Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
|
|
- Ada Long
- 5 years ago
- Views:
Transcription
1 SW Thames Regional Genetics Laboratory, Jenner Wing, SGUL Cranmer Terrace London SW17 0RE Contact: Mr John Short Tel: +44 (0) Fax: +44 (0) Website: Testing performed at the above address only DETAIL OF ACCREDITATION HUMAN TISSUE AND FLUIDS Amniotic fluid CVS Blood Solid tissues Other tissues / fluids Cytogenetic analysis for the purpose of clinical diagnosis Chromosome analysis for detection of aneuploidies and structural chromosome rearrangements for prenatal and postnatal diagnosis. Preparation of material for chromosome analysis by in-house methods - GEN-CYT-LAB-01 blood culture and harvest GEN-CYT-LAB-02 amniotic fluid culture and harvest GEN-CYT-LAB-03 CVS culture and harvest GEN-CYT-LAB-04 tumour culture and harvest GEN-CYT-LAB-05 tissue culture and harvest GEN-ALL-EQU-02 fridge, freezer and incubator use and maintenance GEN-CYT-LAB-06 slide preparation GEN-CYT-LAB-07 slide staining and banding GEN-CYT-EQU-05 Clearview coverslipping machine Analysis using Leica GSL120 automated capture station, Leica Cytovision workstations and analysis software using - GEN-CYT-LAB-08 Slide scanning using the GSL120 GEN-CYT-EQU-06 use of microscopes GEN-CYT-GEN-01 cytogenetic analysis, checking and reporting Assessment Manager: RB2 Page 1 of 9
2 HUMAN TISSUE AND FLUIDS Amniotic fluid CVS Blood Other tissues / fluids FFPE Cultured cells Buccal scrapes / saliva Amniotic fluid CVS Blood Other tissues / fluids FFPE Cultured cells Buccal scrapes / saliva Cytogenetic analysis for the purpose of clinical diagnosis Detection and analysis of genetic re-arrangements and/or genomic imbalance. DNA extraction using one or a combination of the techniques below (In-house procedures, commercial kits Chemagen MSN1, Maxwell 16, Nanodrop, QuBit, Biomek NX robot GEN-MOL-LAB-01 DNA extraction from blood GEN-MOL-LAB-02 Phenol Chloroform extraction GEN-MOL-LAB-03 DNA extraction from tissue, mouthwash, buccal scrapes, Oragene, FFPE GEN-MOL-LAB-23 DNA extraction using the Maxwell 16 IVD instrument GEN-MOL-LAB-04 DNA quantification GEN-MOL-EQU-03 Biomek NX robot use Fluorescent in situ hybridization (FISH) analysis of metaphase and interphase cells by GSL120 automated capture station, Cytovision workstations and Cytovision software GEN-CYT-LAB-14 FISH GEN-CYT-LAB-15 interphase FISH GEN-CYT-LAB-08 Slide scanning using the GSL120 GEN-CYT-EQU-06 use of microscopes GEN-CYT-GEN-01 cytogenetic analysis, checking and reporting Assessment Manager: RB2 Page 2 of 9
3 Amniotic fluid CVS Blood Other tissues / fluids FFPE Cultured cells Buccal scrapes / saliva Cytogenetic analysis for the purpose of clinical diagnosis Genome wide screen for copy number gain or loss of DNA by 8x60k Microarray profiling using OGT/Agilent technology and - GEN-CYT-LAB-16 array-cgh Benchwork GEN-CYT-LAB-18 prenatal array- CGH service process and workflow Analysed using InfoQuant cnfusion software GEN-CYT-LAB-17 array-cgh data handling GEN-CYT-GEN-02 array-cgh reporting procedure DNA extraction using one or a combination of the techniques below (In-house procedures, commercial kits Chemagen MSN1, Maxwell 16, Nanodrop, QuBit, Biomek NX robot - GEN-MOL-LAB-01 DNA extraction from blood GEN-MOL-LAB-02 Phenol Chloroform extraction GEN-MOL-LAB-03 DNA extraction from tissue, mouthwash, buccal scrapes, Oragene, FFPE GEN-MOL-LAB-23 DNA extraction using the Maxwell 16 IVD instrument GEN-MOL-LAB-04 DNA quantification Assessment Manager: RB2 Page 3 of 9
