PCR testing for FMR1-related disorders at the Children s Hospital at Westmead: past and present. Dr Karen Wong

Size: px
Start display at page:

Download "PCR testing for FMR1-related disorders at the Children s Hospital at Westmead: past and present. Dr Karen Wong"

Transcription

1 PCR testing for FMR1-related disorders at the Children s Hospital at Westmead: past and present Dr Karen Wong

2 FMR1-related disorders Fragile X syndrome Fragile X-associated tremor/ataxia (FXTAS) Fragile X-associated Primary Ovarian Insufficiency (FXPOI) Majority are caused by an expansion of CGG repeats at 5 -untranslated region of the first exon of the FMR1 gene.

3 FMR1-related disorders Normal individual 5-44 CGG repeats. Intermediate CGG repeats Premutation CGG repeats (FXTAS & FXPOI) Full mutation >200 CGG repeats (FRAXA) Lab (since 2000) Determine no. of CGG repeats by amplifying CGG repeats region in FMR1 using PCR ~800 patients Fragile X testing/year

4 Fragile X testing (2000 mid 2012) Batch of patients DNA set up PCR - Fu primers and Roche Expand kit Visualise on CE (Qiaxcel) AGRF for fragment separation (AB 3730) Each time perform a batch, 9 controls are included in PCR along with patients DNA.

5 Fragile X testing (2000 mid 2012) Traces from AGRF Linear regression to generate standard curve to determine no. CGG repeats based on 9 controls

6 Fragile X testing (2000 mid 2012) Anonymous patients DNA with Known CGG repeats (19-91) , ,30 29, ,30 31, P1 P2 P3 Standard curve generated based on fragment sizes and known CGG repeats of 9 controls.

7 Fragile X testing (2000 mid 2012) Patient s CGG repeats interpolated based on fragment size. 31 We use own controls as our fragments are GC rich; run differently to internal controls.

8 In house method Limitations Region GC rich, Taq only amplify fragments <100 CGG repeats. Cannot detect fragments >100 repeats. Cannot distinguish homozygote females and females heterozygote for a large PM/FM. Taq only amplify <50 repeats nicely repeats, MU increases. Cannot accurately size fragments >50 repeats.

9 CGG repeats <50 CGG repeats >50

10 In house method Limitations Region GC rich, Taq only amplify fragments <100 CGG repeats. Cannot detect fragments >100 repeats. Cannot distinguish homozygote females and females heterozygote for a large PM/FM Taq only amplify <50 repeats nicely repeats, MU increases. Cannot accurately size fragments >50 repeats. Cannot exclude mosaicism for a larger fragment in males or females showed up normal.

11 In house method Limitations Overcome limitations by sending: 1. Males and females CGG repeats >50 2. Homozygote females 3. Males that cannot amplify To another facility (SEALS) that performed Southern Blots/Amplidex to determine if there was a larger fragment.

12 Fragile X testing (mid 2012-now) Asuragen Amplidex PCR kit Amplify >200 CGG repeats (GC rich polymerase). Same as in-house except all controls in 1 tube F+R primers to generate fragment of a set size. In addition, contains 3 rd primer (CGGx5) binds along CGG repeats resulting in series of smaller fragments.

13 CGGCGGCGGCGGCGG FMR1-R GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGGCGGCGGCGGCGG FMR1-F

14 CGGCGGCGGCGGCGG FMR1-R GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGGCGGCGGCGGCGG FMR1-F

15 CGGCGGCGGCGGCGG CGGCGGCGGCGGCGG CGGCGGCGGCGGCGG CGGCGGCGGCGGCGG FMR1-R GCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGGCGGCGGCGGCGG FMR1-F Generate a fragment of set sizes and a series of smaller fragments

16 Amplidex Control tube with 6 controls

17 Fragile X testing (mid 2012-now) Asuragen Amplidex PCR kit Able to resolve zygosity between females patients.

18 Fragile X testing (mid 2012-now) Asuragen Amplidex PCR kit Able to resolve zygosity between females patients.

19 Fragile X testing (mid 2012-now) Asuragen Amplidex PCR kit Able to resolve zygosity between females patients.

20 Fragile X testing (mid 2012-now) Asuragen Amplidex PCR kit Relatively expensive compared to in house method $7000/100 rxns Estimated cost (DNA extraction, reagents, labour, analysis) In House - $30/patient Amplidex - $90/patient Australian Medicare rebate on Fragile X testing ~$85 Not cost effective to use Amplidex for all patients!

