Increased expression of long noncoding RNA LINC00961 suppresses glioma metastasis and correlates with favorable prognosis
|
|
- Percival Alexander
- 5 years ago
- Views:
Transcription
1 European Review for Medical and Pharmacological Sciences 2018; 22: Increased expression of long noncoding RNA LINC00961 suppresses glioma metastasis and correlates with favorable prognosis X.-W. LU, N. XU, Y.-G. ZHENG, Q.-X. LI, J.-S. SHI Department of Neurosurgery, The First Affiliated Hospital of Medical College, Shantou University, Shantou, Guangdong, China Xiao-wen Lu and Nuo Xu contributed equally to this work Abstract. OBJECTIVE: Long non-coding RNA LINC00961 (LINC00961) has been reported to play an important role in tumor development and metastasis of lung cancer. However, the expression and role of LINC00961 in glioma remains unclear. The present study aimed to investigate the expression of LINC00961 in patients with glioma and to investigate its effect on glioma cells. PATIENTS AND METHODS: Quantitative Real-Time PCR (qrt-pcr) was performed to detect the expression of LINC00961 in glioma tissues and cell lines. Then, the association between LINC00961 expression and clinical pathological parameters and prognosis of glioma patients were further evaluated. Gain of function studies were performed to determine the effects of LINC00961 on proliferation and metastasis of glioma cells. Western blotting assay was used to explore the regulation mechanism. RESULTS: We found that LINC00961 was significantly downregulated in glioma tissues and cell lines compared with that of adjacent normal brain tissues and normal human astrocytes. Low expression of LINC00961 was significantly correlated with WHO grade and KPS score. Clinical analysis indicated that patients with low LINC00961 expression had a shorter overall survival than those with high expression. Univariate and multivariable Cox regression analyses further identified that down-regulated LINC00961 might act as an independent prognostic factor for glioma patients. Functionally, overexpression of LINC00961 significantly suppressed glioma cells proliferation, migration, and invasion. Mechanistically, we found that overexpression of LINC00961 inhibited glioma cell EMT. CONCLUSIONS: LINC00961 might be considered as a novel molecule involved in glioma development, which provides an independent prognostic indicator and a potential therapeutic target for glioma patients. Key Words Long noncoding RNA, LINC00961, Prognosis, EMT, Metastasis, Glioma. Introduction Gliomas, are the most common primary brain tumors in adults, accounting for more than 50% of all primary brain tumors 1. The glioma family includes well-differentiated low-grade astrocytomas [World Health Organization (WHO) grade I-II], anaplastic astrocytomas (WHO grade III), and glioblastoma multiforme (GBM, WHO grade IV) 2. Despite the continuous improvement in treatment approaches, with a combination of surgery, radiotherapy, and chemotherapy, the median survival time of a patient with a glioblastoma multiform is only months 3,4. The obstacle for clinical therapy of glioma patients is due to both infiltrative metastasis and the resistance toward chemoradiotherapy 5,6. A better understanding of the molecular mechanisms on glioma carcinogenesis and progression are urgently needed for the early detection, prognosis prediction, and therapy evaluation for glioma. Long noncoding RNAs (lncrnas) are a class of noncoding RNAs with over 200 nucleotides in length that do not encode proteins 7. LncRNAs may participate in various biological processes including differentiation, angiogenesis, immune responses, and apoptosis 8,9. Also, growing reports 10,11 have shown that the deregulated expression of lncrnas plays a functional role in a variety of disease states including malignancy. For instance, lncrna DANCR, a well-studied lncrna, has been reported to be up-regulated in osteosarcoma and promote tumor progression by upregulating AXL via mir-33a-5p inhibition 12. LncRNA NEAT1, a tumor-related lncrna, has been reported to be an oncogene which contributes to paclitaxel resistance of ovarian cancer cells by regulating ZEB1 expression via mir Another lncrna, lncrna HOTAIR, was found to be highly expressed in glioma and its Corresponding Author: Jia-song Shi, MD; ssjj1716@yeah.net 4917
2 X.-W. Lu, N. Xu, Y.-G. Zheng, Q.-X. Li, J.-S. Shi knockdown exerted tumor-suppressive function in glioma cells via modulation of mir Although several lncrnas have been identified to be oncogenes or tumor suppressor, many lncrnas have not been functionally characterized so far and the mechanisms underlying their biological function on the progression of glioma remain largely unclear. LINC00961, located on chromosome 9, is a newly identified lncrna. The previous study 15 identified LINC00961 as an aberrantly expressed lncrna in lung squamous cell carcinoma which has high diagnostic value in distinguishing tumors tissues from normal tissues. However, the detailed role of LINC00961 in other solid tumors remains largely unknown. The purpose of this study was to investigate the expression profile, clinical significance, and biological function