Ouyang, N., Hörbelt, M., Antus, B., Wang, M., and Exton, M.S., (2000), Influence of Alternatively and Classically Activated Macrophages on Fibrogenic Activities of Human Fibroblasts. Cellular Immunology : p Loke, P., MacDonald, A.S., Robb, A., Maizels, R.M., and Allen, J.E., (2000), Alternatively activated macrophages induced by nematode infection inhibit proliferation via cell-to-cell contact. Eur J Immunol. 30 9: p MacDonald, A.S., Maizels, R.M., Lawrence, R.A., Dransfield, I., and Allen, J.E., (1998), Requirement for in vivo production of IL-4, but not IL-10, in the induction of proliferative suppression by filarial parasites. J Immunol : p Nair, M.G., Cochrane, D.W., and Allen, J.E., (2003), Macrophages in chronic type 2 inflammation have a novel phenotype characterized by the abundant expression of Ym1 and Fizz1 that can be partly replicated in vitro. Immunol Lett. 85 2: p Nair, M.G., Gallagher, I.J., Taylor, M.D., Loke, P., Coulson, P.S., Wilson, R.A., Maizels, R.M., and Allen, J.E., (2005), Chitinase and Fizz family members are a generalized feature of nematode infection with selective upregulation of Ym1 and Fizz1 by antigen-presenting cells. Infect Immun. 73 1: p Loke, P., Nair, M.G., Parkinson, J., Guiliano, D., Blaxter, M., and Allen, J.E., (2002), IL-4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype. BMC Immunol. 3: p Reece, J.J., Siracusa, M.C., and Scott, A.L., (2006), Innate Immune Responses to Lung-Stage Helminth Infection Induce Alternatively Activated Alveolar Macrophages. Infection and Immunity. 74 9: p Herbert, D.R., Holscher, C., Mohrs, M., Arendse, B., Schwegmann, A., Radwanska, M., Leeto, M., Kirsch, R., et al., (2004), Alternative macrophage activation is essential for survival during schistosomiasis and downmodulates T helper 1 responses and immunopathology. Immunity. 20 5: p Huber, S., Hoffmann, R., Muskens, F., and Voehringer, D., (2010), Alternatively activated macrophages inhibit T-cell proliferation by Stat6-dependent expression of PD-L2. Blood : p Smith, P., Walsh, C.M., Mangan, N.E., Fallon, R.E., Sayers, J.R., McKenzie, A.N., and Fallon, P.G., (2004), Schistosoma mansoni worms induce anergy of T cells via selective upregulation of programmed death ligand 1 on macrophages. J Immunol : p Herbert, D.R., Orekov, T., Roloson, A., Ilies, M., Perkins, C., O'Brien, W., Cederbaum, S., Christianson, D.W., et al., (2010), Arginase I suppresses IL-12/IL-23p40-driven intestinal inflammation during acute schistosomiasis. J Immunol : p Modolell, M., Choi, B.S., Ryan, R.O., Hancock, M., Titus, R.G., Abebe, T., Hailu, A., Muller, I., et al., (2009), Local suppression of T cell responses by arginase-induced L-arginine depletion in nonhealing leishmaniasis. PLoS Negl Trop Dis. 3 7: p. e Hegele, R.G., (2000), The pathology of asthma: brief review. Immunopharmacology. 48 3: p Kropf, P., Fuentes, J.M., Fähnrich, E., Arpa, L., Herath, S., Weber, V., Soler, G., Celada, A., et al., (2005), Arginase and polyamine synthesis are key factors in the regulation of experimental leishmaniasis in vivo. The FASEB Journal. Chapter One Introduction 62

63 122. Pesce, J., Ramalingam, T., Mentink-Kane, M., Wilson, M., Kasmi, K., Smith, A., Thompson, R., Cheever, A., et al., (2009), Arginase 1 Expressing Macrophages Suppress Th2 Cytokine Driven Inflammation and Fibrosis. Plos Pathogen. 5 4: p El Kasmi, K.C., Qualls, J.E., Pesce, J.T., Smith, A.M., Thompson, R.W., Henao-Tamayo, M., Basaraba, R.J., Konig, T., et al., (2008), Toll-like receptor-induced arginase 1 in macrophages thwarts effective immunity against intracellular pathogens. Nat Immunol. 9 12: p La Flamme, A.C., Scott, P., and Pearce, E.J., (2002), Schistosomiasis delays lesion resolution during Leishmania major infection by impairing parasite killing by macrophages. Parasite Immunol. 24 7: p Kahnert, A., Seiler, P., Stein, M., Bandermann, S., Hahnke, K., Mollenkopf, H., and Kaufmann, S.H.E., (2006), Alternative activation deprives macrophages of a coordinated defense program to Mycobacterium tuberculosis. European Journal of Immunology. 36 3: p Weng, M., Huntley, D., Huang, I.-F., Foye-Jackson, O., Wang, L., Sarkissian, A., Zhou, Q., Walker, W.A., et al., (2007), Alternatively Activated Macrophages in Intestinal Helminth Infection: Effects on Concurrent Bacterial Colitis. The Journal of Immunology : p Little, M.C., Bell, L.V., Cliffe, L.J., and Else, K.J., (2005), The characterization of intraepithelial lymphocytes, lamina propria leukocytes, and isolated lymphoid follicles in the large intestine of mice infected with the intestinal nematode parasite Trichuris muris. J Immunol : p deschoolmeester, M.L., Little, M.C., Rollins, B.J., and Else, K.J., (2003), Absence of CC Chemokine Ligand 2 Results in an Altered Th1/Th2 Cytokine Balance and Failure to Expel Trichuris muris Infection. The Journal of Immunology : p Bowcutt, R., Bell, L.V., Little, M., Wilson, J., Booth, C., Murray, P.J., Else, K.J., and Cruickshank, S.M., (2011), Arginase-1-expressing macrophages are dispensable for resistance to infection with the gastrointestinal helminth Trichuris muris. Parasite Immunol. 33 7: p Dixon, H., Little, M.C., and Else, K.J., (2010), Characterisation of the protective immune response following subcutaneous vaccination of susceptible mice against Trichuris muris. International Journal for Parasitology. 40 6: p Carlens, J., Wahl, B., Ballmaier, M., Bulfone-Paus, S., Förster, R., and Pabst, O., (2009), Common γ-chain-dependent Signals Confer Selective Survival of Eosinophils in the Murine Small Intestine. The Journal of Immunology : p Wilson, N.S., El-Sukkari, D., Belz, G.T., Smith, C.M., Steptoe, R.J., Heath, W.R., Shortman, K., and Villadangos, J.A., (2003), Most lymphoid organ dendritic cell types are phenotypically and functionally immature. Blood : p Iwasaki, A. and Kelsall, B.L., (2000), Localization of Distinct Peyer's Patch Dendritic Cell Subsets and Their Recruitment by Chemokines Macrophage Inflammatory Protein (Mip)- 3α, Mip-3β, and Secondary Lymphoid Organ Chemokine. The Journal of Experimental Medicine : p Kelsall. B, S.W., (1996), Distinct populations of dendritic cells are present in the subepithelial dome and T cell regions of the murine Peyer's patch. Journal of Experimental Medicine : p Stagg, A.J., Hart, A.L., Knight, S.C., and Kamm, M.A., (2003), The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria. Gut : p Cruickshank. S, E.N., Felsburg. P, Carding. S, (2005), Characterization of colonic dendritic cells in normal and colitic mice. World Journal of Gastroenterology : p Chapter One Introduction 63

64 137. Chirdo, F.G., Millington, O.R., Beacock-Sharp, H., and Mowat, A.M., (2005), Immunomodulatory dendritic cells in intestinal lamina propria. European Journal of Immunology. 35 6: p Varol, C., Vallon-Eberhard, A., Elinav, E., Aychek, T., Shapira, Y., Luche, H., Fehling, H.J., Hardt, W.D., et al., (2009), Intestinal lamina propria dendritic cell subsets have different origin and functions. Immunity. 31 3: p Johansson-Lindbom, B., Svensson, M., Wurbel, M.-A., Malissen, B., Márquez, G., and Agace, W., (2003), Selective Generation of Gut Tropic T Cells in Gut-associated Lymphoid Tissue (GALT). The Journal of Experimental Medicine : p Svensson, M., Johansson-Lindbom, B., Zapata, F., Jaensson, E., Austenaa, L.M., Blomhoff, R., and Agace, W.W., (2007), Retinoic acid receptor signaling levels and antigen dose regulate gut homing receptor expression on CD8+ T cells. Mucosal Immunol. 1 1: p Mora, J.R., Bono, M.R., Manjunath, N., Weninger, W., Cavanagh, L.L., Rosemblatt, M., and von Andrian, U.H., (2003), Selective imprinting of gut-homing T cells by Peyer's patch dendritic cells. Nature : p Mora, J.R., Iwata, M., Eksteen, B., Song, S.-Y., Junt, T., Senman, B., Otipoby, K.L., Yokota, A., et al., (2006), Generation of Gut-Homing IgA-Secreting B Cells by Intestinal Dendritic Cells. Science : p Iwata, M., Hirakiyama, A., Eshima, Y., Kagechika, H., Kato, C., and Song, S.-Y., (2004), Retinoic Acid Imprints Gut-Homing Specificity on T Cells. Immunity. 21 4: p Chang, S.-Y., Cha, H.-R., Uematsu, S., Akira, S., Igarashi, O., Kiyono, H., and Kweon, M.-N., (2008), Colonic Patches Direct the Cross-Talk Between Systemic Compartments and Large Intestine Independently of Innate Immunity. The Journal of Immunology : p Cruickshank, S.M., Deschoolmeester, M.L., Svensson, M., Howell, G., Bazakou, A., Logunova, L., Little, M.C., English, N., et al., (2009), Rapid Dendritic Cell Mobilization to the Large Intestinal Epithelium Is Associated with Resistance to Trichuris muris Infection. The Journal of Immunology : p Jaensson, E., Uronen-Hansson, H., Pabst, O., Eksteen, B., Tian, J., Coombes, J.L., Berg, P.-L., Davidsson, T., et al., (2008), Small intestinal CD103+ dendritic cells display unique functional properties that are conserved between mice and humans. The Journal of Experimental Medicine : p Denning, T.L., Norris, B.A., Medina-Contreras, O., Manicassamy, S., Geem, D., Madan, R., Karp, C.L., and Pulendran, B., (2011), Functional Specializations of Intestinal Dendritic Cell and Macrophage Subsets That Control Th17 and Regulatory T Cell Responses Are Dependent on the T Cell/APC Ratio, Source of Mouse Strain, and Regional Localization. The Journal of Immunology : p Shortman, K. and Naik, S.H., (2007), Steady-state and inflammatory dendritic-cell development. Nat Rev Immunol. 7 1: p Cheong, C., Matos, I., Choi, J.-H., Dandamudi, D.B., Shrestha, E., Longhi, M.P., Jeffrey, K.L., Anthony, R.M., et al., (2010), Microbial Stimulation Fully Differentiates Monocytes to DC- SIGN/CD209+ Dendritic Cells for Immune T Cell Areas. Cell : p Siddiqui, K.R.R., Laffont, S., and Powrie, F., (2010), E-Cadherin Marks a Subset of Inflammatory Dendritic Cells that Promote T Cell-Mediated Colitis. Immunity. 32 4: p Dunay, I.R., DaMatta, R.A., Fux, B., Presti, R., Greco, S., Colonna, M., and Sibley, L.D., (2008), Gr1+ Inflammatory Monocytes Are Required for Mucosal Resistance to the Pathogen Toxoplasma gondii. Immunity. 29 2: p Schlitzer, A., Loschko, J., Mair, K., Vogelmann, R., Henkel, L., Einwächter, H., Schiemann, M., Niess, J.-H., et al., (2011), Identification of CCR9- murine plasmacytoid DC precursors with plasticity to differentiate into conventional DCs. Blood. Chapter One Introduction 64

65 153. Schulz, O., Jaensson, E., Persson, E.K., Liu, X., Worbs, T., Agace, W.W., and Pabst, O., (2009), Intestinal CD103+, but not CX3CR1+, antigen sampling cells migrate in lymph and serve classical dendritic cell functions. The Journal of Experimental Medicine : p Medina-Contreras, O., Geem, D., Laur, O., Williams, I.R., Lira, S.A., Nusrat, A., Parkos, C.A., and Denning, T.L., (2011), CX3CR1 regulates intestinal macrophage homeostasis, bacterial translocation, and colitogenic Th17 responses in mice. The Journal of Clinical Investigation : p Rivollier, A., He, J., Kole, A., Valatas, V., and Kelsall, B.L., (2012), Inflammation switches the differentiation program of Ly6Chi monocytes from antiinflammatory macrophages to inflammatory dendritic cells in the colon. The Journal of Experimental Medicine : p Rescigno. M, U.M., Valzasina. B, Francolini. M, Rotta. G, Bonasio. R, Granucci. F, Kraehenbuhl. J, Ricciardi-Castagnoli. P, (2001), Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nature Immunology: p Niess, J.H., Brand, S., Gu, X., Landsman, L., Jung, S., McCormick, B.A., Vyas, J.M., Boes, M., et al., (2005), CX3CR1-Mediated Dendritic Cell Access to the Intestinal Lumen and Bacterial Clearance. Science : p Chieppa, M., Rescigno, M., Huang, A.Y.C., and Germain, R.N., (2006), Dynamic imaging of dendritic cell extension into the small bowel lumen in response to epithelial cell TLR engagement. The Journal of Experimental Medicine : p Hapfelmeier, S., Müller, A.J., Stecher, B., Kaiser, P., Barthel, M., Endt, K., Eberhard, M., Robbiani, R., et al., (2008), Microbe sampling by mucosal dendritic cells is a discrete, MyD88-independent stepin ΔinvG S. Typhimurium colitis. The Journal of Experimental Medicine : p Alvarez, D., Vollmann, E.H., and von Andrian, U.H., (2008), Mechanisms and consequences of dendritic cell migration. Immunity. 29 3: p Johansson, C. and Kelsall, B.L., (2005), Phenotype and function of intestinal dendritic cells. Seminars in Immunology. 17 4: p Zhao, X., Sato, A., Dela Cruz, C.S., Linehan, M., Luegering, A., Kucharzik, T., Shirakawa, A.- K., Marquez, G., et al., (2003), CCL9 Is Secreted by the Follicle-Associated Epithelium and Recruits Dome Region Peyer s Patch CD11b+ Dendritic Cells. The Journal of Immunology : p Jang, M.H., Sougawa, N., Tanaka, T., Hirata, T., Hiroi, T., Tohya, K., Guo, Z., Umemoto, E., et al., (2006), CCR7 Is Critically Important for Migration of Dendritic Cells in Intestinal Lamina Propria to Mesenteric Lymph Nodes. The Journal of Immunology : p Bonasio, R. and von Andrian, U.H., (2006), Generation, migration and function of circulating dendritic cells. Current Opinion in Immunology. 18 4: p Leon, B. and Ardavin, C., (2008), Monocyte-derived dendritic cells in innate and adaptive immunity. Immunol Cell Biol. 86 4: p Everts, B., Smits, H.H., Hokke, C.H., and Yazdanbakhsh, M., (2010), Helminths and dendritic cells: Sensing and regulating via pattern recognition receptors, Th2 and Treg responses. European Journal of Immunology. 40 6: p Thomas, P.G., Carter, M.R., Atochina, O., Da Dara, A.A., Piskorska, D., McGuire, E., and Harn, D.A., (2003), Maturation of Dendritic Cell 2 Phenotype by a Helminth Glycan Uses a Toll-Like Receptor 4-Dependent Mechanism. The Journal of Immunology : p Chapter One Introduction 65