21 Fragile X testing (mid 2012-now) Overcome this: We use new work scheme of: 1) In house method for all males 2) Amplidex for all females, males with CGG repeats >50, and males that don t amplify Able to Detect and size CGG repeats >50 Resolve zygosity in female patients ~$/patient more cost effective than $85 Participate in the full QAP scheme for Fragile X

22 Fragile X testing (mid 2012-now) Limitations of new work scheme 1) Small volume of GC rich polymerase (Amplidex)/rxn (0.05uL/rxn), cannot start a batch until min 10 patients. 2) Possibility of missing mosaicism for a larger fragment in males with a normal sized allele.

23 Open discussion Our interest How common is presence of mosaicism in males? How common is the presence of point mutations in FMR1? Is the use of the Amplidex method equivalent to the Southern Blot? -? Medicare rebate

24 Acknowledgement Julianne Jackson Gemma Jenkins Katrina Fisk Patricia Amiatu Tiffany Lai Lingli Zhang Bruce Bennetts CHW Molecular Genetics Laboratory CHW

FRAGILE X MOLECULAR DIAGNOSTICS ORDERING INFORMATION. FragilEaseTM FRAGILEASETM ASSAY CHARACTERISTICS WORKFLOW. PCR Purification.

FRAGILE X MOLECULAR DIAGNOSTICS ORDERING INFORMATION. FragilEaseTM FRAGILEASETM ASSAY CHARACTERISTICS WORKFLOW. PCR Purification. ORDERING INFORMATION FRAGILEASE ASSAY CHARACTERISTICS High and low throughput options for cost- and timeefficient analyses 96 or 1152 reactions per kit Turnaround time from DNA to report approximately

More information

Fragile X One gene, three very different disorders for which Genetic Technology is essential. Significance of Fragile X. Significance of Fragile X

Fragile X One gene, three very different disorders for which Genetic Technology is essential. Significance of Fragile X. Significance of Fragile X Fragile X One gene, three very different disorders for which Genetic Technology is essential Martin H. Israel Margaret E. Israel mhi@wustl.edu meisrael@sbcglobal.net uel L. Israel Association of Genetic

More information

Fragile X Syndrome and Infertility Case Example - Not One, but Three

Fragile X Syndrome and Infertility Case Example - Not One, but Three Vol. 008 Fragile X Syndrome and Infertility Fragile X Syndrome and Infertility Case Example - Not One, but Three Abstract A case review of a female patient who was treated for infertility of unknown reasons

More information

ORIGINAL RESEARCH ARTICLE American College of Medical Genetics and Genomics

ORIGINAL RESEARCH ARTICLE American College of Medical Genetics and Genomics ORIGINAL RESEARCH ARTICLE American College of Medical Genetics and Genomics Molecular genetic testing for fragile X syndrome: laboratory performance on the College of American Pathologists proficiency

More information

Population Screening for Fragile X Syndrome

Population Screening for Fragile X Syndrome Population Screening for Fragile X Syndrome FLORA TASSONE PH.D. DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR MEDICINE AND MIND INSTITUTE UC DAVIS, CALIFORNIA USA Molecular Pathology: Principles in Clinical

More information

Genetic Testing for FMR1 Variants (Including Fragile X Syndrome)

Genetic Testing for FMR1 Variants (Including Fragile X Syndrome) Medical Policy Manual Genetic Testing, Policy No. 43 Genetic Testing for FMR1 Variants (Including Fragile X Syndrome) Next Review: February 2019 Last Review: February 2018 Effective: April 1, 2018 IMPORTANT

More information

Next-generation Diagnostics for Fragile X disorders

Next-generation Diagnostics for Fragile X disorders Next-generation Diagnostics for Fragile X disorders Overview Bio-Link presents novel diagnostic technology that offers compelling clinical, technical and commercial advantages over existing tests for fragile

More information

The Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) READ ONLINE

The Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) READ ONLINE The Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) READ ONLINE If you are searching for a ebook The Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) in pdf form, then you have come on to correct

More information

UK National Screening Committee. Screening for Fragile X Syndrome in Pregnancy. 18 June 2015

UK National Screening Committee. Screening for Fragile X Syndrome in Pregnancy. 18 June 2015 UK National Screening Committee Screening for Fragile X Syndrome in Pregnancy 18 June 2015 Aim 1. This document provides background on the item addressing antenatal screening for Fragile X syndrome. Current

More information

Protocol Guide. For Research Use Only. Not for Use in Diagnostic Procedures.