of LINC00961 in glioma and thus be the first to unravel the critical role of LINC00961 in glioma. Patients and Methods Patients 151 paired glioma tissues and normal brain tissues were obtained from patients with glioma who underwent surgery at the First Affiliated Hospital of Medical College from May 2010 to August According to the WHO categories, 93 cases of grade I or grade II glioma, 58 cases of grade III or grade IV glioma. None of the patients had received chemotherapy or radiotherapy prior to surgery. The histologic diagnosis of these tissue samples was confirmed by a pathologist. Clinical data of all the patients was collected from hospitalization and subsequent records. Detailed information is listed in Table II. This study was approved by the Ethical Committee of The First Affiliated Hospital of Medical College. Every patient signed the informed consent. Cell Culture and Transfection Glioma cell lines including U251, A172, U-118, U87. and normal human astrocyte cell line HEB were purchased from Shanghai Institute for Biological Sciences (Xuhui, Shanghai, China). Cells were all cultured in Roswell Park Memorial Institute-1640 (RPMI-1640, Thermo Fisher Scientific, Waltham, MA, USA) medium supplemented with 10% fetal bovine serum (FBS, Gibco BRL, Grand Island, USA). Cultures were maintained in a 5% CO 2 humidified atmosphere at 37 C. The complementary DNA (cdna) of LINC00961 was chemically synthesized by Weifei Technology (Yuzhong, Chongqing, China) and cloned into the KpnI and BamHI sites of a pcdna expression vector (Invitrogen, Carlsbad, CA, USA), namely, pcdna-linc U87 and A172 cells were grown on 6-well plates to confluency and transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer s instructions. After transfection for 48 h, cells were collected for cell proliferation and migration assays, and lysed for quantitative PCR or Western Blot analysis. RNA Extraction and qpcr Analyses Total RNA was extracted from tissues or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer s protocol. Reverse-transcription was performed using M-MLV and cdna amplification was done using SYBR Green Master Mix kit (ThermoFisher Scientific, Waltham, MA, USA). qrt-pcr was performed on Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II (TaKaRa, Otsu, Shiga, Japan). The conditions were as follows: 95 C for 10 min; and 40 cycles (denaturation at 95 C for 15 sec, annealing/extension temperature at 60 C for 1 min). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was employed as reference genes to normalize the expression of LINC Relative gene expression was normalized to GAP- DH using the 2 -ΔΔCT method. The primers were shown in Table I. Cell Viability Assay 24 h after transfection, cells were plated into 96 well plate at a density of 3000 cells/well and cultured with 200 μl RPMI-1640 medium containing 10% FBS at 37 C and 5% CO 2. At each time point, cells were stained with 100 ml sterile 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye (0.5 mg/ml, Sigma-Aldrich, St. Table I. PCR primer sequences. Subject Primer sequence LINC CTGTTCTGGATGGGAGCGAA-3 (Forward) LINC ACAGTCACCACGAACAGCAC3 (Reverse) GAPDH 5 -GTCAACGGATTTGGTCTGTATT-3 (Forward) GAPDH 5 -AGTCTTCTGGGTGGCAGTGAT-3 (Reverse) 4918
3 LncRNA LINC00961 suppresses glioma metastasis Table II. Correlation between LINC00961 expression and clinicopathological features in glioma patients. Parameter No. of cases LINC00961 expression p-value Low High Age < Gender Male Female Extent of resection < 98 % % Tumor size < 5 cm cm WHO grade I-II III-IV KPS score < Louis, MO, USA) for 4 h at 37 C, followed by removal of the culture medium and addition of 100 ml of dimethyl sulphoxide (Sigma-Aldrich, St. Louis, MO, USA). The absorbance at 490 nm was measured using a microplate reader. Data came from three independent experiments. Migration and Invasion Assays The transwell migration and invasion assay were used to detected glioma cells invasion capability. For the migration assay, cells were re-suspended in 100 μl of serum-free medium and placed in the upper compartment of a transwell chamber. For the invasion assay, cells were plated in the top chamber with a Matrigel-coated membrane. Then, 1600 and 600 μl media were added to the lower and upper chambers. After cultured for 24 h, non-migrating and non-invading U87 and A127 cells on the interior of the inserts were removed using a cotton-tipped swab, while cells that adhered to the lower surface of the inserts were stained with crystal violet of 0.1% for 20 min. Migration and invasion were quantified by taking mean and standard deviations of 5 non-biased image fields. Western Blot Cells were lysed in RIPA buffer with protease inhibitors and phosphatase inhibitors. Total proteins were extracted using sodium dodecyl sulfate lysis buffer (Beyotime, Zhejiang, Jiangsu, China). Equal amounts of protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF, Millipore, Haidian, Beijing, China) membrane. After blocking with 10% nonfat milk in phosphate-buffered saline, membranes were immunoblotted with antibodies as indicated, followed by HRP-linked secondary antibodies (Cell Signaling Technology, Danvers, MA, USA). Enhanced chemiluminescence (ECL) detection system (Merck Millipore, Billerica, MA, USA) was used for signal detection. All antibodies were purchased from Abcam Company (Cambridge, MA, USA). β-actin was used as the endogenous control. Statistical Analysis Data was analyzed using SPSS 13.0 (statistical package for the Social Sciences Version 13.0, SPSS Inc., Chicago, IL, USA). The differences between two groups were analyzed using the two-sided Student s t-test. Association between LINC00961 and clinicopathological parameters was analyzed by the x 2 -test. Survival curves were plotted by using the Kaplan-Meier method and compared by using the log-rank test. The Cox proportional hazards regression model was em- 4919