66 168. Kane, C.M., Jung, E., and Pearce, E.J., (2008), Schistosoma mansoni egg antigen-mediated modulation of Toll-like receptor (TLR)-induced activation occurs independently of TLR2, TLR4, and MyD88. Infect Immun : p van Liempt, E., van Vliet, S.J., Engering, A., Garcia Vallejo, J.J., Bank, C.M., Sanchez- Hernandez, M., van Kooyk, Y., and van Die, I., (2007), Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation. Mol Immunol : p van Die, I., van Vliet, S.J., Nyame, A.K., Cummings, R.D., Bank, C.M., Appelmelk, B., Geijtenbeek, T.B., and van Kooyk, Y., (2003), The dendritic cell-specific C-type lectin DC- SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology. 13 6: p Appelmelk, B.J., van Die, I., van Vliet, S.J., Vandenbroucke-Grauls, C.M.J.E., Geijtenbeek, T.B.H., and van Kooyk, Y., (2003), Cutting Edge: Carbohydrate Profiling Identifies New Pathogens That Interact with Dendritic Cell-Specific ICAM-3-Grabbing Nonintegrin on Dendritic Cells. The Journal of Immunology : p Rzepecka, J., Rausch, S., Klotz, C., Schnoller, C., Kornprobst, T., Hagen, J., Ignatius, R., Lucius, R., et al., (2009), Calreticulin from the intestinal nematode Heligmosomoides polygyrus is a Th2-skewing protein and interacts with murine scavenger receptor-a. Mol Immunol. 46 6: p Steinfelder, S., Andersen, J.F., Cannons, J.L., Feng, C.G., Joshi, M., Dwyer, D., Caspar, P., Schwartzberg, P.L., et al., (2009), The major component in schistosome eggs responsible for conditioning dendritic cells for Th2 polarization is a T2 ribonuclease (omega-1). The Journal of Experimental Medicine : p Helmby, H. and Grencis, R.K., (2003), Essential role for TLR4 and MyD88 in the development of chronic intestinal nematode infection. European Journal of Immunology : p van der Kleij, D., Latz, E., Brouwers, J.F.H.M., Kruize, Y.C.M., Schmitz, M., Kurt-Jones, E.A., Espevik, T., de Jong, E.C., et al., (2002), A Novel Host-Parasite Lipid Cross-talk. Journal of Biological Chemistry : p Perrigoue, J.G., Marshall, F.A., and Artis, D., (2008), On the hunt for helminths: innate immune cells in the recognition and response to helminth parasites. Cell Microbiol. 10 9: p MacDonald, A.S., Straw, A.D., Dalton, N.M., and Pearce, E.J., (2002), Cutting Edge: Th2 Response Induction by Dendritic Cells: A Role for CD40. The Journal of Immunology : p MacDonald, A.S., Patton, E.A., La Flamme, A.C., Araujo, M.I., Huxtable, C.R., Bauman, B., and Pearce, E.J., (2002), Impaired Th2 Development and Increased Mortality During Schistosoma mansoni Infection in the Absence of CD40/CD154 Interaction. The Journal of Immunology : p Amsen, D., Blander, J.M., Lee, G.R., Tanigaki, K., Honjo, T., and Flavell, R.A., (2004), Instruction of Distinct CD4 T Helper Cell Fates by Different Notch Ligands on Antigen- Presenting Cells. Cell : p Worsley, A.G.F., LeibundGut-Landmann, S., Slack, E., Phng, L.-K., Gerhardt, H., Sousa, C.R.e., and MacDonald, A.S., (2008), Dendritic cell expression of the Notch ligand jagged2 is not essential for Th2 response induction in vivo. European Journal of Immunology. 38 4: p Tu, L., Fang, T.C., Artis, D., Shestova, O., Pross, S.E., Maillard, I., and Pear, W.S., (2005), Notch signaling is an important regulator of type 2 immunity. The Journal of Experimental Medicine : p de Jong, E.C., Vieira, P.L., Kalinski, P., Schuitemaker, J.H.N., Tanaka, Y., Wierenga, E.A., Yazdanbakhsh, M., and Kapsenberg, M.L., (2002), Microbial Compounds Selectively Induce Chapter One Introduction 66

67 Th1 Cell-Promoting or Th2 Cell-Promoting Dendritic Cells In Vitro with Diverse Th Cell- Polarizing Signals. The Journal of Immunology : p Ekkens, M.J., Liu, Z., Liu, Q., Whitmire, J., Xiao, S., Foster, A., Pesce, J., VanNoy, J., et al., (2003), The Role of OX40 Ligand Interactions in the Development of the Th2 Response to the Gastrointestinal Nematode Parasite Heligmosomoides polygyrus. The Journal of Immunology : p Jenkins, S.J., Perona-Wright, G., Worsley, A.G.F., Ishii, N., and MacDonald, A.S., (2007), Dendritic Cell Expression of OX40 Ligand Acts as a Costimulatory, Not Polarizing, Signal for Optimal Th2 Priming and Memory Induction In Vivo. The Journal of Immunology : p Macpherson, A.J. and Uhr, T., (2004), Induction of Protective IgA by Intestinal Dendritic Cells Carrying Commensal Bacteria. Science : p Worbs, T., Bode, U., Yan, S., Hoffmann, M.W., Hintzen, G., Bernhardt, G.n., Förster, R., and Pabst, O., (2006), Oral tolerance originates in the intestinal immune system and relies on antigen carriage by dendritic cells. The Journal of Experimental Medicine : p Coombes, J.L., Siddiqui, K.R.R., Arancibia-Cárcamo, C.V., Hall, J., Sun, C.-M., Belkaid, Y., and Powrie, F., (2007), A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-β and retinoic acid dependent mechanism. The Journal of Experimental Medicine : p Worthington, J.J., Czajkowska, B.I., Melton, A.C., and Travis, M.A., (2011), Intestinal Dendritic Cells Specialize to Activate Transforming Growth Factor-β and Induce Foxp3+ Regulatory T Cells via Integrin αvβ8. Gastroenterology : p Travis, M.A., Reizis, B., Melton, A.C., Masteller, E., Tang, Q., Proctor, J.M., Wang, Y., Bernstein, X., et al., (2007), Loss of integrin αvβ8 on dendritic cells causes autoimmunity and colitis in mice. Nature : p Rehman, A., Sina, C., Gavrilova, O., Häsler, R., Ott, S., Baines, J.F., Schreiber, S., and Rosenstiel, P., (2011), Nod2 is essential for temporal development of intestinal microbial communities. Gut Wakkach, A., Fournier, N., Brun, V.r., Breittmayer, J.-P., Cottrez, F.o., and Groux, H., (2003), Characterization of Dendritic Cells that Induce Tolerance and T Regulatory 1 Cell Differentiation In Vivo. Immunity. 18 5: p Mullaly, S.C., Burrows, K., Antignano, F., and Zaph, C., (2011), Assessing the Role of CD103 in Immunity to an Intestinal Helminth Parasite. PLoS ONE. 6 5: p. e Wynn, T.A., (2009), Basophils trump dendritic cells as APCs for TH2 responses. Nat Immunol. 10 7: p Rimoldi, M., Chieppa, M., Salucci, V., Avogadri, F., Sonzogni, A., Sampietro, G., Nespoli, A., Viale, G., et al., (2005), Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nature Immunology. 6 5: p Taylor, B.C., Zaph, C., Troy, A.E., Du, Y., Guild, K.J., Comeau, M.R., and Artis, D., (2009), TSLP regulates intestinal immunity and inflammation in mouse models of helminth infection and colitis. The Journal of Experimental Medicine : p Humphreys, N.E., Xu, D., Hepworth, M.R., Liew, F.Y., and Grencis, R.K., (2008), IL-33, a Potent Inducer of Adaptive Immunity to Intestinal Nematodes. The Journal of Immunology : p Schmitz, J., Owyang, A., Oldham, E., Song, Y., Murphy, E., McClanahan, T.K., Zurawski, G., Moshrefi, M., et al., (2005), IL-33, an Interleukin-1-like Cytokine that Signals via the IL-1 Receptor-Related Protein ST2 and Induces T Helper Type 2-Associated Cytokines. Immunity. 23 5: p Chapter One Introduction 67

68 198. deschoolmeester, M.L., Manku, H., and Else, K.J., (2006), The Innate Immune Responses of Colonic Epithelial Cells to Trichuris muris Are Similar in Mouse Strains That Develop a Type 1 or Type 2 Adaptive Immune Response. Infection and Immunity : p Lotze, M.T., Zeh, H.J., Rubartelli, A., Sparvero, L.J., Amoscato, A.A., Washburn, N.R., DeVera, M.E., Liang, X., et al., (2007), The grateful dead: damage-associated molecular pattern molecules and reduction/oxidation regulate immunity. Immunological Reviews : p Takeuchi, O. and Akira, S., (2010), Pattern Recognition Receptors and Inflammation. Cell : p Ting, J.P.Y., Kastner, D.L., and Hoffman, H.M., (2006), CATERPILLERs, pyrin and hereditary immunological disorders. Nat. Revs. Immunol. 6: p Chen, G., Shaw, M.H., Kim, Y.G., and Nunez, G., NOD-Like Receptors: Role in Innate Immunity and Inflammatory Disease, in Annual Review of Pathology-Mechanisms of Disease. 2009, Annual Reviews: Palo Alto. p Kim, Y.-G., Park, J.-H., Shaw, M.H., Franchi, L., Inohara, N., and Núñez, G., (2008), The Cytosolic Sensors Nod1 and Nod2 Are Critical for Bacterial Recognition and Host Defense after Exposure to Toll-like Receptor Ligands. Immunity. 28 2: p Thomas, P.G., Carter, M.R., Atochina, O., Da Dara, A.A., Piskorska, D., McGuire, E., and Harn, D.A., (2003), Maturation of Dendritic Cell 2 Phenotype by a Helminth Glycan Uses a Toll-Like Receptor 4-Dependent Mechanism. The Journal of Immunology : p Borzutzky, A., Fried, A., Chou, J., Bonilla, F.A., Kim, S., and Dedeoglu, F., (2010), NOD2- associated diseases: Bridging innate immunity and autoinflammation. Clinical Immunology : p Kobayashi, K., Inohara, N., Hernandez, L.D., Galan, J.E., Nunez, G., Janeway, C.A., Medzhitov, R., and Flavell, R.A., (2002), RICK/Rip2/CARDIAK mediates signalling for receptors of the innate and adaptive immune systems. Nature : p Hessle, C.C., Andersson, B., and Wold, A.E., (2005), Gram-positive and Gram-negative bacteria elicit different patterns of pro-inflammatory cytokines in human monocytes. Cytokine. 30 6: p Strober, W., Murray, P.J., Kitani, A., and Watanabe, T., (2006), Signalling pathways and molecular interactions of NOD1 and NOD2. Nat Rev Immunol. 6 1: p Gutierrez, O., Pipaon, C., Inohara, N., Fontalba, A., Ogura, Y., Prosper, F., Nuñez, G., and Fernandez-Luna, J.L., (2002), Induction of Nod2 in Myelomonocytic and Intestinal Epithelial Cells via Nuclear Factor-κB Activation. Journal of Biological Chemistry : p Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Crespo, J., Fukase, K., Inamura, S., et al., (2003), Host Recognition of Bacterial Muramyl Dipeptide Mediated through NOD2. Journal of Biological Chemistry : p Caetano, B.C., Biswas, A., Lima-Junior, D.S., Benevides, L., Mineo, T.W.P., Horta, C.V., Lee, K.H., Silva, J.S., et al., (2011), Intrinsic expression of Nod2 in CD4 + T lymphocytes is not necessary for the development of cell-mediated immunity and host resistance to Toxoplasma gondii. European Journal of Immunology : p Ekman, A.-K. and Cardell, L.O., (2010), The expression and function of Nod-like receptors in neutrophils. Immunology : p Rosenstiel, P., Fantini, M., Bräutigam, K., Kühbacher, T., Waetzig, G.H., Seegert, D., and Schreiber, S., (2003), TNF-α and IFN-γ regulate the expression of the NOD2 (CARD15) gene in human intestinal epithelial cells. Gastroenterology : p Pauleau, A.-L. and Murray, P.J., (2003), Role of Nod2 in the Response of Macrophages to Toll-Like Receptor Agonists. Molecular and Cellular Biology : p Chapter One Introduction 68

69 215. Lala, S., Ogura, Y., Osborne, C., Hor, S.Y., Bromfield, A., Davies, S., Ogunbiyi, O., Nuñez, G., et al., (2003), Crohn s disease and the NOD2 gene: a role for paneth cells. Gastroenterology : p Ogura, Y., Lala, S., Xin, W., Smith, E., Dowds, T.A., Chen, F.F., Zimmermann, E., Tretiakova, M., et al., (2003), Expression of NOD2 in Paneth cells: a possible link to Crohn s ileitis. Gut : p Cruickshank. S, W.L., Cardone. J, Howdle. P, Murray. P, Carding. S,, (2008), Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival. World Journal of Gastroenterology : p Tanabe, T., Chamaillard, M., Ogura, Y., Zhu, L., Qiu, S., Masumoto, J., Ghosh, P., Moran, A., et al., (2004), Regulatory regions and critical residues of NOD2 involved in muramyl dipeptide recognition. EMBO J. 23 7: p Vavricka, S.R., Musch, M.W., Chang, J.E., Nakagawa, Y., Phanvijhitsiri, K., Waypa, T.S., Merlin, D., Schneewind, O., et al., (2004), hpept1 transports muramyl dipeptide, activating NF-κB and stimulating IL-8 secretion in human colonic Caco2/bbe cells. Gastroenterology : p Marina-Garcia, N., Franchi, L., Kim, Y.G., Hu, Y., Smith, D.E., Boons, G.J., and Nunez, G., (2009), Clathrin- and dynamin-dependent endocytic pathway regulates muramyl dipeptide internalization and NOD2 activation. J Immunol : p Saleh, A., Srinivasula, S.M., Acharya, S., Fishel, R., and Alnemri, E.S., (1999), Cytochrome c and datp-mediated Oligomerization of Apaf-1 Is a Prerequisite for Procaspase-9 Activation. Journal of Biological Chemistry : p Ogura, Y., Inohara, N., Benito, A., Chen, F.F., Yamaoka, S., and Núñez, G., (2001), Nod2, a Nod1/Apaf-1 Family Member That Is Restricted to Monocytes and Activates NF-κB. Journal of Biological Chemistry : p Lécine, P., Esmiol, S., Métais, J.-Y., Nicoletti, C., Nourry, C., McDonald, C., Nunez, G., Hugot, J.-P., et al., (2007), The NOD2-RICK Complex Signals from the Plasma Membrane. Journal of Biological Chemistry : p Beourhis, L., Benko, S., and Girardin, S.E., (2007), Nod1 and Nod2 in innate immunity and human inflamatory disorders. Biochemincal Society Transactions. 35: p Abbott, D.W., Wilkins, A., Asara, J.M., and Cantley, L.C., (2004), The Crohn's Disease Protein, NOD2, Requires RIP2 in Order to Induce Ubiquitinylation of a Novel Site on NEMO. Current Biology : p Franchi, L., Warner, N., Viani, K., and Nuñez, G., (2009), Function of Nod-like receptors in microbial recognition and host defense. Immunological Reviews : p Kim, J.-Y., Omori, E., Matsumoto, K., Núñez, G., and Ninomiya-Tsuji, J., (2008), TAK1 Is a Central Mediator of NOD2 Signaling in Epidermal Cells. Journal of Biological Chemistry : p Kobayashi, K.S., Chamaillard, M., Ogura, Y., Henegariu, O., Inohara, N., Nuñez, G., and Flavell, R.A., (2005), Nod2-Dependent Regulation of Innate and Adaptive Immunity in the Intestinal Tract. Science : p Sabbah, A., Chang, T.H., Harnack, R., Frohlich, V., Tominaga, K., Dube, P.H., Xiang, Y., and Bose, S., (2009), Activation of innate immune antiviral responses by Nod2. Nat Immunol : p Watanabe, T., Kitani, A., Murray, P.J., and Strober, W., (2004), NOD2 is a negative regulator of Toll-like receptor 2-mediated T helper type 1 responses. Nat Immunol. 5 8: p Dahiya, Y., Pandey, R.K., and Sodhi, A., (2011), Nod2 downregulates TLR2/1 mediated IL1β gene expression in mouse peritoneal macrophages. PloS one. 6 11: p. e Netea, M.G., Ferwerda, G., de Jong, D.J., Jansen, T., Jacobs, L., Kramer, M., Naber, T.H.J., Drenth, J.P.H., et al., (2005), Nucleotide-Binding Oligomerization Domain-2 Modulates Chapter One Introduction 69