Protocol Guide. For Research Use Only. Not for Use in Diagnostic Procedures. Protocol Guide For Research Use Only. Not for Use in Diagnostic Procedures. 49402 100 Asuragen, Inc. 2170 Woodward St. Austin, TX 78744-1840 USA +1.512.681.5200 AmplideX PCR/CE FMR1 Reagents (RUO) PC-0170v2

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Genetic Testing for FMR1 Mutations Including Fragile X Syndrome File Name: Origination: Last CAP Review Next CAP Review Last Review genetic_testing_for_fmr1_mutations_including_fragile_x_syndrome

More information

Are we Close to Solve the Mystery of Fragile X Associated Premature Ovarian Insufficiency (FXPOI) in FMR1 Premutation Carriers?

Are we Close to Solve the Mystery of Fragile X Associated Premature Ovarian Insufficiency (FXPOI) in FMR1 Premutation Carriers? Are we Close to Solve the Mystery of Fragile X Associated Premature Ovarian Insufficiency (FXPOI) in FMR1 Premutation Carriers? Yoram Cohen M.D. Department of Obstetrics and Gynecology, IVF Unit, Sheba

More information

FRAGILE X 101. A guide for the newly-diagnosed and those already living with Fragile X. fragilex.org

FRAGILE X 101. A guide for the newly-diagnosed and those already living with Fragile X. fragilex.org FRAGILE X 101 A guide for the newly-diagnosed and those already living with Fragile X. fragilex.org Introduction Most people first hear about Fragile X disorders when someone in their family is unexpectedly

More information

This fact sheet describes the condition Fragile X and includes a discussion of the symptoms, causes and available testing.

This fact sheet describes the condition Fragile X and includes a discussion of the symptoms, causes and available testing. 11111 Fact Sheet 54 FRAGILE X SYNDROME This fact sheet describes the condition Fragile X and includes a discussion of the symptoms, causes and available testing. In summary Fragile X is a condition caused

More information

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

More information

Population-based estimates of the prevalence of FMR1 expansion mutations in women with early menopause and primary ovarian insufficiency

Population-based estimates of the prevalence of FMR1 expansion mutations in women with early menopause and primary ovarian insufficiency American College of Medical Genetics and Genomics Original Research Article Open Population-based estimates of the prevalence of FMR1 expansion mutations in women with early menopause and primary ovarian

More information

Fragile X syndrome prenatal diagnosis: parental attitudes and reproductive responses

Fragile X syndrome prenatal diagnosis: parental attitudes and reproductive responses Reproductive BioMedicine Online (2010) 21, 560 565 www.sciencedirect.com www.rbmonline.com ARTICLE Fragile X syndrome prenatal diagnosis: parental attitudes and reproductive responses M Xunclà a,b, C Badenas

More information

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon

More information

Genetic diagnosis in clinical psychiatry: A case report of a woman with a 47,XXX karyotype and Fragile X syndrome

Genetic diagnosis in clinical psychiatry: A case report of a woman with a 47,XXX karyotype and Fragile X syndrome Eur. J. Psychiat. Vol. 23, N. 1, (31-36) 2009 Keywords: Fragile X; 47,XXX; obesity; hyperphagia; affective disorder. Genetic diagnosis in clinical psychiatry: A case report of a woman with a 47,XXX karyotype

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual Effective Date: April 15, 2018 Related Policies: 2.04.59 Genetic Testing for Developmental Delay/Intellectual Disability, Autism Spectrum Disorder, and Congenital Anomalies Genetic

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

TEST INFORMATION Test: CarrierMap GEN (Genotyping) Panel: CarrierMap Expanded Diseases Tested: 311 Genes Tested: 299 Mutations Tested: 2647

TEST INFORMATION Test: CarrierMap GEN (Genotyping) Panel: CarrierMap Expanded Diseases Tested: 311 Genes Tested: 299 Mutations Tested: 2647 Ordering Practice Jane Smith John Smith Practice Code: 675 Miller MD 374 Broadway New York, NY 10000 Physician: Dr. Frank Miller Report Generated: 2016-02-03 DOB: 1973-02-19 Gender: Female Ethnicity: European