4 /RNA Detection of nucleotide variation (triplet repeats, microsatellites) for: Fragile X Myotonic Dystrophy types 1 and 2 (including TP-PCR and QP-PCR) Beckwith Weiderman, Wilms tumour, Silver Russell, isolated hemihypertrophy Huntington disease Identity / zygosity / maternal cell contamination (using Powerplex 16HS kit) Incontinentia Pigmentii Prader-Willi / Angelman s. UPD14 Y chromosome microdeletion PCR and electrophoretic analysis using ABI3130xl (including Assuragen AmplideX kit test for Fragile X) and Genemarker, Genemapper software - GEN-MOL-LAB-06 bisulphite modification of DNA GEN-MOL-LAB-07 Polymerase chain reaction GEN-MOL-EQU-02 ABI3130xl use GEN-MOL-DIS-02 11p15 disorders (including Silver Russell) GEN-MOL-DIS-06 - FMR1 disorders GEN-MOL-DIS-16 - Myotonic dystrophy type 1 GEN-MOL-DIS-17 - Myotonic dystrophy type 2 GEN-MOL-DIS-08 - Huntington disease GEN-MOL-DIS-09 Identity testing & DNA typing GEN-MOL-DIS-10 - Incontinentia Pigmentii GEN-MOL-DIS-19 - Prader-Willi / Angelman s GEN-MOL-DIS-21 - UPD14 GEN-MOL-DIS-23 - Y chromosome microdeletions reporting. Assessment Manager: RB2 Page 4 of 9
5 Detection of aneuploidy of chromosomes 13, 18, 21 or sex chromosomes Detection of triplet repeat expansions in genes beyond the detection limit of PCR for: Fragile X QF-PCR using ABI 3130 xl PCR System and analysis using Genemapper, Genemarker Software GEN-MOL-EQU-02 ABI3130xl use GEN-ALL-DIS-01 - Aneuploidy screening by QF-PCR GEN-MOL-LAB-22 QF-PCR analysis Southern blot analysis by agarose gel electrophoresis GEN-MOL-LAB-10 chemiluminescent Southern blot analysis GEN-MOL-DIS-06 - FMR1 associated disorders GEN-MOL-DIS-16 Myotonic dystrophy type 1 reporting. Assessment Manager: RB2 Page 5 of 9
6 Molecular analysis of DNA dosage of genes and exons for: 1p19q / MGMT glioma analysis 11p15-associated conditions including Beckwith Wiederman, Wilms tumour, Silver Russell, isolated hemihypertrophy BRCA 1 & 2 Marfan Sotos Li-Fraumeni MLPA using ABI3130xl and software (Coffalyser and GeneMarker) GEN-MOL-EQU-06 thermal cyclers GEN-MOL-EQU-02 ABI3130xl use GEN-MOL-LAB-17 MLPA GEN-MOL-LAB-18 MLPA statistical analysis (excluding 11p15, 1p19q and MGMT) GEN-MOL-LAB-19-11p15 MLPA GEN-MOL-LAB-1p19q MLPA GEN-MOL-LAB-21 - MGMT MLPA GEN-MOL-DIS-01 1p19q oligodendroglioma GEN-MOL-DIS-24 - MGMT GEN-MOL-DIS-02 11p15 disorders GEN-MOL-DIS-03 - Breast cancer GEN-MOL-DIS-13 Marfan GEN-MOL-DIS-25 Overgrowth s GEN-MOL-DIS-11 Li-Fraumeni reporting. Assessment Manager: RB2 Page 6 of 9
7 DNA and RNA profiling for detection of point mutations and small insertions and deletions of nucleotides in single genes for: Beckwith Wiederman, Wilms tumour, Silver Russell, isolated hemihypertrophy Breast cancer (BRCA1 & 2) CADASIL Costello Li-Fraumeni Lymphoedema distichiasis and associated disorders Marfan Marfanrelated disorders( Aortopathies ) Rasopathies (Noonan Spectrum disorderst) Sotos and associated overgrowth s IDH1&2 infiltrative glioma Sanger sequencing and analysis using ABI3730 and 3130xl and software (Sequence scanner, Mutation Surveyor, Alamut) GEN-MOL-LAB-07 Polymerase chain reaction GEN-MOL-LAB-12 Sanger sequencing of a PCR product GEN-MOL-LAB-14 analysis of sequencing data GEN-MOL-LAB-15 Alamut software GEN-MOL-EQU-01 ABI3730 use GEN-MOL-EQU-02 ABI3130xl use GEN-MOL-DIS-02 11p15 disorders GEN-MOL-DIS-03 - Breast cancer GEN-MOL-DIS-04 CADASIL GEN-MOL-DIS-11 Li-Fraumeni GEN-MOL-DIS-18 RASopathies (Noonan spectrum disorders) GEN-MOL-DIS-13 Marfan GEN-MOL-DIS-14 Marfan related disorders GEN-MOL-DIS-25 Overgrowth s GEN-MOL-DIS-26 hereditary primary lymphoedema GEN-MOL-DIS-27 IDH1&2 infiltrative glioma reporting Assessment Manager: RB2 Page 7 of 9