70 Specific TLR Pathways for the Induction of Cytokine Release. The Journal of Immunology : p van Heel, D.A., Ghosh, S., Butler, M., Hunt, K.A., Lundberg, A.M.C., Ahmad, T., McGovern, D.P.B., Onnie, C., et al., (2005), Muramyl dipeptide and toll-like receptor sensitivity in NOD2-associated Crohn's disease. The Lancet : p Hisamatsu, T., Suzuki, M., Reinecker, H.-C., Nadeau, W.J., McCormick, B.A., and Podolsky, D.K., (2003), CARD15/NOD2 functions as an antibacterial factor in human intestinal epithelial cells. Gastroenterology : p Wehkamp, J., Harder, J., Weichenthal, M., Schwab, M., Schäffeler, E., Schlee, M., Herrlinger, K.R., Stallmach, A., et al., (2004), NOD2 (CARD15) mutations in Crohn s disease are associated with diminished mucosal α-defensin expression. Gut : p Petnicki-Ocwieja, T., Hrncir, T., Liu, Y.-J., Biswas, A., Hudcovic, T., Tlaskalova-Hogenova, H., and Kobayashi, K.S., (2009), Nod2 is required for the regulation of commensal microbiota in the intestine. Proceedings of the National Academy of Sciences : p Rehman, A., Sina, C., Gavrilova, O., Häsler, R., Ott, S., Baines, J.F., Schreiber, S., and Rosenstiel, P., (2011), Nod2 is essential for temporal development of intestinal microbial communities. Gut : p Mondot, S., Barreau, F., Al Nabhani, Z., Dussaillant, M., Le Roux, K., Doré, J., Leclerc, M., Hugot, J.-P., et al., (2012), Altered gut microbiota composition in immune-impaired Nod2 / mice. Gut. 61 4: p Barreau, F., Meinzer, U., Chareyre, F., Berrebi, D., Niwa-Kawakita, M., Dussaillant, M., Foligne, B., Ollendorff, V., et al., (2007), CARD15/NOD2 is required for Peyer's patch homeostasis in mice. PLoS ONE. 6: p Hugot, J.-P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J.-P., Belaiche, J., Almer, S., Tysk, C., et al., (2001), Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature : p Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L., Chen, F.F., Ramos, R., Britton, H., Moran, T., et al., (2001), A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature : p Miceli-Richard, C., Lesage, S., Rybojad, M., Prieur, A.-M., Manouvrier-Hanu, S., Hafner, R., Chamaillard, M., Zouali, H., et al., (2001), CARD15 mutations in Blau syndrome. Nat Genet. 29 1: p Kanazawa, N., Okafuji, I., Kambe, N., Nishikomori, R., Nakata-Hizume, M., Nagai, S., Fuji, A., Yuasa, T., et al., (2005), Early-onset sarcoidosis and CARD15 mutations with constitutive nuclear factor-κb activation: common genetic etiology with Blau syndrome. Blood : p Holler, E., Rogler, G., Herfarth, H., Brenmoehl, J., Wild, P.J., Hahn, J., Eissner, G., Schölmerich, J., et al., (2004), Both donor and recipient NOD2/CARD15 mutations associate with transplant-related mortality and GvHD following allogeneic stem cell transplantation. Blood : p Ningappa, M., Higgs, B.W., Weeks, D.E., Ashokkumar, C., Duerr, R.H., Sun, Q., Soltys, K.A., Bond, G.J., et al., (2011), NOD2 Gene Polymorphism rs Associates With Need for Combined Liver-Intestine Transplantation in Children With Short-Gut Syndrome. Am J Gastroenterol : p Fishbein, T., Novitskiy, G., Mishra, L., Matsumoto, C., Kaufman, S., Goyal, S., Shetty, K., Johnson, L., et al., (2008), NOD2-expressing bone marrow-derived cells appear to regulate epithelial innate immunity of the transplanted human small intestine. Gut. 57 3: p Lough, D., Abdo, J., Guerra-Castro, J.F., Matsumoto, C., Kaufman, S., Shetty, K., Kwon, Y.K., Zasloff, M., et al., (2012), Abnormal CX3CR1+ Lamina Propria Myeloid Cells from Intestinal Chapter One Introduction 70

71 Transplant Recipients with NOD2 Mutations. American Journal of Transplantation. 12 4: p Virgin, H.W. and Levine, B., (2009), Autophagy genes in immunity. Nat Immunol. 10 5: p Cooney, R., Baker, J., Brain, O., Danis, B., Pichulik, T., Allan, P., Ferguson, D.J.P., Campbell, B.J., et al., (2010), NOD2 stimulation induces autophagy in dendritic cells influencing bacterial handling and antigen presentation. Nat Med. 16 1: p Travassos, L.H., Carneiro, L.A.M., Ramjeet, M., Hussey, S., Kim, Y.-G., Magalhaes, J.G., Yuan, L., Soares, F., et al., (2010), Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immunol. 11 1: p Netea, M.G. and Joosten, L.A.B., (2010), A NOD for autophagy. Nat Med. 16 1: p Kim, Y.-G., Kamada, N., Shaw, Michael H., Warner, N., Chen, Grace Y., Franchi, L., and Núñez, G., (2011), The Nod2 Sensor Promotes Intestinal Pathogen Eradication via the Chemokine CCL2-Dependent Recruitment of Inflammatory Monocytes. Immunity. 34 5: p Kim, Y.-G., Park, J.-H., Reimer, T., Baker, Darren P., Kawai, T., Kumar, H., Akira, S., Wobus, C., et al., (2011), Viral Infection Augments Nod1/2 Signaling to Potentiate Lethality Associated with Secondary Bacterial Infections. Cell host & microbe. 9 6: p Shaw, M.H., Reimer, T., Sanchez-Valdepenas, C., Warner, N., Kim, Y.-G., Fresno, M., and Nunez, G., (2009), T cell-intrinsic role of Nod2 in promoting type 1 immunity to Toxoplasma gondii. Nat Immunol : p Pandey, A.K., Yang, Y., Jiang, Z., Fortune, S.M., Coulombe, F., Behr, M.A., Fitzgerald, K.A., Sassetti, C.M., et al., (2009), NOD2, RIP2 and IRF5 Play a Critical Role in the Type I Interferon Response to Mycobacterium tuberculosis. PLoS Pathog. 5 7: p. e Chapter One Introduction 71

72 72

73 Chapter Two A role for the pattern recognition receptor Nod2 in promoting recruitment of CD103 + Dendritic Cells to the gut in response to Trichuris muris infection Rowann Bowcutt 1, Peter J Murray 2, Cath Booth 3, Simon Carding 4, Richard Grencis 1, Sheena Cruickshank 1 1 The University of Manchester, Manchester, UK, 2 Departments of Infectious Diseases and Immunology, St. Jude Children s Research Hospital, Memphis, TN, USA, 3 Epistem Limited, Manchester, UK, 4 University of East Anglia, Norwich, UK Author contributions: Rowann Bowcutt carried out all work unless otherwise stated Peter J Murray donated the Nod2 -/- mice Cath Booth is the industrial supervisor of Rowann Bowcutt Simon Carding supervised the work done by Sheena Cruickshank Richard K Grencis co supervised the project Sheena Cruickshank supervised the project, carried out experiments in Figure 5C and Figure 6A and B Manuscript in preparation for submission to Mucosal Immunology Chapter Two The role of Nod2 in T. muris infection 73

74 Abstract The ability of the colon to generate an immune response to pathogens, such as the whipworm Trichuris muris, is a fundamental and critical defense mechanism. Our previous work demonstrated that resistance to infection is associated with the rapid recruitment of dendritic cells (DCs) to the colonic epithelium via epithelial production of CCL5 and CCL20. However, the epithelial-parasite interaction that drives chemokine production is not known. Here, we address the role of the cytosolic pattern recognition receptor Nod2, the location of which within the crypts correlates with the T. muris niche. Nod2 -/- mice had a delayed expulsion of T. muris. In WT mice, in response to infection, there was a rapid influx of CD103 + CD11c + DCs into the colonic epithelium, whereas, this recruitment was impaired in Nod2 -/- animals. Despite the number of colonic CD11c + CD103 + DCs in Nod2 -/- mice having a moderate increase at D5 p.i., the levels were not to the same magnitude as WT mice. Migration assays revealed no difference between the migration of Nod2 -/- and WT colonic DCs in response to chemokines suggesting Nod2 -/- DCs do not have impaired migration. However, in vitro experiments showed epithelial production of the chemokine CCL2 by Nod2 -/- epithelial cells to be markedly reduced. Furthermore, bone marrow chimeras of wild-type mice reconstituted with Nod2 -/- cells equivocally demonstrated that Nod2 -/- DC recruitment to the epithelium was normal in response to T. muris. Collectively, these data suggest a role for Nod2 in promoting epithelial chemokine production in the response to T. muris driving the subsequent recruitment of CD103 + DCs to the colonic epithelium. Chapter Two The role of Nod2 in T. muris infection 74

75 Introduction The gastro-intestinal dwelling parasite, Trichuris muris (T. muris), is a natural infection of mice and is also used as a model system for the human parasite Trichuris trichiura (T. trichiura). T. trichiura infection affects over 1 billion people, with the highest prevalence being in developing countries [1, 2]. Patients have a spectral immune response with some people immune to infection despite being in a disease endemic country, while others are susceptible and harbour long term chronic infection [3]. This spectral immune response is also reflected in T. muris infection in mice. A strong Th2 response governs immunity to the parasite whereas a dominant Th1 response renders the host susceptible to infection [4]. Although the immune responses to T. muris are well characterised, how the immune response is initiated is still unclear. Dendritic cells (DCs) are important cells for priming T cells and driving T cell subset polarisation [5, 6]. Epithelial cells have been shown to play a critical role in promoting this ability of DCs to polarise T cell responses [7-9]. Therefore, the epithelial/dc interaction may be an underlying factor as to why we observe differing immune response to T. muris and indeed T. trichiura. T. muris is known to burrow into the epithelium of the large intestine and remains throughout its lifetime with its head end buried within an epithelial syncitial tunnel [3]. Given the close proximity of T. muris within the epithelial layer of the gut it is thus feasible to suggest that the epithelial cells are sensing the parasite and initiating DC priming and immunity. Indeed, previous work has shown that colonic epithelial cells (CECs) are able to respond to T. muris antigen [10] and work from our group demonstrated that resistance to infection is associated with the rapid recruitment of DCs to the colonic epithelium via epithelial production of CCL5 and CCL20 [11]. However, the epithelial-parasite interaction that drives chemokine production and DC recruitment is not known. Rapid recruitment of DCs to the colonic epithelium in T. muris infection is also associated with more rapid maturation of DCs [11]. Thus implying, not only do the DCs have to be effectively recruited to the epithelial layer, they also have to receive the correct epithelial derived signals in order for them to mature and promote Th2 driven immunity. Epithelial cells express several evolutionarily conserved and structurally related proteins called pattern recognition receptors (PRRs) that recognize specific pathogen associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS) or peptidoglycan (PGN) that are found on the surface of pathogens. In addition, PRRs can also detect damage associated molecular patters (DAMPS) that are associated with tissue injury or cell death caused by inflammation and infection [12]. One such family of PRRs is the Nod-like receptors (NLR). NLR family members are primarily intracellular pattern recognition receptors located within the cytosol of cells [13]. The NLR Chapter Two The role of Nod2 in T. muris infection 75

76 Nod2 is a PRR of high interest as mutations in the Nod2 gene have been associated with the inflammatory disorder Crohn s disease as well as increased susceptibility to infections [14]. The highest levels of Nod2 expression are found in epithelial cells and antigen presenting cells [15, 16], although Nod2 has also been identified in T cells [17] and neutrophils [18]. Within the colonic epithelium Nod2 expression is thought to be restricted to the dividing cells at the base of the crypts [19] which correlates with the T. muris niche during the early phase of infection [3, 20]. Nod2 was once thought to be restricted to the detection of muramyl dipeptide (MDP) on gram positive and gram negative bacteria, however, its role in the immune system is now known to be increasingly diverse. Nod2 has been attributed to viral recognition [21], T cell signalling [22], adaptive immune responses [23] and the regulation of the host micro-biota [24, 25]. However, a role for Nod2 in helminth immunity is yet to be defined. We investigated the role of Nod2 in the initiation of the immune response to T. muris. We found Nod2 -/- mice showed impaired recruitment of in CD103 + DCs to the epithelium. Furthermore, Nod2 -/- mice had delayed expulsion kinetics of the parasite. The impaired DC recruitment was driven by reduced epithelial responsiveness and chemokine secretion in response to the parasite. Our data implicates a role for Nod2 in the regulation of epithelial derived chemokines and subsequent DC recruitment during T. muris infection. Chapter Two The role of Nod2 in T. muris infection 76