More information

Screening for fragile X syndrome among Brazilian mentally retarded male patients using PCR from buccal cell DNA

Screening for fragile X syndrome among Brazilian mentally retarded male patients using PCR from buccal cell DNA D.M. Christofolini et al. 448 Screening for fragile X syndrome among Brazilian mentally retarded male patients using PCR from buccal cell DNA D.M. Christofolini, M.V.N. Lipay, M.A.P. Ramos, D. Brunoni

More information

Reproductive carrier screening

Reproductive carrier screening Reproductive carrier screening Information for Doctors Available for three of the most common disorders Cystic fibrosis Spinal muscular atrophy Fragile X syndrome RANZCOG recommends that information about

More information

IMMEDIATE HOT LINE: Effective January 6, 2014

IMMEDIATE HOT LINE: Effective January 6, 2014 MEDICARE COVERAGE OF LABORATORY TESTING Please remember when ordering laboratory tests that are billed to Medicare/Medicaid or other federally funded programs, the following requirements apply: 1. Only

More information

Fragile X full mutation expansions are inhibited by one or more AGG interruptions in premutation carriers

Fragile X full mutation expansions are inhibited by one or more AGG interruptions in premutation carriers American College of Medical Genetics and Genomics Original Research Article Open Fragile X full mutation expansions are inhibited by one or more AGG interruptions in premutation carriers Sarah L. Nolin,

More information

Preconception carrier screening. Information for Doctors

Preconception carrier screening. Information for Doctors Preconception carrier screening Information for Doctors Preconception carrier screening can identify individuals or couples at high risk of having a child with a serious heritable disorder. This test is

More information

Partially Methylated Alleles, Microdeletion and Tissue Mosaicism in a Fragile X Male with

Partially Methylated Alleles, Microdeletion and Tissue Mosaicism in a Fragile X Male with Page: 1 Partially Methylated Alleles, Microdeletion and Tissue Mosaicism in a Fragile X Male with Tremor and Ataxia at 30 Years of Age: A Case Report Yun Tae Hwang 1,2, Solange Aliaga 3,4,5, Marta Arpone

More information

+ Fragile X Tremor Ataxia Syndrome (FXTAS)

+ Fragile X Tremor Ataxia Syndrome (FXTAS) + Fragile X Tremor Ataxia Syndrome (FXTAS) Le point de vue du neurologue n Gaëtan Garraux n CHU de Liège n www.movere.org + Background FXTAS was first described by Hagerman and coll. (2001) as they collected

More information

Fragile X syndrome (FXS, OMIM ) is the most common

Fragile X syndrome (FXS, OMIM ) is the most common ARTICLE Qualitative assessment of FMR1 (CGG)n triplet repeat status in normal, intermediate, premutation, full mutation, and mosaic carriers in both sexes: Implications for fragile X syndrome carrier and

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK SW Thames Regional Genetics Laboratory, Jenner Wing, SGUL Cranmer Terrace London SW17 0RE Contact: Mr John Short Tel: +44 (0) 208 725 5332 Fax: +44 (0) 208 725 3440 E-Mail: swtrgl@stgeorges.nhs.uk Website:

More information

Title: Development and validation of a multiplex-pcr assay for X-linked intellectual disability

Title: Development and validation of a multiplex-pcr assay for X-linked intellectual disability Author's response to reviews Title: Development and validation of a multiplex-pcr assay for X-linked intellectual disability Authors: PAULA JORGE (paula.jorge@insa.min-saude.pt) Bárbara Oliveira (barbara.oliveira@insa.min-saude.pt)

More information

EXPLORING GENETIC COUNSELORS PERCEPTIONS AND UTILIZATION OF AGG ANALYSIS TO REFINE FMR1 GENE EXPANSION RISK. Lauren Haley Brown

EXPLORING GENETIC COUNSELORS PERCEPTIONS AND UTILIZATION OF AGG ANALYSIS TO REFINE FMR1 GENE EXPANSION RISK. Lauren Haley Brown EXPLORING GENETIC COUNSELORS PERCEPTIONS AND UTILIZATION OF AGG ANALYSIS TO REFINE FMR1 GENE EXPANSION RISK by Lauren Haley Brown B.A. Biology, Seattle Pacific University, 2011 Submitted to the Graduate