8 Detection of point mutations and small insertions and deletions of nucleotides in multiple genes for: Breast cancer (BRCA1 &2) Rasopathy panel (Noonan Spectrum Test) Overgrowth panel Lymphoedema panel Next generation sequencing based on Ion PGM, Ion Chef, OneTouch 2 and and analysis using software Sofia Genetics, IonReporter, TSS and Alamut GEN-MOL-LAB-24 Ion Torrent Ampliseq DNA Library preparation GEN-MOL-LAB-25 Ion Torrent template preparation and sequencing GEN-MOL-LAB-26 Next Generation Sequence data analysis GEN-MOL-LAB-14 analysis of sequencing data reporting. GEN-MOL-LAB-15 Alamut software Assessment Manager: RB2 Page 8 of 9
9 Cell Free DNA extracted from maternal blood Detection of trisomy 21,18 and 13 Non-invasive prenatal screening test CE Marked IONA test using - QiaSymphony SP DNA extractor, GX Touch, IonChef, IonProton, IONA computer - GEN-SAFE-LAB-02 Automated DNA extraction using the QiaSymphony GEN-SAFE-LAB-03 Sciclone automated library preparation GEN-SAFE-LAB-04- Fragment size analysis using the GX Touch GEN-SAFE-LAB-05 - Ion Chef setup GEN-SAFE-LAB-06 - Ion Proton: Cleaning, Initialization and Sequencing GEN-SAFE-LAB-07 SAFE Lab report generation and distribution procedure GEN-SAFE-LAB-08 Manual library preparation GEN-SAFE-LAB-09 Manual DNA extraction END Assessment Manager: RB2 Page 9 of 9
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK NW Thames Regional Genetics Laboratory Northwick Park Hospital Watford Road Harrow HA1 3UJ United Kingdom Contact: Caroline Sullivan Tel:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Accredited to ISO 15189:2012 Laboratory Genetics Level 2B, Laboratory Medicine Queen Elizabeth University Hospital Govan Road Glasgow G51
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK University Hospitals NHS Foundation Trust, Level 1, The Women s Centre John Radcliffe Hospital University Hospitals NHS Foundation Trust OX3
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationLIST OF INVESTIGATIONS
Karyotyping: K001 K002 LIST OF INVESTIGATIONS SAMPLE CONTAINER TYPE cells For Karyotyping [Single] cells For Karyotyping [Couple] Vacutainer Vacutainer 7-8 7-8 K003 Fetal Blood Sample For Karyotyping Vacutainer
More informationNew and Developing Technologies for Genetic Diagnostics National Genetics Reference Laboratory (Wessex) Salisbury, UK - July 2010 BACs on Beads
New and Developing Technologies for Genetic Diagnostics National Genetics Reference Laboratory (Wessex) Salisbury, UK - July 2010 BACs on Beads Susan Gross, MD Division of Reproductive Genetics Professor
More informationGenetics Quality and Accreditation workshop Manchester 17 th May 2017
Genetics Quality and Accreditation workshop Manchester 17 th May 2017 Katrina Rack Oxford CEQAS What is CEQAS Types of schemes Scheme update Highlights 2016 Key recommendations CEQAS Background External
More informationCYTOGENETICS INTRODUCTION SPECIAL INSTRUCTIONS ON SAMPLE COLLECTION AND HANDLING
INTRODUCTION The Cytogenetics Laboratory offers a comprehensive array of chromosome investigations for cancers, constitutional abnormalities, and prenatal and postnatal diagnosis. Analyses are performed
More informationACMG/CAP Cytogenetics CY
www.cap.org Cytogenetics Analytes/procedures in bold type are regulated for proficiency testing by the Centers for Medicare & Medicaid Services ACMG/CAP Cytogenetics CY Analyte CY Challenges per Shipment
More informationImplementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Building 9 Contact: Dr Catherine Sturgeon BioQuarter Tel: +44 (0)131-2426885 Little France Road Fax: +44 (0)131-242-6882 E-Mail: c.sturgeon@ed.ac.uk Websites: http://edqas.org EH16 4UX Proficiency Testing
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationUnderstanding the Human Karyotype Colleen Jackson Cook, Ph.D.
Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. SUPPLEMENTAL READING Nussbaum, RL, McInnes, RR, and Willard HF (2007) Thompson and Thompson Genetics in Medicine, 7th edition. Saunders: Philadelphia.
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationEmbryoCellect TM. Pre-implantation Genetic Screening Kit TECHNICAL INFORMATION
EmbryoCellect TM Pre-implantation Genetic Screening Kit TECHNICAL INFORMATION Aneuploidy Whole chromosome aneuploidy has been shown to affect all chromosomes in IVF embryos. Aneuploidy is a significant
More informationComprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS
Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for
More informationUNIVERSITY OF PENNSYLVANIA GENETIC DIAGNOSTIC LABORATORY. Name of Test Turnaround Time Cost CPT codes
Beckwith-Wiedemann: methylation and copy number 3-4 weeks $800 81401x2, 81402, 81403 Beckwith-Wiedemann: CDKN1C sequencing 3 weeks $600 81404 Beckwith-Wiedemann: prenatal diagnosis for methylation and
More informationDevelopments in Laboratory Genetics
Developments in Laboratory Genetics Rachel Butler rachel.butler@wales.nhs.uk The Impact of Genomics on Public Health Where are we now? Single gene disorders Core disorders Newborn screening (CF, MCAD)
More informationWhat s the Human Genome Project Got to Do with Developmental Disabilities?
What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the
More informationCanadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010
Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationCYTOGENETICS Dr. Mary Ann Perle
CYTOGENETICS Dr. Mary Ann Perle I) Mitosis and metaphase chromosomes A) Chromosomes are most fully condensed and clearly distinguishable during mitosis. B) Mitosis (M phase) takes 1 to 2 hrs and is divided
More informationPrenatal Diagnosis: Are There Microarrays in Your Future?
Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationOriginal Policy Date
MP 2.04.76 Genetic Counseling Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Created Local Policy/ 12:2013 Return to Medical Policy Index Disclaimer
More informationOrganisational challenges faced by Bristol Genetics in the past 18 months
Organisational challenges faced by Bristol Genetics in the past 18 months Stuart Cook Introduction 1. The move towards 7-day working 2. Transitioning to a new lab facility 3. Improving process efficiency
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationDate of Birth Gender Ethnicity/Family History Male Female Unknown. (Institutional Billing only. We DO NOT bill patients directly.)
PATIENT INFORMATION Last Name First M.I. CLINICAL LABORATORY Date of Birth Gender Ethnicity/Family History Male Female Unknown Molecular Diagnotics Patient or Sample ID# Institutional Account # (415) 514-8488
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationTEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days
TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationPrices listed correspond to institutional rates only; please contact the lab for insurance rates.