77 Materials and Methods Mice Male Nod2 -/- C57BL/6 mice have been described [26] and were bred in-house. Specific pathogen-free male C57BL/6 mice were purchased at 6 8 weeks of age from Harlan Olac (Bicester, UK). All mice were maintained by the Biological Services Unit (BSU), University of Manchester, UK and kept in individually ventilated cages. Animals were treated and experiments performed according to the Home Office Animals (Scientific Procedures) Act (1986) Parasites Maintenance of the T. muris lifecycle and production of excretory/secretory (E/S) antigen was carried out as described previously. [27] Mice were infected with approximately 175 embryonated eggs by oral gavage and sacrificed at various time points post infection (p.i.), worm burdens were [28, 29] assessed as described previously. ELISA T. muris-specific IgG1 and IgG2a antibodies were measured in sera samples collected at autopsy by ELISA using a previously described method. [30] Concentrations of the chemokines CCL2 and CCL3 in colonic epithelial cell culture supernatant were measured by a custom ELISA kit (R and D Systems, Abingdon, UK) according to the manufacturer s instructions. Histology Caecal and colon snips were fixed in neutral buffered formalin (NBF) for 24 hours, processed and embedded in paraffin wax. 5 µm sections were then dewaxed, rehydrated and stained using a standard Haematoxylin & Eosin (H&E) or Periodic acid Schiffs (PAS) stain. Slides stained with H&E were measured for crypt hyperplasia, measured in 20 crypts per mouse using WCIF ImageJ software. Goblet cells were counted in 20 crypts per mouse from PAS-stained sections. All slides were measured and counted blind and in a randomised order. Immunofluorescence Caecal and colonic snips were taken at autopsy and frozen in OCT embedding matrix (Thermo Fisher Scientific, Cheshire, UK). 6 µm sections were then fixed in 4% paraformaldehyde at 4 C for 5 minutes. Sections were blocked using the tryamide blocking kit (PerkinElmer, Cambridge, UK) for 30 minutes. Endogenous biotins were blocked using the avidin/biotin blocking kit as per the manufacturer s instructions (Vector Lab, Peterborough, UK). For four colour Chapter Two The role of Nod2 in T. muris infection 77

78 immunohistochemistry, slides were first stained with either purified anti-cd103 (Beckon Dickinson, Oxford, UK) or anti-f4/80 diluted in 0.1M Tris-HCL (ph7.5) (TNB). A secondary of mouse-anti-rat IgG2a-Cy5 was applied to slides. Slides were then incubated with the primary antibodies CD11c-biotin (Ebioscience, Hatfield, UK) and cytokeratin-fitc (Sigma Aldrich, Dorset UK). Samples were incubated with Streptavidin-Horseradish peroxidase for 30 minutes. After washing, samples were incubated with Tyramide Cy3 detection antibody for 5 minutes. Slides were washed and mounted with vector shield containing 4,6-diamidino-2-phenylindole (DAPI, Vector Lab, Peterborough UK). Slides were imaged and CD11c + (red cells), or CD11c + CD103 + or CD11c + F4/80 + (purple cells) counted per field of view in a blind randomized order. Three to four fields/view were counted per section. Mesenteric Lymph Node cell culture and cytokine analysis Single cell suspensions were prepared from mesenteric lymph nodes (MLNs) taken at autopsy and added at 5 x 10 6 cells per well in 1ml cultures to 48-well plates and stimulated with T. muris E/S at 50µg/ml. Cells were incubated at 37 C, 5% CO 2, 95% humidity for 48 hours, after which time supernatants were harvested and stored at 20 C. For cytokine analysis levels of IL-4, IL-10, IL-6, IL-9, IL-13, Interferon gamma, tumour necrosis factor α and IL-12p70 were determined using a custom cytometric bead array according to manufacturers instructions (CBA, Becton Dickenson, Oxford, UK) and analysed using BD FacsAria cytometer and FCAP Array software. Generation of Bone marrow chimeras Recipient mice were irradiated with two 5 Gy doses 4 hours apart. Recipient mice were then injected via the tail vein with bone marrow harvested from donor mice at 10 million cells /250μl sterile PBS. Bone marrow was allowed to reconstitute for 6 weeks before mice were infected with T. muris. Bone marrow culture and verification of successful reconstitution of bone marrow chimeras Bone marrow was harvested and cultured as previously described [31]. On day six of the culture the cells were harvested from the plates and semi-adherent cells removed. The cells were spun at 400g and re-suspended at a concentration of 1x10 6 cells/ml in DC media (RPMI 1640 supplemented with 10% LPS-free FBS (Gibco, Paisley, UK) 1% Penicillin/streptomycin and 50mM Beta-mercaptoethanol (Sigma Aldrich, Dorset UK)). The cells were stimulated over night with LPS (100ng/ml), MDP (5μg/ml) and media as a control. After 24hours the cells were harvested and prepared for flow cytometry. Fc receptors were blocked by incubating cells in anti-cd16/32 Chapter Two The role of Nod2 in T. muris infection 78

79 (2μg/ml) for 15 minutes. Cells were washed and stained with anti-cd45 PeCy7 (1 μg/ml, Becton Dickinson), anti-cd11c Alexa700 (1μg/ml), anti-mhc-ii FITC (2.5 μg/ml) and anti-cd86 PE (1 μg/ml) (all E Bioscience) and acquired using a (Becton Dickinson, LSRII (Becton Dickinson Biosciences, Oxfordshire). Data was analysed using Flow Jo flow cytometry analysis software (Tree Star, Inc, Oregon, US). LPL isolation and Flow cytometry Caecum and colon were harvested at autopsy and digested in RPMI containing 5% L-glutamine, 5% penicillin streptomycin, 10% fetal bovine serum (Sigma Aldrich, Dorset, UK), collagenase (1mg/ml), and dispase (0.5mgs/ml, both Gibco, Paisley, UK) for 2 hours at 37 C. Cells were then forced through a 70μm cell strainer, spun at 405g for 5 minutes and resuspended in 10mls 80% Percoll (GE Healthcare, Buckinghamshire, UK) solution. Which was then overlaid on a 40% Percoll solution. Cells were spun for 25minutes at 1000g. The cells at the gradient interface were harvested. Fc receptors were blocked using anti-cd16/32 (2 μg/ml E bioscience, Hatfield, UK). Cells were washed and stained with anti-cd45 PeCy7 (1 μg/ml, Becton Dickinson, Oxford, UK), anti-cd103 PE (1 μg/ml), anti-cd11c Alexa700 (2.5 μg/ml), anti-mhc-ii FITC (2.5 μg/ml) and anti- F4/80 APC (1 μg/ml) (all E bioscience, Hatfield, UK) and acquired by flow cytometry on the BD LSRII. Data was analysed using FlowJo flow cytometry software (Tree Star inc. Oregon, US) Colonic and caecal cell isolation, cdna conversion and qpcr Caecum and colon were harvested at autopsy, digested in RPMI containing 5% L-glutamine, 5% penicillin streptomycin, 10% fetal bovine serum and dispase (1mg/ml Gibco, Paisley, UK) for 90 minutes at 37 C. Cells were then forced through a 70μm cell strainer (Becton Dickinson, Oxford, UK) and spun at 400g for 5 minutes and resuspended in 1ml TRIsure (Bioline, London, UK). Total RNA was isolated from cells by homogenizing in TRIsure, phases separated using chloroform (Sigma-Aldrich, Dorset, UK) and RNA precipitated in isopropanol (Sigma-Aldrich, Dorset, UK). RNA concentration was analysed on a nanodrop-1000 spectrophotometer (Labtech International, East Sussex, UK) and resuspended at a concentration of 1μg/μl using Bioscript M-MLV kit (Bioscript, London, UK) for cdna conversion. Quantitative PCR was performed using the SYBR green I core kit (Eurogentec, Southampton, UK) and an Opticon quantitative PCR thermal cycler (Bio-Rad, Hemel Hempstead, UK). Each sample was serially diluted, and expression ratios normalized to the mean of two reference primers (Gapdh and Ywhaz). Primer sequences are given in Table 1. Table 1: Primer sequences used for quantitative PCR of colonic epithelial cells Chapter Two The role of Nod2 in T. muris infection 79

80 Gene Forward Primer Reverse Primer Gapdh CCCACTAACATCAAATGGGG TCTCCATGGTGGTGAAGACA Ywhaz TTCTTGATCCCCAATGCTTC TTCTTGTCATC ACCAGCAGC CCL2 TCTGGGCCTGCTGTTCACA CTGTCACACTGGTCACTCCTA CCL5 GGGTACCATGAAGATCTCTGCA TTGGCGGTTCCTT CGAGTGA IL33 AGACCAGGTGCTACTACGCTAC CACCATCAGCTTCTTCCCATCC Nod2 Rip2 CGACATCTCCCACAGAGTTGTAATCC GGCACCTGAAGTTGACATTTTGC CTGCACCCGAAGGCGGAACAATCA GCGCCCATCCACTCTGTATTAGC CEC culture Monolayer cultures of primary CECs were cultured as described previously [32]. After 24 hours, the cells were incubated with 10μg/ml S. aureus PGN (Sigma-Aldrich, Dorset, UK), 0.1μg/ml Pam 3 CSK4 (InVivoGen, San Diego, CA) or, 1.0μg/ml MDP (Ac-muramyl-Ala-D-isoglutamine) (Bubendorf, Switzerland). Optimal culture conditions were empirically determined. Chemokine migration assay Colonic lamina propria cells from wild type or Nod2 -/- mice were labelled with Vybrant fluorescent dye (Molecular Probes, Leiden, The Netherlands) and added to the upper well of transwell plates (Fisher Scientific, Loughborough, UK) at 1-8x10 5 per well and chemokines were added to the bottom well ( ng/ml). As a control, cells were also plated in the absence of chemokine. After incubating for 1h at 37 C cells in the bottom well were stained with CD11c antibodies and the proportion of dual stained cells was calculated as a proportion of the total number of dyelabelled cells using a Zeiss Axiovert 200M microscope with Axiovision software from which the negative control values were subtracted. Statistics Where statistics are quoted, two experimental groups were compared using a student s T test. P- values < 0 05 were considered significant. All statistical analyses were carried out using GraphPad Prism for windows, version Chapter Two The role of Nod2 in T. muris infection 80

81 Results Nod2 mrna expression in colonic epithelial cells shows an increased trend 24 hours after T. muris infection Trichuris muris is known to penetrate the colonic epithelial layer with its head remaining buried within the epithelium for the bulk of its life cycle Therefore, we investigated the up-regulation of Nod2 and Rip2 in isolated CECs in early T. muris infection in C57BL/6 wild type mice by qpcr. Within 24 hours of infection there was a trend towards a two fold increase in the expression of Nod2 and Rip2 in colonic epithelial cells of C57BL/6 mice (Figure 1 A and B). Nod2 -/- mice have impaired recruitment of CD103 + DCs to the colonic epithelium Rapid DC recruitment to the colon has been shown to be associated with resistance to T. muris [11]. To assess whether Nod2 plays a role in recruitment of DCs in T. muris infection we analysed the recruitment of macrophages and DCs to the colon in response to T. muris infection (Figure 1 C-E). At D1 post infection we observed an increase in the number of CD103 + DCs (CD11c + MHCII hi ) to the colon in C57BL/6 WT animals but not in Nod2 -/- mice (Figure 1 D P=0.02). Although numbers of CD103 + DCs between C57BL/6 WT and Nod2 -/- mice were similar at D2 the difference in magnitude of the DC response between Nod2 -/- and C57BL/6 WT mice was more dramatic at D5 post infection, (p=0.01), with C57BL/6 mice showing a considerable increase in the proportion of colonic DCs (~17% of the CD45 + population) compared to Nod2 -/- animals in which there was only a modest increase (~5% of the CD45 + population). The percentage of DCs remained higher in C57BL/6 mice at Days 7 (difference not significant) and 9 post-infection (p=0.03) (Figure 1 D). The difference in numbers of DCs between Nod2 -/- and WT mice was restricted to post-infection as the numbers of CD103 + DCs were comparable between naïve C57BL/6 WT and Nod2 -/- animals. To see if there was a general reduction in the phagocyte response to T. muris in Nod2 -/- mice, we also assessed macrophages (F4/80 + MHCII + ) (Figure 1 E). Similar to DCs, macrophages increased at Day 5 p.i. albeit to a lesser degree than DCs (~7% of CD45 + cells). However, in contrast to the changes in the proportion of DCs between WT and Nod2 -/- mice, there was no significant difference in the proportion of macrophages in the colon between Nod2 -/- and C57BL/6 mice before or during infection. To see if the changes in the proportions of DCs/macrophages post-infection between WT and Nod2 -/- mice were restricted to the colon, we also investigated macrophages and DCs in the MLN and spleens and saw no differences in the numbers of macrophages (data not shown). Chapter Two The role of Nod2 in T. muris infection 81

82 Immunohistochemistry analysis showed higher frequencies of CD11c + cells (red) in the colon and caecum of C57BL/6 mice compared with Nod2 -/- mice (Figure 2 A and B), although the difference was not significant. As CD11c alone is not a discrete marker of DCs, we performed further validation using antibodies against CD103 or F4/80 and counted the number of CD103 + CD11c + cells and F480 + CD11c + cells (Figure 2 C-F). Our data showed an increase in the number of CD11c + CD103 + cells in C57BL/6 WT mice (Figure 2C and D, p=0.04) and verified the reduced number of CD103 + CD11c + DCs in the large intestine of Nod2 -/- animals (Figure 2 D). In addition, DC localisation changed during T. muris infection. Within the large intestine DCs are scarce, located deep within the lamina propria far away from the epithelium (Figure 2A). Upon T. muris infection within the wild-type mice, DCs were observed higher up the crypt axis close or adjacent to epithelial cells whereas this was not observed in Nod2 -/- mice (Figure 2). The number of F480 + CD11c + cells were more variable post-infection but overall showed little difference in number or distribution between Nod2 -/- and WT mice (Figure 2E and F). Chapter Two The role of Nod2 in T. muris infection 82

83 Figure 1 Impaired recruitment of CD103 + DCs to the colonic epithelium in Nod2 -/- mice in response to T. muris. WT and Nod2 -/- mice were infected orally with approximately 175 embryonated T. muris eggs. Colonic epithelial cells from WT mice were analysed before and at D1, D2, and D5 post infection and analysed by qpcr for Nod2 (A) and Rip2 (B) mrna n=2-7, data shown in mean +/- SEM. Lamina propria and intraepithelial cells were isolated from the large intestine and stained for CD45, MHCII, CD11c, CD103 and F4/80 on D0, D1, D2, D5, D7 and D9 post infection. (C) Gating strategy for CD103 + and F4/80 positive cells isolated from the large intestine. (D) Percentage of MHCII + CD11c + CD103 + F4/80 - DCs as a percentage of the CD45 + cell population, (E) Percentage of MHCII+CD11c+CD103 - F4/80 + macrophages as a percentage of the CD45+ cell population. Data shown is mean +SEM and is representative of at least 3-4 mice each from 3 experiments with the exception of D7 and D9 which are representative of 1 experiment. *P= <0.05 Chapter Two The role of Nod2 in T. muris infection 83