More information

CHAPTER 1 INTRODUCTION

CHAPTER 1 INTRODUCTION 1 CHAPTER 1 INTRODUCTION 1.1. BACKGROUND Fragile X mental retardation 1 gene (FMR1) is located on the X chromosome and is responsible for producing the fragile X mental retardation protein (FMRP) which

More information

Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis

Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou

More information

Experts call for universal fragile X screening

Experts call for universal fragile X screening NEWS Experts call for universal fragile X screening BY ANDREA ANDERSON 1 APRIL 2008 1 / 5 Clean sweep: Universal screening would detect even asymptomatic carriers of fragile X. Screening for genetic precursors

More information

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.

More information

Journal of Medical Genetics Copyright (C) 1997 by Journal of Medical Genetics.

Journal of Medical Genetics Copyright (C) 1997 by Journal of Medical Genetics. Journal of Medical Genetics Copyright (C) 1997 by Journal of Medical Genetics. Volume 34(11) November 1997 pp 924-926 Prenatal diagnosis of the fragile X syndrome: loss of mutation owing to a double recombinant

More information

Diagnostics guidance Published: 14 August 2013 nice.org.uk/guidance/dg9

Diagnostics guidance Published: 14 August 2013 nice.org.uk/guidance/dg9 EGFR-TK mutation testing in adults with locally advanced or metastatic non-small- cell lung cancer Diagnostics guidance Published: 14 August 2013 nice.org.uk/guidance/dg9 NICE 2018. All rights reserved.

More information

EVOLVE FERTILITY GENETIC SCREENS

EVOLVE FERTILITY GENETIC SCREENS LEADERS IN GENETIC FERTILITY SCREENING TM FOR MEN & WOMEN EVOLVE FERTILITY GENETIC SCREENS The most advanced and comprehensive fertility genetic screens on the market today. SCREEN TODAY. PROTECT TOMORROW.

More information

FRAGILE X-ASSOCIATED TREMOR/ATAXIA SYNDROME (FXTAS)

FRAGILE X-ASSOCIATED TREMOR/ATAXIA SYNDROME (FXTAS) FRAGILE X CLINICAL & RESEARCH CONSORTIUM Consensus of the FXTAS Task Force and the Fragile X Clinical & Research Consortium FRAGILE X-ASSOCIATED TREMOR/ATAXIA SYNDROME (FXTAS) First Published: June 2011

More information

Articles Polar body-based preimplantation diagnosis for X-linked disorders

Articles Polar body-based preimplantation diagnosis for X-linked disorders RBMOnline - Vol 4. No 1. 38 42 Reproductive BioMedicine Online; www.rbmonline.com/article/384 on web 20 November 2001 Articles Polar body-based preimplantation diagnosis for X-linked disorders Dr Yury

More information

7.1 Molecular Characterization of Fragile X Syndrome

7.1 Molecular Characterization of Fragile X Syndrome 7 GENETIC DISORDERS Advances in knowledge of molecular genetics, cytogenetics and biochemical genetics have led to availability of diagnostic tests for various genetic disorders. The most important application

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

EVOLVE GENETIC FERTILITY SCREENS

EVOLVE GENETIC FERTILITY SCREENS LEADERS IN GENETIC FERTILITY SCREENING TM FOR MEN & WOMEN EVOLVE GENETIC FERTILITY SCREENS The most advanced and comprehensive pre-ivf fertility screens on the market today. SCREEN TODAY. PROTECT TOMORROW.

More information

Behavior From the Inside Out. Marcia L Braden, PhD PC Licensed Psychologist Special Educator

Behavior From the Inside Out. Marcia L Braden, PhD PC Licensed Psychologist Special Educator Behavior From the Inside Out Marcia L Braden, PhD PC Licensed Psychologist Special Educator www.marciabraden.com Behavioral Profile Sensory Integration Disorder Anxiety Disorders, panic attacks Attention

More information

LIST OF INVESTIGATIONS

LIST OF INVESTIGATIONS Karyotyping: K001 K002 LIST OF INVESTIGATIONS SAMPLE CONTAINER TYPE cells For Karyotyping [Single] cells For Karyotyping [Couple] Vacutainer Vacutainer 7-8 7-8 K003 Fetal Blood Sample For Karyotyping Vacutainer