Prices listed correspond to institutional rates only; please contact the lab for insurance rates. Genetic Test TAT ** Neurofibromatosis Type 1 - NF1 and Legius syndrome SPRED1 $1400 (NF1/SPRED1 negative)
More informationscfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003
scfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003 FISH: A Molecular Cytogenetic Test Complementary nucleic acid
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationCorporate Medical Policy
Corporate Medical Policy Invasive Prenatal (Fetal) Diagnostic Testing File Name: Origination: Last CAP Review: Next CAP Review: Last Review: invasive_prenatal_(fetal)_diagnostic_testing 12/2014 3/2018
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationWorkflow. Connecting the Pieces For Total Patient Care
Workflow Connecting the Pieces For Total Patient Care Biocare provides a full line of IHC and molecular pathology products for cancer and infectious disease diagnosis. From a full range of equipment: including
More informationTPMI Presents: Translational Genomics Research Update, Opportunities and Challenges
TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges April 12, 2016 Darren D. O Rielly, Ph.D., FCCMG Director, Molecular Genetics Laboratory, Eastern Health Director, Translational
More informationComprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS
Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for
More informationOncology Genetics: Cytogenetics and FISH 17/09/2014
Oncology Genetics: Cytogenetics and FISH 17/09/2014 Chris Wragg Head of Oncology Genomics, BGL BGL Bristol Genetics Laboratory (BGL) CPA accredited Genetics laboratory serving a core population of 4-5million
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationApproach to the Genetic Diagnosis of Neurological Disorders
Approach to the Genetic Diagnosis of Neurological Disorders Dr Wendy Jones MBBS MRCP Great Ormond Street Hospital for Children National Hospital for Neurology and Neurosurgery What is a genetic diagnosis?
More informationNon-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing
Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationMOC MGP General Molecular Genetics I (Mandatory 75-Question Module) assay validation; sensitivity; oligodendroglioma, FISH CAP lab accreditation;
MOC MGP General Molecular Genetics I (Mandatory 75-Question Module) assay validation; sensitivity; oligodendroglioma, FISH CAP lab accreditation; phase II deficiency oligodendroglioma; chemotherapy response
More informationChromosome microarray analysis in routine prenatal diagnosis practice: a prospective study on 3000 consecutive clinical cases
Chromosome microarray analysis in routine prenatal diagnosis practice: a prospective study on 3000 consecutive clinical cases Fiorentino F, Napoletano S, Caiazzo F, Sessa M, Bono S, Spizzichino L, Gordon
More informationNEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM. Crosswalk of Proposed Revisions to Cytogenetics Standards
2014 Standard 2014 Guidance 2016 Standard 2016 Guidance Cytogenetics Standard 1 (CG S1) The laboratory shall request clinical information necessary for proper initiation of test procedures and interpretation
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationAn Overview of Cytogenetics. Bridget Herschap, M.D. 9/23/2013
An Overview of Cytogenetics Bridget Herschap, M.D. 9/23/2013 Objectives } History and Introduction of Cytogenetics } Overview of Current Techniques } Common cytogenetic tests and their clinical application
More informationComprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS
Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions NF1 only NGS testing and copy number analysis for the NF1 gene (NF1
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationClinical Validation of Cytocell Pathology Probes
Clinical Validation of Cytocell Pathology Probes Shivanand Richardson Specialized Technician Molecular Pathology Department of Pathology, University Medical Center Utrecht The Netherlands 5th annual Cytocell
More informationMRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationCLL Complete SM Report
Reported: 02/01/2012 Σ CGI ID No:5 Client:r Client Address: CLINICAL DATA: Lymphoma No CBC results provided. CLL Complete SM Report FINAL DIAGNOSIS: CD19+ B cell lymphoma, ZAP-70 + (44%), with borderline
More informationAMERICAN BOARD OF MEDICAL GENETICS AND GENOMICS
AMERICAN BOARD OF MEDICAL GENETICS AND GENOMICS Logbook Guidelines for Certification in Clinical Genetics and Genomics for the 2017 Examination as of 10/5/2015 Purpose: The purpose of the logbook is to
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationSALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509
mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationUNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationReporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia
More informationKaryology. Preparation and study of karyotypes is part of Cytogenetics.