84 Figure 2 Impaired recruitment of CD103+ DCs to the colonic epithelium in Nod2-/- mice in response to T. muris. Frozen caecal and colon sections were take at autopsy, sectioned and stained for nuclei (blue), cytokeratin (green) and CD11c (red). Representative images shown in A (Scale bar for naïves = 100μm.. D2 p.i. = 50 μm). μm) (B) Quantification of CD11c+ cells in Nod2-/- and C57BL/6 mice. Frozen caecal and colon sections were taken at autopsy, sectioned and stained for nuclei (Dapi, blue) CD11c (red) and CD103 or F4/80 (green). Co-localised Co localised cells are shown in i yellow. (C) Representative image of CD103 staining. (Scale bar = 50μm, (insert= 30 μm)). μm)) (D) Quantification of dual stained CD103+ CD11c+ cells. (E) Representative image of F4/80 staining. (Scale bar = 50μm (insert= 40 μm)).. (F) ( Quantification of dual stained F4/80 CD11c cells. n = 3 -/(C57BL/6) n=4 (Nod2 ). Data shown are mean +SEM. *P= * <0.05 Chapter Two The role of Nod2 in T. muris infection 84

85 Impaired T. muris expulsion kinetics in Nod2 -/- mice To assess whether the impaired recruitment of CD103 + DCs impacted on parasite expulsion we infected Nod2 -/- and C57BL/6 mice with T. muris and assessed worm burdens on D21 post infection. We observed a significantly higher worm burden in Nod2 -/- animals compared with C57BL/6 WT mice (Figure 3 p=0.006). In addition we measured cytokine levels from mesenteric lymph node cells re-stimulated with T. muris E S antigens. The supernatants were analysed for IFN-γ and IL-13 by CBA (Figure 3). Mice produced both IFN-γ and IL-13 which is typical of the mixed Th1/Th2 response observed in C57BL/6 mice. Levels of IFN-γ were similar between Nod2 -/- and C57BL/6 WT mice (Figure 3B and 3C). In addition, we measured levels of IL-4, IL-6, IL-9, tumour necrosis factor α, and IL-12p70 with no differences were observed between Nod2 -/- and C57BL/6 suggesting that Nod2 was not necessary for driving the adaptive immune response to T. muris. Figure 3 Delayed expulsion kinetics of T. muris in Nod2 -/- mice Mice were infected orally with approximately 175 embryonated T. muris eggs and worm burdens were assessed at D21 post infection (A). Data is representative of two independent experiments with n=4 (Nod2 -/- ) and n=5 (C57BL/6) in each experiment. (B) Mesenteric lymph nodes cells re-stimulated with E/S at day 21p.i. IL-13 (B) and IFN-γ (C) levels in supernatants were then assayed by cytokine bead array. Data is representative of two independent experiments each with n=2-3 (naïve animals) and n=5 (infected animals). Data shown are for individual mice with mean values per group (-) and error bars are +/- SEM. **P= <0.01 Chapter Two The role of Nod2 in T. muris infection 85

86 Nod2 does not drive basophil recruitment Recently basophils have been implicated in mediating Th2 immunity against T. muris [33]. Furthermore DCs alone were shown to be insufficient at mediating immunity to T. muris [33]. We therefore assessed basophil frequencies in C57BL/6 and Nod2 -/- post infection with T. muris (Figure 4). At D5 post infection we did not observe any differences in basophil proportions between C57BL/6 and Nod2 -/- mice, suggesting no role for Nod2 in the recruitment of basophils in our system (Figure 4 A and B). Figure 4 Increased CD103 + cells in the large intestine is not due to in situ proliferation of DCs and Nod2 has no role in basophil recruitment to the large intestine. Mice were infected orally with approximately 175 embryonated T. muris eggs. Lamina propria and intraepithelial cells were isolated from the large intestine and stained for Lineage markers (CD4, CD8α, B220, CD19), c-kit and FcεR. (A) Gating strategy for basophils (Lin - C-kit - FcεR + ) cells. (B) Quantification of Lin - c-kit - FcεR + cells in the large intestine. n= 5 (C57BL/6) n= 4 (Nod2 -/- )(C) Mice were infected with T. muris and injected with BRDU 16 hours post sacrifice. Lamina propria and intraepitheliall cells were isolated from the large intestine and stained for CD45, MHCII, CD11c, CD103 and BrdU. The number of BRDU + CD103 + of CD45 + population quantified in C. n= 5 Data shown are mean +SEM. Chapter Two The role of Nod2 in T. muris infection 86

87 Increased CD103 + numbers is due to migration not proliferation To assess whether the increased numbers of CD103 + DCs observed in the colon of C57BL/6 WT mice was due to in situ proliferation or migration of the cells to the site of infection we assessed BrdU uptake in DCs in the colon of Nod2 -/- and C57BL/6 WT animals post-infection by flow cytometry. At D5 p.i., low levels of double positive CD103 + BrdU + cells were observed in both the C57BL/6 and Nod2 -/- animals with levels being comparable between both mice strains (Figure 4 C), thus, this data indicates that the increased numbers of DCs observed in C57BL/6 wild type mice compared with Nod2 -/- is not due to in situ proliferation and more likely due to altered DC recruitment into the large intestine. Nod2 -/- DCs can migrate normally in vitro and in vivo Nod2 is expressed in epithelial cells and immune cells so to begin to understand the role of Nod2 in the recruitment of CD103 + DCs to the colon we asked whether the impaired recruitment was due to an inability of Nod2 -/- DCs to migrate to the epithelium or to impaired responses by Nod2 -/- epithelial cells. Chemokines are key drivers in the migration of immune cells to the site of infection. We therefore first assessed the level of expression of the chemokine receptors CCR5 and CCR2 on DCs by flow cytometry in naive and infected mice and showed that the levels of chemokine receptors on the Nod2 -/- DCs were equivalent to C57BL/6 wild type DCs (Figure 5 A and B). Furthermore, we showed that in vitro colonic Nod2 -/- DCs were able to migrate across a transwell in response to CCL2 and CCL3 with the same efficiency as C57BL/6 wild type DCs (Figure 5 C). These data show that Nod2 -/- DCs have the potential and ability to respond to chemokines and have the same migratory capabilities as wild type DCs. We next assessed the ability of Nod2 -/- DCs to migrate to a Nod2 +/+ epithelium in vivo through the generation of bone marrow chimeras. C57BL/6 WT mice were irradiated and then reconstituted with Nod2 -/- bone marrow, herein referred to as C57BL/6 nod2-/- (Figure 5 D). In this model, the Nod2 remained intact in the epithelium whereas all the DCs were deficient in Nod2. To assess the successful reconstitution of C57BL/6 wild type with Nod2 -/- bone marrow we harvested bone marrow and cultured DCs in vivo with MDP and LPS (Figure 5 E). Bone marrow DCs from C57BL/6 nod2-/- were unresponsive to the Nod2 ligand, MDP (p=0.01), but were responsive to LPS, illustrating the bone marrow cells were from the Nod2 -/- donor and the mouse had been successfully reconstituted. Cells were isolated from the large intestine of the chimeras at D5 post infection and the proportion of CD103 + DCs were assessed. Our data shows that in C57BL/6 nod2-/- CD103 + DCs were able to migrate to the colonic epithelium and proportions were equivalent to Chapter Two The role of Nod2 in T. muris infection 87

88 the responses of normal C57BL/6. Collectively this data demonstrates that Nod2 -/- DCs are able to migrate effectively both in vitro and in vivo in response to T. muris (Figure 5 F). Nod2 -/- epithelial cells show impaired chemokine secretion in vitro Previous data from our group showed a role for the production of epithelial chemokines in DC recruitment to T. muris [11]. Therefore, it is possible that the impaired recruitment of CD103 + DCs in Nod2 -/- mice was due to defective epithelial responses and production of chemokines. To assess the function of the colonic epithelial cells of Nod2 -/- primary colonic epithelial cells (CECs) were harvested from the epithelium of C57BL/6 wild type and Nod2 -/- mice. The cells were cultured in vitro with the TLR2 ligands Pam3cys and PGN (p=0.03), and the Nod2 ligand MDP (p=0.04) and the supernatants analysed by ELISA. The data showed that CECs from Nod2 -/- mice were produced at much lower levels of CCL2 compared to CECs from C57BL/6 WT animals in response to the various ligands (Figure 6 A and B). Furthermore the same trend was shown for CCL3. In vivo the results were less clear, with no observed difference in CCL5 mrna in CECs from Nod2 -/- and C57BL/6 WT mice (Figure 6 C). However there was a decreased trend in the amount of CCL2 and IL-33 mrna in CECs from Nod2 -/- mice compared with WT mice (Figure 6 D and E). Chapter Two The role of Nod2 in T. muris infection 88

89 Figure 5 Nod2 -/- dendritic cells can migrate to a Nod2 +/+ epithelium Mice were infected orally with approximately 175 embryonated T. muris eggs. Lamina propria and intraepithelial cells were isolated from the large intestine Dendritic cells isolated from the large intestine were stained with chemokine receptors CCR5 (A) and CCR2 (B). (C) Bone marrow derived DCs were cultured in vitro and the level of DC migration across a transwell in response to CCL2 and CCL3 measured n=3. C57BL/6 mice were irradiated and reconstituted with Nod2 -/- bone marrow (C57BL/6 Nod-/- ) and infected with T. muris. (D) A schematic representation of generation of bone marrow chimeras. (E) Successful reconstitution was determined by harvesting bone marrow from C57BL/6 Nod-/- mice and stimulating with media (negative control), MDP (1.0μg/ml) and LPS (100ng/ml, positive control). DC responses to the various ligands were analysed by assessing the level of maturation by CD86, CD40 and MHC-II up-regulation by flow cytometry. (F) Lamina propria and intraepithelial cells were isolated from the large intestine of C57BL/6 Nod-/- and C57BL/6 wt mice and stained for CD45, MHC-II, CD11c, CD103 and F4/80 on D5 post infection and measured as a percentage of the CD45 + population. (n=4-5) Data shown is mean +SEM. *P= <0.05 Chapter Two The role of Nod2 in T. muris infection 89

90 Nod2 -/- C57BL/6 Figure 6 Nod2 -/- colonic epithelial cells are unable to produce the chemokines CCL2 and CCL3. (A,B) Colonic epithelial cells were harvested from C57BL/6 and Nod2 -/- mice and stimulated with Peptidoglycan (PGN, 10μg/ml), Pam3Cys (0.1μg/ml), MDP (1.0μg/ml) and media as a control and the levels of CCL2 and CCL3 were measured by ELISA. White bars Nod2 -/-, Black bars C57BL/6. (B) Colonic epithelial cells were harvested from the colon of infected C57BL/6 and Nod2 -/- mice on D1 post infection. mrna levels of IL-33, CCL5 and CCL2 were measured by qpcr. (n=6-8) Data shown is mean +SEM. *P= <0.05 Chapter Two The role of Nod2 in T. muris infection 90

91 Discussion The immune response to T. muris is well characterised, with resistance being associated with an archetypal Th2 response and susceptibility with a dominant Th1 response [4]. However, the mechanisms that govern the initiation of the immune response, in terms of the recognition of the parasite, and recruitment of immune cells to the site of infection are unclear. In addition to providing a protective barrier, epithelial cells of the gastrointestinal tract have important roles in the immune response. Indeed, they have been shown to express MHC-II and CD86 [34-36] and have the ability to condition DCs [7] and T cells [37, 38]. Moreover, epithelial cells express PRRs that serve to recognise conserved structure on the surface of pathogens. PRR ligation initiates a cascade of events within epithelial cells which results in them producing cytokines and chemokines to allow the communication with other cells which can influence immune responses. There is no known PRR specific for T. muris. Both TLR4 -/- and MyD88 -/- mice are able to expel T. muris infection [39], suggesting that signalling through TLR4 and MydD88 pathways is not needed for the generation of Th2 immunity in T. muris infection. T. muris resides in an intimate relationship with the gastrointestinal epithelium with its head end burrowed within a syncytial tunnel and tail end free in the lumen of the gut, therefore, it is likely that the epithelial cells are activated by its presence. Thus, we investigated the role of a cytosolic PRR. Our data suggests a role for the epithelial cell expression of the PRR, Nod2, in mediating the recruitment of CD103 + DCs to the large intestine in T. muris infection. We showed in WT mice recruitment of CD103 + DCs to the large intestine happens early on in infection, with numbers increasing by D1 post infection and peaking at D5 post infection. The numbers of DCs did increase in the large intestine of Nod2 -/- mice but not to the same magnitude as WT animals indicating the lack of Nod2 has detrimental effects on the recruitment of DCs to the colon. We have defined a role specifically for the epithelial expression of Nod2. Our work suggests that Nod2 in colonic epithelial cells mediates DC recruitment in T. muris infection. Previous work from our group has shown that epithelial-derived chemokine secretion is important in driving the recruitment of DCs to the large intestine [11] with the chemokines CCL5 and CCL20 particularly implicated. We did not analyse CCL20 in this study and were unable to determine a definitive role for CCL5 as we saw no differences in epithelial expression of CCL5 between Nod2 -/- and WT CEC in vivo. It is likely that given that multiple chemokines are recognized by the same receptors that there is some redundancy. Furthermore, in the previous study, only BALB/c and AKR mice were analysed and not C57BL/6 mice. Thus there may be differences in the different mouse strains particularly when you consider that unlike BALB/c or AKR mice which have well defined and Chapter Two The role of Nod2 in T. muris infection 91

92 polarised responses to T. muris, C57BL/6 mice have a mixed Th1/Th2 response. Furthermore, it is not clear that CCL5 is critical for DC recruitment in resistant BALB/c mice as although blocking both CCL5 and CCL20 prevented DC recruitment, CCL5 was not tested alone, thus it may be that CCL20 is more important for the DC response. Other epithelial derived chemokines may also be important in DC recruitment and it should be noted that our previous studies investigated CCL5, CCL20, CCL3 and CCL2 [11]. In addition, other chemokines such as CCL1 may have a role in DC recruitment of the epithelium [40]. Our data may implicate a subtle role for epithelial derived CCL2 in recruitment of DCs as our in vitro data showed that Nod2 CECs had reduced secretion of CCL2 in response to various ligands. Our in vivo data is less clear and therefore more work needs to be done to clarify these differences further. However, differences in the ease of detecting mrna versus protein may account for the difference observed. Nevertheless when combined with the bone marrow chimera data these data show that an epithelial defect of chemokine expression, potentially CCL2, has a role in DC recruitment in response to parasite infection. The role of other chemokines remains to be addressed. Nod2 has been previously shown to be important in the production of chemokines. A recent study showed that Nod2 -/- mice had impaired secretion of CCL2 from the stromal compartment of the small intestine in response to bacterial infection [41]. Furthermore, this impaired chemokine production impacted on the recruitment of inflammatory monocytes to the site of infection [41]. Inflammatory monocytes have been shown to differentiate into DCs [42, 43] and macrophages [44, 45], and, it seems that the differentiation pathway of monocytes depends on the type of environment and the nature of the infection [46]. However, the researchers did not investigate the numbers of CD103 + DCs or whether the recruited monocytes differentiated into DCs or macrophages. Furthermore, they show that epithelial cells infected with Citrobacter rodentium do not produce CCL2 and that CCL2 production is unique to stromal cells beneath the epithelium. However, this was determined using an epithelial cell line rather than primary epithelial cells. We were able to see epithelial derived CCL2 by qpcr and ELISA in primary colonic epithelial cells suggesting differences may exist between primary cells and cell lines. One possibility in our model could be that stromal cells have contaminated our epithelial cells during isolation, however this method is established with analysis showing that the purity of the colonic epithelial cells is >98% [32, 47], thus their is unlikely to be substantial contamination. Nod2 signals through the NF-κB signalling pathway, importantly NF-κB signalling has been shown to be important for colonic epithelial cell function in T. muris infection. Mice lacking the IκB kinase Chapter Two The role of Nod2 in T. muris infection 92