More information

approach Population studies of the fragile X: a molecular ORIGINAL ARTICLES

approach Population studies of the fragile X: a molecular ORIGINAL ARTICLES 454 Med Genet 1993; 30: 454-459 ORIGINAL ARTICLES Wessex Regional Genetics Laboratory, Salisbury District Hospital, Odstock, Salisbury SP2 8BJ, UK. P A Jacobs H Bullman J Macpherson S Youings Community

More information

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing! attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95

More information

Fragile X screening for FRAXA and FRAXE mutations using PCR based studies: Results of a five year study

Fragile X screening for FRAXA and FRAXE mutations using PCR based studies: Results of a five year study 17 Original Communication Fragile X screening for FRAXA and FRAXE mutations using PCR based studies: Results of a five year study Madhumita Roy Chowdhury, Madhulika Kabra, Deepti Sharma*, Deepika Singh*,

More information

QIAsymphony DSP Circulating DNA Kit

QIAsymphony DSP Circulating DNA Kit QIAsymphony DSP Circulating DNA Kit February 2017 Performance Characteristics 937556 Sample to Insight Contents Performance Characteristics... 4 Basic performance... 4 Run precision... 6 Equivalent performance

More information

Unifactorial or Single Gene Disorders. Hanan Hamamy Department of Genetic Medicine and Development Geneva University Hospital

Unifactorial or Single Gene Disorders. Hanan Hamamy Department of Genetic Medicine and Development Geneva University Hospital Unifactorial or Single Gene Disorders Hanan Hamamy Department of Genetic Medicine and Development Geneva University Hospital Training Course in Sexual and Reproductive Health Research Geneva 2011 Single

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

Identification of Males with Cryptic Fragile X Alleles by Methylation-Specific Quantitative Melt Analysis

Identification of Males with Cryptic Fragile X Alleles by Methylation-Specific Quantitative Melt Analysis Clinical Chemistry 62:2 343 352 (2016) Molecular Diagnostics and Genetics Identification of Males with Cryptic Fragile X Alleles by Methylation-Specific Quantitative Melt Analysis Solange M. Aliaga, 1,2,3

More information

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for

More information

MMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco

MMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco MMB (MGPG) 2017 Non traditional Inheritance Epigenetics A.Turco NON TRADITIONAL INHERITANCE EXCEPTIONS TO MENDELISM - Genetic linkage (2 loci close to each other) - Complex or Multifactorial Disease (MFD)

More information

Impaired Visuospatial Processing in Young Adult Female Fragile X Premutation Carriers and Emerging Trends in Children

Impaired Visuospatial Processing in Young Adult Female Fragile X Premutation Carriers and Emerging Trends in Children Impaired Visuospatial Processing in Young Adult Female Fragile X Premutation Carriers and Emerging Trends in Children Yingratana Bella McLennan, Ling Wong, Naomi Goodrich-Hunsaker, Danielle Harvey, Flora

More information

The Role of Molecular Diagnostics in Genetics Testing and Pharmacogenetics Gregory J. Tsongalis, Ph.D.

The Role of Molecular Diagnostics in Genetics Testing and Pharmacogenetics Gregory J. Tsongalis, Ph.D. The Role of Molecular Diagnostics in Genetics Testing and Pharmacogenetics Gregory J. Tsongalis, Ph.D. Professor of Pathology Director, Molecular Pathology Dartmouth Medical School Dartmouth Hitchcock

More information

Current genotyping in the Czech Republic

Current genotyping in the Czech Republic The European Perspective: Current genotyping in the Czech Republic MUDr. Martin Písačka Reference laboratory for immunohematology ÚHKT Prag 37.Jahreskongress DGTI, 24.September 2004, Mannheim Pre-genotyping

More information

HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings

HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings Elizabeth M. Dax with the staff of the National Serology Reference Laboratory, Australia My Background Worked in HIV

More information

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us. Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

AGG interruptions within the maternal FMR1 gene reduce the risk of offspring with fragile X syndrome

AGG interruptions within the maternal FMR1 gene reduce the risk of offspring with fragile X syndrome American College of Medical Genetics and Genomics original research article interruptions within the maternal FMR1 gene reduce the risk of offspring with fragile X syndrome Carolyn M. Yrigollen BSc 1,

More information

Reliable and Sensitive Detection of Fragile X (Expanded) Alleles in Clinical Prenatal DNA Samples with a Fast Turnaround Time