Chromosomal Karyotyping Karyology Karyotyping - process of pairing and ordering all chromosomes of an organism, thus providing a genome-wide snapshot of an individual's chromosomes. Karyotypes describe
More informationBest practice DNA prep for SMRT. Olga Vinnere Pettersson, PhD Project coordinator NGI-Sweden / SciLifeLab (UU)
Best practice DNA prep for SMRT Olga Vinnere Pettersson, PhD Project coordinator NGI-Sweden / SciLifeLab (UU) National Genomics Infrastructure - Sweden NGI Stockholm NGI Uppsala NGI staff: 60-70 FTE, including
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationCentral Pathology Review and Tissue MicroArrays. Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham
Central Pathology Review and Tissue MicroArrays Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham What is a tissue microarray? Tissue microarrays (TMAs) consist of paraffin blocks in which
More informationMLPA SAMPLES USER GUIDE
MLPA SAMPLES USER GUIDE MLPA microdeletion studies Requirements: 1-2 mls (minimum) of peripheral blood in a lithium heparin tube (green or orange top) AND 1-2 mls of peripheral blood in a EDTA tube (purple
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationSame Day, Cost-Effective Aneuploidy Detection with Agilent Oligonucleotide array CGH and MDA Single Cell Amplification Method
Same Day, Cost-Effective Aneuploidy Detection with Agilent Oligonucleotide array CGH and MDA Single Cell Amplification Method Presenter: Dr. Ali Hellani, Founder, Viafet Genomic Center, Dubai Wednesday,
More informationSNP Microarray. Prenatal
SNP Microarray Prenatal SNP Microarray Reveal SNP Microarray is a test that analyzes chromosomes for changes that can explain certain kinds of birth defects. This brochure is designed to answer some of
More informationGenetic Testing Methods
THE JACKSON LABORATORY Genetic Testing Methods CLINICAL AND CONTINUING EDUCATION About this resource THE GOAL The goal of this resource is to improve the primary care provider s knowledge about commonly
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationPCR testing for FMR1-related disorders at the Children s Hospital at Westmead: past and present. Dr Karen Wong
PCR testing for FMR1-related disorders at the Children s Hospital at Westmead: past and present Dr Karen Wong FMR1-related disorders Fragile X syndrome Fragile X-associated tremor/ataxia (FXTAS) Fragile
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationSupplementary Online Content
Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More informationSection: Medicine Effective Date: January15, 2016 Subsection: Pathology/Laboratory Original Policy Date: December 7, 2011 Subject:
Section: Medicine Effective Date: January15, 2016 Last Review Status/Date: December 2015 Page: 1 of 22 Microarray Analysis and Next-Generation Autism Spectrum Disorder and/or Congenital Description Chromosomal
More informationGenetic Testing for Single-Gene and Multifactorial Conditions
Clinical Appropriateness Guidelines Genetic Testing for Single-Gene and Multifactorial Conditions EFFECTIVE DECEMBER 1, 2017 Appropriate.Safe.Affordable 2017 AIM Specialty Health 2069-1217 Table of Contents
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationApplication. Application of molecular biology methods in hematology and oncology. Oncogenes are involved in:
Application Application of molecular biology methods in hematology and oncology Research on the etiology of cancer Diagnostics / Differential diagnostics Stratifying for treatment Prognosing the outcome
More informationAssociation for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology
Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology 9650 Rockville Pike, Bethesda, Maryland 20814 Tel: 301-634-7939 Fax: 301-634-7990 Email:
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationSALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B
SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B1-0613. The purpose of the P372 probemix is to further investigate results found with the P245 Microdeletion Syndromes-1A probemix. The
More informationAn Update on PGD: Where we are today
An Update on PGD: Where we are today Joyce Harper UCL Centre for PG&D and CRGH Institute for Womens Health University College London Overview What is PGD/PGS How we do it Disadvantages and advantages Future
More information