93 (IKK-β) subunit of the IKK complex which is required for NF-κB activation are unable to develop a Th2 response and are thus rendered susceptible to T. muris infection [48]. This defect was attributed to a failure of epithelial cells to produce the DC-conditioning cytokine TSLP [48]. Thus showing that NF-κB signalling in epithelial cells is important in DC responses against T. muris. Thus defective Nod2 signalling through NF-κB may have an impact on the ability of colonic epithelial cells to condition DCs. The defect in immune cell recruitment seen in Nod2 -/- mice was specific to the CD103 + CD11c + DC population. Although an observed increase in F4/80 + cells was observed at D5 post infection, macrophage numbers were equivalent between WT and Nod2 -/- mice. Similarly we saw no difference in the number of basopohils in the colon of WT and Nod2 -/- mice. This suggests Nod2 has an important role in DC recruitment in the response to T. muris. Macrophages have previously been shown to be recruited to the large intestine in T. muris infection, however, at later time points [49] which suggests they have different roles to DCs in orchestrating immunity to T. muris and other mechanisms aside from Nod2 activation in the epithelium drive their recruitment or proliferation. DC migration to the site of infection is an important stage in the immune response [50, 51], with many papers showing that DCs are necessary for priming adaptive immunity. For example, effective DC migration is needed to prevent susceptibility to infection with the protozoan parasite, Cryptosporidium parvum [52]. Furthermore, epithelial-derived CCL20 has been shown to be important in driving skin DCs to the inflamed tissue [53]. Therefore, due to the observed impaired DC recruitment, we expected Nod2 -/- mice to be susceptible to T. muris infection. Analysis of worm burdens at D21 post infection showed that Nod2 -/- mice had impaired expulsion of T. muris but not development of Th2 immunity. We propose that Nod2-dependent epithelial responses promote DC recruitment which then impacts on the downstream immune response such that there is a delayed expulsion of the parasite. Importantly, Nod2 -/- mice were not devoid of DCs. For instance, while in the WT mice there was an increase at D1 post infection in CD103 + DCs this is not evident in Nod2 -/- mice. Furthermore, while DC numbers did increase at D5 post infection in the Nod2 -/- mice the magnitude was not as great as that observed in WT mice. Thus, not only suggesting that DC migration is both reduced and delayed in Nod2 -/- mice. However, the small level of DC migration in the Nod2 -/- mouse suggests that other mechanisms are involved in DC recruitment to the large intestine other than epithelial Nod2 signalling. For example, eosinophils have been shown to be important for DC recruitment to the lung draining lymph nodes [54]. As eosinophilia is observed during T. muris infection in both the MLN [55] and the intestine [56] we could hypothesise that eosinophils are also involved in DC recruitment. However, Chapter Two The role of Nod2 in T. muris infection 93

94 as eosinophil deficient mice are resistant to T. muris infection [55, 56] it is unlikely that they are the determining factor in DC recruitment to the gut but it is possible that they contribute. In addition, the fact that Nod2 -/- mice are resistant to infection suggests that the DCs that do get to the site of infection are sufficient to ultimately initiate effective immunity albeit impaired. Coupled with delayed expulsion of the worm, Nod2 -/- mice were able to mount an effective Th2 response producing the cytokines IL-13 and IL-4 at equivalent levels to WT animals despite the impaired DC migration. This is not the first time that effective DC function has been shown to not be paramount to parasite resistance. Experiments restricting antigen presentation to DCs during T. muris infection did not impede host clearance of the pathogen or the ability of the host to mount Th2 responses [41], in these sets of experiments the role of antigen presentation and T cell priming was attributed to basophils. We addressed whether, in the absence of an effective DC recruitment, there was a compensatory recruitment of basophils to the gut. However, our data demonstrated that basophils were detected at equivalent levels in the large intestine of both WT and Nod2 -/- mice post-infection albeit in very low numbers. Previous data has shown a role for basophils in augmenting Th2 responses [57, 58] therefore basophils may be acting to support the few CD103 + DCs observed in the Nod2 -/- mice and promoting T cell polarisation. Nod2 protein levels are notoriously hard to detect in normal tissues, nevertheless within the large intestine, Nod2 expression was found in epithelial cells and highest at the base of the crypts in proliferating cells. To indicate whether or not the Nod2 is activated by T. muris infection we analysed the levels of Nod2 and Rip2 in colonic epithelial cells in infected mice. Our data suggests Nod2 mrna and Rip2 mrna have a trend towards increased up-regulation within the first 24 hours post infection with T. muris. This correlates with the timeframe in which T. muris hatches and is thought to invade the epithelium, thus once the larvae begin to penetrate the epithelium Nod2 becomes activated. Evidence has shown that the time taken from ingestion to hatching in the caecum can be as short as 90 minutes. Once hatched T. muris larvae start their journey to the base of the crypts where they embed in the epithelium [3, 20]. Within the large intestine the larvae undergo four moults during their life cycle [3], during which the larvae move up the crypt axis so by the time the larvae reach adulthood they are observed near the top of the crypt with their anterior ends burrowed into the epithelium and their posterior end extending out into the lumen to allow mating. This then means that late in infection, the T. muris niche no longer corresponds with the location of Nod2 expression in the epithelium. Our investigations showed that the up-regulation of Nod2 mrna and Rip2 mrna in the epithelium was only transient with levels Chapter Two The role of Nod2 in T. muris infection 94

95 being back down to naïve at D5 post infection, which suggests that the Nod2 pathway may only be important in the initial stages of infection (0-48 hours). Our data demonstrates that Nod2 plays a role in initiating the immune response to T. muris. As well as acting as a bacterial PRR, Nod2 has been shown to recognise viral peptides [21]. Our data shows that Nod2 plays a role in the recruitment of CD103 + DCs to the colon in response to T. muris infection. The factors that drive the recognition of T. muris infection by Nod2 are still unknown. However, we have hypothesised some ways in which these events may occur (Figure7); PRRs have been shown to respond to damage associated molecular patterns such as heat shock proteins, ATP and heparin [12]. T. muris physically invades the gastrointestinal epithelial through the aid of the secretion of pore forming antigens [59, 60]. During this process the epithelium is put under a lot of stress potentially causing the release of DAMPs that may be detected by Nod2. Indeed, the NLR family member NLRP3 is a known to detect DAMPs and cellular stress [61, 62] and previous work has shown synergism between NLRP23 and Nod2 [63]. Moreover, T. muris infection has been associated with increased apoptosis in susceptible mice [64] and E/S antigen from the porcine parasite Trichuris suis, has been shown to have cytotoxic effects on intestinal epithelial cells [65]. Combined, these data support our hypothesis that damage caused during infection may trigger Nod2 activation. T. muris also produces an excretory/secretory antigen (ES antigen) which may contain components that have the potential to bind to Nod2. Indeed, CECs have been shown to response to T. muris E/S antigen by producing cytokines IFN-γ and TNF-α and also the chemokine CCL2 [10]. Notably, we observed reduced epithelial production of CCL2 both in vitro and in vivo in the absence of Nod2. Another possibility is that Nod2 directly recognises surface proteins on the helminth. Currently, we do not know what surface proteins are expressed on T. muris and if/how they interact with the epithelium or immune cells however this possibility cannot be ruled out yet. Finally, as the T. muris enters the epithelium, it may allow introduction of bacteria into the epithelial cells, either via opportunistic translocation of bacteria as pores are formed within the epithelial layer, or T. muris could directly carry bacteria on its surface into the epithelium. Chapter Two The role of Nod2 in T. muris infection 95

96 Damage caused by parasite? How does Nod2 mediate DC migration in response to T.muris? Secreted peptides in E/S? Direct recognition of parasite Introduction of bacteria carried in by T. muris 2) Activation of Nod2 4) NFκB independent pathway? RelA IκB P50 3) Nod2 signalling pathway activated 4) NFκB activation and translocation to nucleus 5) Gene transcription 6) Chemokine secretion 7) Dendritic cell recruitment Figure 7 How does T. muris activate Nod2? Schematic representation of the hypothesised ways T. muris activates Nod2. Nod2 may become activated during T. muris infection via four proposed mechanisms; 1) activation via the damage caused by the parasite. 2) T. muris secreted antigen activates Nod2. 3) Nod2 directly recognises peptides on the surface of the parasite. 4) While burrowing into the colonic epithelium T. muris allows the introduction of bacteria inside the cell. Bacteria can then stimulate Nod2 via MDP. Activation of Nod2 then triggers the Nod2 signalling pathway which ultimately leads to the release of chemokines from the epithelium and subsequent DC recruitment. In conclusion we have provided evidence that shows, for the first time, a role for a PRR in mediating the immune response to T. muris. Activation of Nod2 mediates the production of epithelial-derived chemokines which then induces the recruitment of CD103 + dendritic cells to the gastrointestinal epithelium. As DC recruitment to the epithelium has previously been shown to be important for host resistance to T. muris infection [11], activation of Nod2 is therefore potentially an important first step in the initiation of the immune response to T. muris. Chapter Two The role of Nod2 in T. muris infection 96

97 Acknowledgements This study was supported by the Biotechnology and Biological Sciences Research Council, Epistem Ltd., Work in PJM s laboratory is supported by NIH grant AI062921, NIH CORE grant P30 CA21765 and the American Lebanese Syrian Associated Charities. A special thanks to Dr Kaye Williams and her lab for their help with the bone marrow chimeras References 1. Bundy, D.A.P., (1988), Population Ecology of Intestinal Helminth Infections in Human Communities. Philosophical Transactions of the Royal Society of London. B, Biological Sciences : p Crompton, D.W.T., (1999), How Much Human Helminthiasis Is There in the World? The Journal of Parasitology. 85 3: p Cliffe, L.J. and Grencis, R.K., (2004), The Trichuris muris system: a paradigm of resistance and susceptibility to intestinal nematode infection. Adv Parasitol. 57: p Else, K.J., Hultner, L., and Grencis, R.K., (1992), Cellular immune responses to the murine nematode parasite Trichuris muris. II. Differential induction of TH-cell subsets in resistant versus susceptible mice. Immunology. 75 2: p Sallusto, F. and Lanzavecchia, A., (2002), The instructive role of dendritic cells on T-cell responses. Arthritis Res. 4 Suppl 3: p. S Mempel, T.R., Henrickson, S.E., and Von Andrian, U.H., (2004), T-cell priming by dendritic cells in lymph nodes occurs in three distinct phases. Nature : p Rimoldi, M., Chieppa, M., Salucci, V., Avogadri, F., Sonzogni, A., Sampietro, G., Nespoli, A., Viale, G., et al., (2005), Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nature Immunology. 6 5: p Hammad, H. and Lambrecht, B.N., (2008), Dendritic cells and epithelial cells: linking innate and adaptive immunity in asthma. Nat Rev Immunol. 8 3: p Liu, Y.J., Soumelis, V., Watanabe, N., Ito, T., Wang, Y.H., Malefyt, R.D., Omori, M., Zhou, B., et al., TSLP: An epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation, in Annual Review of Immunology. 2007, Annual Reviews: Palo Alto. p deschoolmeester, M.L., Manku, H., and Else, K.J., (2006), The Innate Immune Responses of Colonic Epithelial Cells to Trichuris muris Are Similar in Mouse Strains That Develop a Type 1 or Type 2 Adaptive Immune Response. Infection and Immunity : p Cruickshank, S.M., Deschoolmeester, M.L., Svensson, M., Howell, G., Bazakou, A., Logunova, L., Little, M.C., English, N., et al., (2009), Rapid Dendritic Cell Mobilization to the Large Intestinal Epithelium Is Associated with Resistance to Trichuris muris Infection. The Journal of Immunology : p Lotze, M.T., Zeh, H.J., Rubartelli, A., Sparvero, L.J., Amoscato, A.A., Washburn, N.R., DeVera, M.E., Liang, X., et al., (2007), The grateful dead: damage-associated molecular pattern molecules and reduction/oxidation regulate immunity. Immunological Reviews : p Chen, G., Shaw, M.H., Kim, Y.G., and Nunez, G., NOD-Like Receptors: Role in Innate Immunity and Inflammatory Disease, in Annual Review of Pathology-Mechanisms of Disease. 2009, Annual Reviews: Palo Alto. p Chapter Two The role of Nod2 in T. muris infection 97

98 14. Borzutzky, A., Fried, A., Chou, J., Bonilla, F.A., Kim, S., and Dedeoglu, F., (2010), NOD2- associated diseases: Bridging innate immunity and autoinflammation. Clinical Immunology : p Gutierrez, O., Pipaon, C., Inohara, N., Fontalba, A., Ogura, Y., Prosper, F., Nuñez, G., and Fernandez-Luna, J.L., (2002), Induction of Nod2 in Myelomonocytic and Intestinal Epithelial Cells via Nuclear Factor-κB Activation. Journal of Biological Chemistry : p Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Crespo, J., Fukase, K., Inamura, S., et al., (2003), Host Recognition of Bacterial Muramyl Dipeptide Mediated through NOD2. Journal of Biological Chemistry : p Caetano, B.C., Biswas, A., Lima-Junior, D.S., Benevides, L., Mineo, T.W.P., Horta, C.V., Lee, K.H., Silva, J.S., et al., (2011), Intrinsic expression of Nod2 in CD4 + T lymphocytes is not necessary for the development of cell-mediated immunity and host resistance to Toxoplasma gondii. European Journal of Immunology : p Ekman, A.-K. and Cardell, L.O., (2010), The expression and function of Nod-like receptors in neutrophils. Immunology : p Cruickshank. S, W.L., Cardone. J, Howdle. P, Murray. P, Carding. S,, (2008), Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival. World Journal of Gastroenterology : p Lee, T.D.G. and Wright, K.A., (1978), The morphology of the attachment and probable feeding site of the nematode Trichuris muris Canadian Journal of Zoology. 56 9: p Sabbah, A., Chang, T.H., Harnack, R., Frohlich, V., Tominaga, K., Dube, P.H., Xiang, Y., and Bose, S., (2009), Activation of innate immune antiviral responses by Nod2. Nat Immunol : p Shaw, M.H., Reimer, T., Sanchez-Valdepenas, C., Warner, N., Kim, Y.-G., Fresno, M., and Nunez, G., (2009), T cell-intrinsic role of Nod2 in promoting type 1 immunity to Toxoplasma gondii. Nat Immunol : p Kobayashi, K.S., Chamaillard, M., Ogura, Y., Henegariu, O., Inohara, N., Nuñez, G., and Flavell, R.A., (2005), Nod2-Dependent Regulation of Innate and Adaptive Immunity in the Intestinal Tract. Science : p Petnicki-Ocwieja, T., Hrncir, T., Liu, Y.-J., Biswas, A., Hudcovic, T., Tlaskalova-Hogenova, H., and Kobayashi, K.S., (2009), Nod2 is required for the regulation of commensal microbiota in the intestine. Proceedings of the National Academy of Sciences : p Rehman, A., Sina, C., Gavrilova, O., Häsler, R., Ott, S., Baines, J.F., Schreiber, S., and Rosenstiel, P., (2011), Nod2 is essential for temporal development of intestinal microbial communities. Gut. 26. Pauleau, A.-L. and Murray, P.J., (2003), Role of Nod2 in the Response of Macrophages to Toll-Like Receptor Agonists. Mol. Cell. Biol : p Wakelin, D., (1967), Acquired immunity to Trichuris muris in the albino laboratory mouse. Parasitology. 57 3: p Else, K., Wakelin, D., Wassom, D., and Hauda, K., (1990), MHC-restricted antibody responses to Trichuris muris excretory/secretory (E/S) antigen. Parasite Immunology : p Else, K.J., Wakelin, D., Wassom, D.L., and Hauda, K.M., (1990), The influence of genes mapping within the major histocompatibility complex on resistance to Trichuris muris infections in mice. Parasitology : p Else, K.J., Entwistle, G., and Grencis, R., (1993), Correlations between worm burden and markers of Th1 and Th2 cell subset induction in an inbred strain of mouse infected with Trichuris muris. Parasite Immunology : p Chapter Two The role of Nod2 in T. muris infection 98