Reliable and Sensitive Detection of Fragile X (Expanded) Alleles in Clinical Prenatal DNA Samples with a Fast Turnaround Time ASIP 2012 JMD CME Program The Journal of Molecular Diagnostics, Vol. 14, No. 6, November 2012 Copyright 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published

More information

Population carrier screening for fragile X syndrome Attitudes and experiences of women undergoing screening

Population carrier screening for fragile X syndrome Attitudes and experiences of women undergoing screening Population carrier screening for fragile X syndrome Attitudes and experiences of women undergoing screening Dr Jonathan Cohen, Dr Alison Archibald, Dr Melissa Martyn, Chriselle Hickerton, Megan Cotter,

More information

alleles in high-functioning FM and PM males determined by both reference methods were also unmethylated

alleles in high-functioning FM and PM males determined by both reference methods were also unmethylated Clinical Chemistry 60:7 963 973 (2014) Molecular Diagnostics and Genetics Early Detection of Fragile X Syndrome: Applications of a Novel Approach for Improved Quantitative Methylation Analysis in Venous

More information

THE IMPACT OF FRAGILE X NEWBORN SCREENING RESULTS ON REPRODUCTIVE CHOICES AND SURVEILLANCE FOR FMR1- ASSOCIATED DISORDERS

THE IMPACT OF FRAGILE X NEWBORN SCREENING RESULTS ON REPRODUCTIVE CHOICES AND SURVEILLANCE FOR FMR1- ASSOCIATED DISORDERS THE IMPACT OF FRAGILE X NEWBORN SCREENING RESULTS ON REPRODUCTIVE CHOICES AND SURVEILLANCE FOR FMR1- ASSOCIATED DISORDERS A Project Presented to the Faculty of California State University, Stanislaus In

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Standardization: Calibration of. International Standards, reference preparations and working standards. Micha Nübling, PEI

Standardization: Calibration of. International Standards, reference preparations and working standards. Micha Nübling, PEI Standardization: Calibration of International Standards, reference preparations and working standards Micha Nübling, PEI Paul-Ehrlich-Institut Governmental Authority for biological medicinal products Blood

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

More information

Associated features in females with an FMR1 premutation

Associated features in females with an FMR1 premutation Wheeler et al. Journal of Neurodevelopmental Disorders 2014, 6:30 REVIEW Associated features in females with an FMR1 premutation Open Access Anne C Wheeler 1,9*, Donald B Bailey Jr 1, Elizabeth Berry-Kravis

More information

Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK

Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK Sesh Kamal Sunkara Aberdeen Fertility Centre Aberdeen Maternity Hospital University of Aberdeen Aberdeen, UK Declared no potential conflict of interest Genetic aetiology of poor and hyper responders Sesh

More information

Feasibility and acceptance of screening for fragile X mutations in low-risk pregnancies

Feasibility and acceptance of screening for fragile X mutations in low-risk pregnancies European Journal of Human Genetics (1999) 7, 212 216 t 1999 Stockton Press All rights reserved 1018 4813/99 $12.00 http://www.stockton-press.co.uk/ejhg ARTICLE Feasibility and acceptance of screening for

More information

Fragile X-associated disorders: Don t miss them

Fragile X-associated disorders: Don t miss them CLINICAL Fragile X-associated disorders: Don t miss them Rachael C Birch, Jonathan Cohen, Julian N Trollor Background Fragile X-associated disorders are a family of inherited disorders caused by expansions

More information

VQA HIV DNA Control SOP Version 5.0 HIV DNA Testing 13 March 2012

VQA HIV DNA Control SOP Version 5.0 HIV DNA Testing 13 March 2012 1. PRINCIPLE 1.1. The Virology Quality Assurance (VQA) Laboratory provides external cell pellet controls for use in the validation of assays that detect HIV proviral DNA. 1.2. HIV seronegative peripheral

More information

FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States

FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States RESEARCH Open Access FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States Flora Tassone 1,2*, Ka Pou Iong 1, Tzu-Han Tong 1, Joyce Lo 1, Louise W Gane 2, Elizabeth

More information

The Japanese collaborated study of Fragile X syndrome and its related disorders

The Japanese collaborated study of Fragile X syndrome and its related disorders The Japanese collaborated study of Fragile X syndrome and its related disorders Yuji Nakayama, PhD Research Center for Bioscience and Technology, Tottori University, Japan TOTTORI Tsukuba Kyoto TOKYO Okayama

More information

Enabling Personalized

Enabling Personalized Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development

More information

MRC-Holland MLPA. Description version 08; 30 March 2015

MRC-Holland MLPA. Description version 08; 30 March 2015 SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.

More information

Rare pitfalls associated with the routine use of real time PCR

Rare pitfalls associated with the routine use of real time PCR Rare pitfalls associated with the routine use of real time PCR Dr RN Gunson On Behalf of the West of Scotland Specialist Virology Centre R+D team Gartnavel General Hospital Glasgow Scotland Talk outline:

More information

VQA Control SOP Version 4.0 Roche Amplicor HIV-1 DNA Test, v August 2007

VQA Control SOP Version 4.0 Roche Amplicor HIV-1 DNA Test, v August 2007 1. PRINCIPLE 1.1. The Virology Quality Assurance (VQA) Laboratory provides external cell pellet controls for use in the validation of assays that detect HIV proviral DNA. 1.2. HIV seronegative peripheral

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for

More information

Available for Montrose Therapy Services

Available for Montrose Therapy Services Funding O ptions Available for Montrose Therapy Services Funding Options There are number of ways to access Montrose services including the National Disability Insurance Scheme (NDIS) and private health

More information

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.

More information

Genetic examination of diseases affecting bone development. and structure in newborns

Genetic examination of diseases affecting bone development. and structure in newborns Genetic examination of diseases affecting bone development and structure in newborns Examination of molecular genetic markers in osteopenic preterm infants PhD Thesis Simone Funke, MD University of Pécs

More information

Testing Criteria for Fragile X Syndrome: Report of the outcome from the UKGTN Fragile X Workshop

Testing Criteria for Fragile X Syndrome: Report of the outcome from the UKGTN Fragile X Workshop Testing Criteria for Fragile X Syndrome: Report of the outcome from the UKGTN Fragile X Workshop December 2 nd, 2008 at Chandos House, 2 Queen Anne Street, London W1G 9LQ Summary The UKGTN organised an

More information

Human Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment

Human Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in

More information

Prevalence of Fragile X syndrome among children receiving special education and carrier states in first degree relatives

Prevalence of Fragile X syndrome among children receiving special education and carrier states in first degree relatives Prevalence of Fragile X syndrome among children receiving special education and carrier states in first degree relatives B Chandrasekara 1, S Wijesundera 1, S S Chong 2,3,4, H N Perera 5 (Index words:

More information

Molecular diagnosis of infectious disease - Method validation and environmental setting 傳染病的分子診斷 - 方法確認與環境背景. WC Yam 任永昌

Molecular diagnosis of infectious disease - Method validation and environmental setting 傳染病的分子診斷 - 方法確認與環境背景. WC Yam 任永昌 Molecular diagnosis of infectious disease - Method validation and environmental setting 傳染病的分子診斷 - 方法確認與環境背景 WC Yam 任永昌 Dept of Microbiology Queen Mary Hospital The University of Hong Kong Clinical and

More information

P renatal Diag nosis of F rag ile X S yndrom e u sing Amn iotic F luid DNA

P renatal Diag nosis of F rag ile X S yndrom e u sing Amn iotic F luid DNA 44 3 2001 Vol. 44 No. 3 March 2001 DNA X, * * =ABSTRACT= P renatal Diag nosis of F rag ile X S yndrom e u sing Amn iotic F luid DNA Gwan g J u n Kim, Su k You n g Kim, Byu n g Ch eu l Hwan g, Ch an You

More information

RealLine Mycoplasma genitalium Str-Format

RealLine Mycoplasma genitalium Str-Format Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1

More information

Kit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive

Kit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) Glucocorticoid-remediable

More information

ORIGINAL CONTRIBUTION. FMR1 Premutations Associated With Fragile X Associated Tremor/Ataxia Syndrome in Multiple System Atrophy

ORIGINAL CONTRIBUTION. FMR1 Premutations Associated With Fragile X Associated Tremor/Ataxia Syndrome in Multiple System Atrophy ORIGINAL CONTRIBUTION FMR1 Premutations Associated With Fragile X Associated Tremor/Ataxia Syndrome in Multiple System Atrophy Valérie Biancalana, PhD; Mathias Toft, MD; Isabelle Le Ber, MD; François Tison,

More information