99 31. Lutz, M.B., Kukutsch, N., Ogilvie, A.L.J., Rössner, S., Koch, F., Romani, N., and Schuler, G., (1999), An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. Journal of Immunological Methods : p Baumgart, D.C., Olivier, W.-A., Reya, T., Peritt, D., Rombeau, J.L., and Carding, S.R., (1998), Mechanisms of intestinal epithelial cell injury and colitis in interleukin 2 (IL-2)-deficient mice. Cellular Immunology. 187: p Perrigoue, J.G., Saenz, S.A., Siracusa, M.C., Allenspach, E.J., Taylor, B.C., Giacomin, P.R., Nair, M.G., Du, Y., et al., (2009), MHC class II-dependent basophil-cd4+ T cell interactions promote TH2 cytokine-dependent immunity. Nat Immunol. 10 7: p Lin, X.P., Almqvist, N., and Telemo, E., (2005), Human small intestinal epithelial cells constitutively express the key elements for antigen processing and the production of exosomes. Blood Cells, Molecules, and Diseases. 35 2: p Shao, L., Kamalu, O., and Mayer, L., (2005), Non-classical MHC class I molecules on intestinal epithelial cells: mediators of mucosal crosstalk. Immunological Reviews : p Kaiserlian, D., Vidal, K., and Revillard, J.-P., (1989), Murine enterocytes can present soluble antigen to specific class II-restricted CD4+ T cells. European Journal of Immunology. 19 8: p Westendorf, A.M., Bruder, D., Hansen, W., and Buer, J.A.N., (2006), Intestinal Epithelial Antigen Induces CD4+ T Cells with Regulatory Phenotype in a Transgenic Autoimmune Mouse Model. Annals of the New York Academy of Sciences : p Yamamoto, M., Fujihashi, K., Kawabata, K., McGhee, J.R., and Kiyono, H., (1998), A Mucosal Intranet: Intestinal Epithelial Cells Down-Regulate Intraepithelial, But Not Peripheral, T Lymphocytes. The Journal of Immunology : p Helmby, H. and Grencis, R.K., (2003), Essential role for TLR4 and MyD88 in the development of chronic intestinal nematode infection. European Journal of Immunology : p Stumbles, P.A., Strickland, D.H., Pimm, C.L., Proksch, S.F., Marsh, A.M., McWilliam, A.S., Bosco, A., Tobagus, I., et al., (2001), Regulation of Dendritic Cell Recruitment into Resting and Inflamed Airway Epithelium: Use of Alternative Chemokine Receptors as a Function of Inducing Stimulus. The Journal of Immunology : p Kim, Y.-G., Kamada, N., Shaw, Michael H., Warner, N., Chen, Grace Y., Franchi, L., and Núñez, G., (2011), The Nod2 Sensor Promotes Intestinal Pathogen Eradication via the Chemokine CCL2-Dependent Recruitment of Inflammatory Monocytes. Immunity. 34 5: p Rivollier, A., He, J., Kole, A., Valatas, V., and Kelsall, B.L., (2012), Inflammation switches the differentiation program of Ly6Chi monocytes from antiinflammatory macrophages to inflammatory dendritic cells in the colon. The Journal of Experimental Medicine : p Narni-Mancinelli, E., Campisi, L., Bassand, D., Cazareth, J., Gounon, P., Glaichenhaus, N., and Lauvau, G.g., (2007), Memory CD8+ T cells mediate antibacterial immunity via CCL3 activation of TNF/ROI+ phagocytes. The Journal of Experimental Medicine : p Robben, P.M., LaRegina, M., Kuziel, W.A., and Sibley, L.D., (2005), Recruitment of Gr-1+ monocytes is essential for control of acute toxoplasmosis. The Journal of Experimental Medicine : p Shechter, R., London, A., Varol, C., Raposo, C., Cusimano, M., Yovel, G., Rolls, A., Mack, M., et al., (2009), Infiltrating Blood-Derived Macrophages Are Vital Cells Playing an Antiinflammatory Role in Recovery from Spinal Cord Injury in Mice. PLoS Med. 6 7: p. e Chapter Two The role of Nod2 in T. muris infection 99

100 46. Gordon, S. and Taylor, P.R., (2005), Monocyte and macrophage heterogeneity. Nat Rev Immunol. 5 12: p Cruickshank. S, E.N., Felsburg. P, Carding. S, (2005), Characterization of colonic dendritic cells in normal and colitic mice. World Journal of Gastroenterology : p Zaph, C., Troy, A.E., Taylor, B.C., Berman-Booty, L.D., Guild, K.J., Du, Y., Yost, E.A., Gruber, A.D., et al., (2007), Epithelial-cell-intrinsic IKK-β expression regulates intestinal immune homeostasis. Nature : p Little, M.C., Bell, L.V., Cliffe, L.J., and Else, K.J., (2005), The characterization of intraepithelial lymphocytes, lamina propria leukocytes, and isolated lymphoid follicles in the large intestine of mice infected with the intestinal nematode parasite Trichuris muris. J Immunol : p Steinman, R.M. and Cohn, Z.A., (1973), Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J Exp Med : p Steinman, R.M. and Witmer, M.D., (1978), Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice. Proc Natl Acad Sci U S A : p Auray, G.l., Lacroix-Lamandé, S., Mancassola, R., Dimier-Poisson, I., and Laurent, F., (2007), Involvement of intestinal epithelial cells in dendritic cell recruitment during C. parvum infection. Microbes and Infection. 9 5: p Dieu-Nosjean, M.-C., Massacrier, C., Homey, B., Vanbervliet, B.a., Pin, J.-J., Vicari, A., Lebecque, S., Dezutter-Dambuyant, C., et al., (2000), Macrophage Inflammatory Protein 3α Is Expressed at Inflamed Epithelial Surfaces and Is the Most Potent Chemokine Known in Attracting Langerhans Cell Precursors. The Journal of Experimental Medicine : p Jacobsen, E.A., Zellner, K.R., Colbert, D., Lee, N.A., and Lee, J.J., (2011), Eosinophils Regulate Dendritic Cells and Th2 Pulmonary Immune Responses following Allergen Provocation. The Journal of Immunology : p Svensson, M., Bell, L., Little, M.C., DeSchoolmeester, M., Locksley, R.M., and Else, K.J., (2011), Accumulation of eosinophils in intestine-draining mesenteric lymph nodes occurs after Trichuris muris infection. Parasite immunology. 33 1: p Betts, C.J. and Else, K.J., (1999), Mast cells, eosinophils and antibody-mediated cellular cytotoxicity are not critical in resistance to Trichuris muris. Parasite immunology. 21 1: p Kim, S., Prout, M., Ramshaw, H., Lopez, A.F., LeGros, G., and Min, B., (2010), Cutting Edge: Basophils Are Transiently Recruited into the Draining Lymph Nodes during Helminth Infection via IL-3, but Infection-Induced Th2 Immunity Can Develop without Basophil Lymph Node Recruitment or IL-3. The Journal of Immunology : p Torrero, M.N., Hübner, M.P., Larson, D., Karasuyama, H., and Mitre, E., (2010), Basophils Amplify Type 2 Immune Responses, but Do Not Serve a Protective Role, during Chronic Infection of Mice with the Filarial Nematode Litomosoides sigmodontis. The Journal of Immunology : p Drake, L., Korchev, Y., Bashford, L., Djamgoz, M., Wakelin, D., Ashall, F., and Bundy, D., (1994), The Major Secreted Product of the Whipworm, Trichuris, is a Pore-Forming Protein. Proceedings: Biological Sciences : p Drake, L.J., Barker, G.C., Korchev, Y., Lab, M., Brooks, H., and Bundy, D.A., (1998), Molecular and functional characterization of a recombinant protein of Trichuris trichiura. Proceedings. Biological sciences / The Royal Society : p Tschopp, J. and Schroder, K., (2010), NLRP3 inflammasome activation: the convergence of multiple signalling pathways on ROS production? Nat Rev Immunol. 10 3: p Chapter Two The role of Nod2 in T. muris infection 100

101 62. Leemans, J.C., Cassel, S.L., and Sutterwala, F.S., (2011), Sensing damage by the NLRP3 inflammasome. Immunological Reviews : p Conforti-Andreoni, C., Beretta, O., Licandro, G., Qian, H.L., Urbano, M., Vitulli, F., Ricciardi- Castagnoli, P., and Mortellaro, A., (2010), Synergism of NOD2 and NLRP3 activators promotes a unique transcriptional profile in murine dendritic cells. Journal of Leukocyte Biology. 88 6: p Cliffe, L.J., Potten, C.S., Booth, C.E., and Grencis, R.K., (2007), An Increase in Epithelial Cell Apoptosis Is Associated with Chronic Intestinal Nematode Infection. Infection and Immunity. 75 4: p Abner, S.R., Hill, D.E., Turner, J.R., Black, E.D., Bartlett, P., Urban, J.F., and Mansfield, L.S., (2002), Response of intestinal epithelial cells to Trichuris suis excretory/secretory products and the influence of campylobacter jejuni invasion under in vitro conditions. Journal of Parasitology. 88 4: p Chapter Two The role of Nod2 in T. muris infection 101

102 102

103 Chapter Three Arginase-1 Expressing Macrophages are Dispensable for Resistance to Infection with the Gastrointestinal Helminth Trichuris muris. Rowann Bowcutt * 1, Louise V Bell* 1, Matthew Little 1, Jim Wilson 2, Cath Booth 2, Peter J. Murray 3, Kathryn J Else *1, Sheena M Cruickshank. *1 1 Faculty of Life Sciences, AV Hill Building, University of Manchester, Manchester M13 9PT. 2 Epistem Limited, Incubator Building, Grafton Street, Manchester, M13 9XX, UK. 3 Departments of Infectious Diseases and Immunology, St. Jude Children s Research Hospital, Memphis, TN Author Contributions: *These authors contributed equally to the paper. * These authors share senior authorship Rowann Bowcutt carried out all work in the with the Arg1 flox/flox ;Tie2-cre transgenic mice Louise V Bell carried out all nor-noha experiments Matthew Little carried out work in Figure 1 E and F Jim Wilson and Cath Booth were the industrial supervisors of Rowann Bowcutt Peter J Murray donated the Arg1 flox/flox ;Tie2-cre mice Kathryn Else and Sheena Cruickshank supervised the project Manuscript published in Parasite Immunology, 2011, Volume 33, Pages Chapter Three Arg1-expressing macrophages in T. muris infection 103

104 Abstract Alternatively-activated macrophages (AAMs) have key roles in the immune response to a variety of gastrointestinal helminths such as Heligmosomoides bakeri and Nippostrongylus brasiliensis. In addition AAMs have been implicated in the resolution of infection-induced pathology in Schistosoma mansoni infection. AAM exert their activity in part via the enzyme arginase-1 (Arg1), which hydrolyzes L-arginine into urea and ornithine, and can supply precursor substrate for proline and polyamine production. Trichuris muris is a worm that resides in the large intestine with resistance being characterized by a Th2 T cell response, which drives AAM production in the local environment of the infection. In order to investigate the role of arginase and Arg1 expression in macrophages during T. muris infection, we used independent genetic and pharmacologic models of arginase deficiency. In acute infection and Th2 dominated immunity, arginase-deficient models expelled worms normally. Macrophage-Arg1-deficient mice showed cytokine and antibody levels comparable to wild-type animals in acute and chronic infection. We also found no role for macrophage-arg1 in infection-induced pathology in the response to T. muris in either chronic (Th1 dominated) or acute (Th2 dominated) infections. Our data demonstrates that, unlike other gastrointestinal helminths, Arg1 expression in AAMs is not essential for resistance to T. muris or effective resolution of helminth-induced inflammation. Chapter Three Arg1-expressing macrophages in T. muris infection 104

105 Introduction Macrophages play pivotal roles in both innate and adaptive immune responses through phagocytosis, antigen presentation and direct pathogen killing. In addition to host protection, macrophages are also involved in the maintenance of gut homeostasis, the resolution of pathology and tissue repair. [1] The cytokine milieu is thought to lead to the development of two broad subsets of macrophage. [2] Classically activated macrophages (CAMs) have been shown to develop in a Th1 environment with IFN-γ playing a significant activation role. [2] In addition, TNFα and microbial products such as lipopolysaccharide (LPS) influence classical activation. [3] CAMs exert their protective role against intracellular pathogens through L-arginine metabolism and the subsequent production of nitric oxide. [3] By contrast to CAMs, STAT6-dependent alternative activation occurs in the presence of IL-4 or IL-13, produced by Th2 cells and innate immune cells such as mast cells. [3] AAMs are characterised by the up-regulation of the cell surface receptors IL4Rα chain and mannose receptor (MR), and the expression of the genes Arg1, Retnla (encoding Fizz1/RELMα) and Chi3l3 (Ym1),, and the transcription factor PPARγ. [3] Along with their role in tissue repair, and because of their development in a Th2-rich environment, AAMs have been hypothesised to play an important role in immunity to extracellular pathogens such as helminths. [4] Immunity to helminths is mediated by CD4 + T cells, with a Th1 response associated with susceptibility to infection and a Th2 response associated with parasite expulsion and resistance. [5] Previous research has shown AAMs to be present in most helminth infections. The numbers of circulating AAMs increase in mice upon infection with the small-intestinal parasite Nippostrongylus brasiliensis, and the infection-associated alterations of the gastrointestinal smooth muscle are thought to be AAMØ dependent. [6] N.brasiliensis expulsion has also been shown to be impaired after clodronate mediated depletion of macrophages or after blocking arginase activity by pharmacologic agents. [6] AAMs are thought to be important in infections with other nematodes such as Brugia malayi and Litomosiodes sigmodontis, where infection induces the recruitment of F4/80 + cells, along with the up-regulation of the associated alternatively activated genes, Retnla (RELMα /FIZZ1) and Chi3l3 (Ym1), at the site of infection. [7] Furthermore, depletion of macrophages or blocking arginase activity with the inhibitor BEC in mice infected with Heligmosomoides bakeri (formerly Heligmosomoides polygyrus) results in increased parasite burdens. [8] Previous research has therefore suggested a role for AAMs in a range of parasitic infections as possible effector cells. We aimed to define the role of the Arg1-expressing macrophages and arginase in resistance to the large-intestinal parasite Trichuris muris (T. muris). Resistance to T. muris infection is Chapter Three Arg1-expressing macrophages in T. muris infection 105

106 associated with a dominant Th2 response characterised by IL-4, IL-13, IL-9, IL-5 and susceptibility a Th1 response characterised by IFN-γ and IL-12. [5] AAMs have been shown to be present in the caecum and proximal colon of T. muris-infected, resistant C57BL/6 mice around the time of parasite expulsion. We used the mice lacking Arg1 in macrophages [9], where the floxed arginase-1 (Arg1) gene is deleted in all haematopoietic and endothelial cell lineages. Arg1 is expressed in myeloid and not lymphoid lineages therefore Arg1 flox/flox ;Tie2-cre mice are used as a model of Arg1 deficiency in macrophages. [9] In addition we used C57BL/6 mice treated with the arginase inhibitor nor-noha [10] which inhibits the activity of both Arginase 1 and Arginase 2. We measured parasite expulsion kinetics along with several parameters of gut pathology in both these mouse models. Our data therefore suggests that arginase activity nor Arg1 expression in macrophages is not essential for resistance to T. muris, and in addition is not crucial for the effective resolution of helminth-induced pathology. Chapter Three Arg1-expressing macrophages in T. muris infection 106

107 Materials and methods Mice Male Arg1 flox/flox ;Tie2-cre and control Arg1 +/+ ;Tie2-cre e [11] mice have been described and were bred in-house. [9, 12] All mice were routinely screened by PCR to confirm their genotype Arg1 flox/flox ;Tie2-cre [9]. PCR was performed on ear punches using TaqGold and buffers (Applied Biosystems). Primer sequences were as follows: floxed allele; 5 -TGCGAGTTCATGACTAAGGTT-3 5 -AAAGCTCAGGTGAATCGG-3. Tie2cre; 5 -CGCATAACCAGTGAA ACAGCATTGC-3 5 -CCCTGTGCTCAGACAGAAATGA G A-3 Delta allele; 5 -CCCCCAAAGGAAATGTAAGAA-3 5 -CACTGTCTAAG CCCGA G AGTA-3 Specific pathogen-free male C57BL/6 mice were purchased at 6-8 weeks of age from Harlan Olac (Bicester, UK). All mice were maintained by the Biological Services Unit (BSU), University of Manchester, UK and kept in individually ventilated cages. Animals were treated and experiments performed according to the Home Office Animals (Scientific Procedures) Act (1986) Parasites Maintenance of the T. muris lifecycle and production of excretory/secretory (E/S) antigen was carried out as described previously. [13] Mice were infected with approximately 175 embryonated eggs by oral gavage and killed at various timepoints post infection (p.i.), when worm burdens [14, 15] were assessed as described previously. Parasite-specific antibody ELISA Trichuris muris-specific IgG1 and IgG2a were measured in sera samples collected at autopsy by ELISA in a previously described method. [16] Histology Caecal snips were fixed in neutral buffered formalin (NBF) for 24 hours, processed and embedded in paraffin wax. 5 µm sections were then dewaxed, rehydrated and stained using a standard Haematoxylin & Eosin, Periodic acid Schiff or Gomori's One-Step Trichrome Stain method. Crypt length was measured in 20 crypts per mouse from H&E-stained sections using WCIF ImageJ software. Goblet cells were counted in 20 crypts per mouse from PAS-stained sections. All slides were measured and counted in a blind, randomised order. Chapter Three Arg1-expressing macrophages in T. muris infection 107

108 Expression of arginase and RELMα was assessed in gut caecum tissue by immunohistochemistry. Slides of paraffin embedded tissue were dewaxed and rehydrated. Endogenous peroxidases were quenched by incubation for 20 mins in 30% H 2 O 2 in methanol for anti-arginase stained samples and 1.5μl/ml glucose oxidase (Sigma Aldrich) for RELMα stained sections. Antigen retrieval was performed using pepsin digest solution (Invitrogen). Sections were blocked with rat serum for 1 hour and endogenous biotins were blocked using the avidin/biotin blocking kit as per the manufacturers instructions (Vector Lab). For arginase1 staining only slides were incubated with the mouse on mouse (M.O.M) Ig blocking reagent for 1 hour. Stock M.O.M diluent was added to the slides for 5minutes. Sections were incubated with primary antibodies to arginase1 (Beckon Dickinson) diluted in M.O.M diluent or anti-relmα (R and D Systems) diluted in PBS. For RELMα staining only a secondary antibody biotinylated goat anti-rat IgGF(ab) 2 (Chemicon International) was used. Slides were incubated with avidin and biotinylated horseradish peroxidase macromolecular complex kit, (ABC, Vector laboratories), for 30mins. 3, 3 diaminobenzidine (DAB substrate for peroxidase, Vector Laboratories) was added to samples and the colour development monitored under a microscope. Slides were washed and counterstained with HaemQS; washed and mounted. The number of arginase positive of RELMα positive cells were quantified in a blind randomized order. Mesenteric Lymph Node cell culture Single cell suspensions were prepared from mesenteric lymph nodes (MLNs) taken at autopsy and added at 5 x 10 6 cells per well in 1ml cultures to 48-well plates and stimulated with T. muris E/S at 50µg/ml. Cells were incubated at 37 C, 5% CO 2, 95% humidity for 48 hours, after which time supernatants were harvested and stored at 20 C for later cytokine analysis by cytokine bead array (CBA). Cytokine Bead Array Levels of IL-4, IL-10, IL-6, IL-9, IL-13, Interferon gamma, tumour necrosis factor α, IL-12p70 and MCP1 were determined via cytometric bead array (CBA, Becton Dickenson). Briefly lyophilized cytokine standards were pooled, reconstituted using assay diluent and serial dilutions from 1:2 to 1:256 prepared. The Protein Flex Set Capture Bead mix and Protein Flex Set Detection Reagent mix were prepared; all beads were pooled allowing 0.3μl of each bead per well, beads were reconstituted in the total volume needed in capture bead or detection reagent diluent. 16.5μl of capture bead mix and 16.5μl of standard/sample was added to each well; Plates were shaken for 5 minutes and incubated for 1 hour. 16.5μl of detection bead mixture was added to each well. Chapter Three Arg1-expressing macrophages in T. muris infection 108

109 Plates incubated for 1 hour. Plates were washed and beads re-suspended. Samples were then analysed using BD FacsAria cytometer and FCAP Array software. Statistics Where statistics are quoted, two experimental groups were compared using the Mann Witney U- test. Three or more groups were compared using the Kruskall Wallis test, with Dunn's multiple comparison post-test. P-values < 0 05 were considered significant. All statistical analyses were carried out using GraphPad Prism for windows, version Chapter Three Arg1-expressing macrophages in T. muris infection 109

110 Results Expulsion of T. muris from BL6 mice does not require Arg1 expression in macrophages. Male Arg1 flox/flox ;Tie2-cre and control Arg1 +/+ ;Tie 2-cre were infected with 175 infective T. muris eggs, killed at days 21 and 35 p.i., and worm burdens assessed (Figure 1A). Both Arg1 flox/flox ;Tie 2- cre and Arg1 +/+ ;Tie 2-cre mice were able to expel the worms, with almost all mice completely clear of parasites by day 35 p.i. C57BL/6 mice were also infected with around 175 infective T. muris eggs and treated with nor-noha by i.p. injection up to day 21 post-infection to inhibit all arginases including arginase 1. Mice treated with nor-noha expelled their worm burden as efficiently as PBS control-treated animals (Figure 1B). These data suggest that arginase activity in general is not essential for the expulsion of T. muris. Arginase expressing macrophages were rare in the naïve gut but increased significantly around day 21 post-infection (Figure 1C,D). Furthermore, the arginase staining confirmed that there was an absence of arginase in macrophages in the caecum of Arg1 flox/flox ;Tie 2-cre animals (Figure 1 C,D). Similar results were observed using RELMα (encoded by Retnla), a marker of AAMs, by immunohistochemistry. RELMα positive cells were increased in the guts of mice post-infection with T.muris but reduced in the presence of the arginase inhibitor nor-noha (Figure 1E and F). Chapter Three Arg1-expressing macrophages in T. muris infection 110

111 Figure 1 Expulsion of T. muris from BL6 mice is not dependent on arginase or Arg1 expression in macrophages. Mice were infected orally with approximately 175 embryonated T. muris eggs, killed at days 14, 21 and 35 p.i., and worm burden in the caecum and proximal colon assessed. A, Arg1 flox/flox ;Tie 2-cre (Arg fl/fl ) and Arg1 +/+ ;Tie 2-cre (Arg +/+ ) worm burden at day 21 and 35 p.i. B, worm burden at day 14 and 35 p.i. nor-noha-treatecontrol-treated (PBS) C57BL/6 mice. (n-n) and PBS Data shown are for individual mice ( ), with mean values per group (-) and are pooled from two independent experiments, n = 5 (Arg1 +/+ ;Tie 2-cre mice) and n = 8 for (Arg1 flox/floxx ;Tie 2-cre mice) (A), and n=5 mice per group (B). ND=not done. Quantification of number of arginase1 + cells (arrowed) per crypt in the caecum of naïve, D21 and D35 post infection in Arg1 +/+ ;Tie 2-cre mice (C) data shown is mean + SEM, No arginase positive cells were found in Arg1 flox/flox ;Tie 2-cre mice. Representative images of arginase staining are shown in Figure 1,D (Scale bar =50μm).Quantification of number of RELMα + cells (arrowed) per crypt in naïve, nor-noha-treated (n-n) and PBS control-treated (PBS) C57BL/6 mice (E) data shown is mean +SEM. Representative images of RELMα staining are shown in F (Scale bar =50μm). *P= <0.05 Chapter Three Arg1-expressing macrophages in T. muris infection 111

112 T. muris-specific cytokine responses are not affected by the absence of arginase. MLN cells from both Arg1 flox/flox ;Tie2-cre and control Arg1 +/+ ;Tie 2-cre, and nor-noha- or PBStreated C57BL/6 mice at day 21 p.i. were cultured with T. muris E/S antigens and the supernatants analysed for IFN-γ and IL-13 by CBA (Figure 2). Levels of IFN-γ were similar between Arg1 flox/flox ;Tie2-cre and Arg1 +/+ ;Tie 2-cre controls (Figure 2A) and between nor-noha- and PBStreated BL6 mice (Figure 2C). Also, there were no differences in IL-13 between Arg1 flox/flox ;Tie 2-cre and Arg1 +/+ ;Tie 2-cre controls (Figure 2B) or between nor-noha- and PBS-treated BL6 mice (Figure 2D). Similarly no significant differences in MLN derived IL-10 were observed post-infection between control PBS treated mice 458.3pg/ml ± 107.9pg/ml,mice and nor-noha treated mice (347.8pg/ml ± 267.8pg/ml) as well as Arg1 +/+ ;Tie 2-cre infected 43.4 pg/ml ± 62.3 pg/ml and Arg1 flox/flox ;control Arg1 +/+ ;Tie 2-cre infected mice (196.7 pg/ml ± pg/ml). Furthermore, there were no significant differences in the levels post-infection of CCL2 (MCP1) between control PBS-treated (916.9 pg/ml ± pg/ml and nor-noha treated groups (780.4 pg/ml ± pg/ml) as well as Arg1 +/+ ;Tie 2-cre control mice (355.8 pg/ml ± pg/ml) and.arg1 flox/flox ;Tie2- cre mice (256.3 pg/ml ± pg/ml). In addition to the cytokines displayed in figure2 and those mentioned above we measured levels of IL-4, IL-6, IL-9, IL-13, Interferon-γ, tumour necrosis factor α, IL-12p70. No differences were observed between all cytokines analysed, thus, arginases do not seem play an overt role in the regulation of Th cell responses to T. muris infection. Chapter Three Arg1-expressing macrophages in T. muris infection 112

113 Figure 2 T. muris-specific cytokine responses are not affected by the absence of arginase. Mice were infected orally with approximately 175 embryonated T. muris eggs and MLN cells restimulated with T. muris E/S at day 21 p.i. IFN-γ and IL-13 levels in supernatants were then assayed by CBA. Arg1 flox/flox ;Tie 2-cre (Arg fl/fl ) and Arg1 +/+ ;Tie 2-cre (Arg +/+ ) IFN-γ (A) and IL-13 (B) infected versus naïve animals. C,D; nor-noha-treated (n-n) and PBS-treated (PBS) infected C57BL/6 mice versus naïve. Data shown are for individual mice ( ), with mean values per group (-) with +/- SEM and are pooled from two independent experiments. IFN-γ data is presented on a linear axis whereas IL-13 data is presented on a log scale. n = 3 naïve animals, n = 5 (Arg1 +/+ ;Tie 2-cre infected animals), n = 8 (Arg1 flox/flox ;Tie 2-cre infected animals) (A,B) and n=5 mice per group (C,D). Chapter Three Arg1-expressing macrophages in T. muris infection 113

114 T. muris-specific serum antibody responses are not affected by the absence of arginase activity. Serum from both Arg1 flox/flox ;Tie2-cre and Arg1 +/+ ;Tie 2-cre controls and nor-noha- or PBS-treated C57BL/6 mice was harvested at day 35 p.i. and levels of T. muris-specific IgG1 and IgG2a measured by ELISA (Figure 3). There were no significant differences in levels of IgG1 or IgG2a between Arg1 flox/flox ;Tie 2-cre and Arg1 +/+ ;Tie 2-cre controls (Figure 3A and B), or indeed between C57BL/6 mice treated with nor-noha compared to PBS controls (Figure 3C and D). Figure 3 T. muris-specific serum antibody responses are not affected by the absence of arginase. Mice were infected orally with approximately 175 embryonated T. muris eggs and serum harvested at day 35 p.i. T. muris-specific IgG1 and IgG2a levels were measured by ELISA from sera samples diluted at 1 in 80 with PBS (A,B) and at 1 in 160 with PBS (C,D). A,B; IgG1 and IgG2a levels in Arg1 flox/flox ;Tie 2-cre (Arg fl/fl ) and Tie 2-cre (Arg +/+ ) mice. C,D; nor-noha (n-n) versus PBS-treated C57BL/6 mice. Data shown are mean +SEM and are pooled from two independent experiments. n = 3 (Tie 2-cre and Arg1 flox/flox ;Tie 2-cre naïve animals), n = 5 (Tie 2-cre animals) n = 8 (Arg1 flox/flox ;Tie 2-cre infected animals) (A,B) and n=5 mice per group (C,D). Chapter Three Arg1-expressing macrophages in T. muris infection 114