4 X.-W. Lu, N. Xu, Y.-G. Zheng, Q.-X. Li, J.-S. Shi ployed for univariate and multivariate analyses to estimate the prognostic factors for survival prediction. A p-value of less than 0.05 was considered to be statistically significant. Results LINC00961 is Downregulated in Glioma Tissues and Cell Lines To investigate the potential role of LINC00961, we performed Real-Time PCR to detect LINC00961 levels in 151 glioma tissues and their corresponding adjacent tissues. As shown in Figure 1A, we found that LINC00961 was significantly downregulated in glioma tissues compared with that of adjacent normal brain tissues (p<0.01). Furthermore, the expression levels of LINC00961 in tumors with high grades were significantly lower than those in those with low grades (WHO I and WHO II) (p<0.01, Figure 1B). We also detected the expression levels of LINC00961 in glioma cell lines and found that LINC00961 were differentially decreased in four glioma cell lines compared with that in the normal human astrocyte cells (p<0.01, Figure 1C). Correlation Between LINC00961 Expression and Clinical Features and Prognosis of Glioma Patients For the clinicopathological correlation analysis, 151 glioma patients were divided into two groups: high LINC00961 group (n=77) and low LINC00961 group (n=74) via the median value of LINC00961 expression as a cut-off value. As shown in Table II, we observed that low expression of LINC00961 was significantly correlated with WHO grade (p=0.001) and Karnofski Per- A B C D Figure 1. Relative expression of LINC00961 in glioma tissues and its clinical significance. A, qrt-pcr was performed to detect the relative LINC00961 expression in 151 pairs of glioma and corresponding non cancerous brain tissues. B, qrt-pcr was performed to detect the relative LINC00961 expression in low-grade glioma and high-grade glioma tissues. C, LINC00961 expression was further examined in normal human astrocyte cells (HEB) and 4 human glioma cell lines. D, The overall survival rate of glioma patients with low LINC00961 was significantly shorter compared to those patients with high LINC00961 (p=0.0059). *p<0.05, **p<
5 LncRNA LINC00961 suppresses glioma metastasis A B D C E Figure 2. LINC00961 inhibits U87 and A172 cells proliferation, migration and invasion. A, U87 and A172 cells were transduced with pcdna or pcdna-linc Seventy-two hours after transduction, the expression of LINC00961 was analyzed by qrt-pcr. MTT results indicate that U87 (B) and A172 (C) cells transfected with pcdna-linc00961 possess lower viability than pcdna control. D-E, Transwell assay was performed to detect the ability of migration and invasion of pcdna-linc00961 transfected U87 and A172 cells and their negative control. *p<0.05, **p<0.01. formance Score (KPS) (p=0.004). However, no significant difference in LINC00961 expression was observed with age, gender, extent of resection or tumor size (all p>0.05). Furthermore, using the Kaplan-Meier method and log-rank test, we found that the overall survival of patients with low LINC00961 expression was significantly shorter than those with high LINC00961 expression (p=0.0059, Figure 1D). More importantly, multivariate Cox proportional hazards model showed that decreased expressions of LINC00961 was an independent prognostic marker of overall survival of patients with glioma. LINC00961 Overexpression Suppresses Cell Proliferation, Migration, and Invasion in Glioma Cells Based on the significant association between low LINC00961 expression and advanced clinical progression, we hypothesized that LINC00961 has a biological function in glioma. To explore the potential role of LINC00961 in the progression of glioma, U87 and A172 cell lines were transfected with pcdna or pcdna-linc The transfection efficiency was validated by qrt-pcr (Figure 2A). Then, MTT assays revealed that ectopic expression of LINC00961 significantly sup4921
6 X.-W. Lu, N. Xu, Y.-G. Zheng, Q.-X. Li, J.-S. Shi pressed cell proliferation in U87 and A172 cells (Figure 2B and 2C). To further determine the effect of LINC00961 overexpression on glioma cell migration and invasion, transwell assay was performed. As shown in Figure 2D, our results showed that overexpression of LINC00961 promoted cell migration in both U87 and A172 cells. Similarly, the invasion was significantly suppressed in LINC00961 overexpression cells compared with their control cells (Figure 2E). Taken together, our data indicated that LINC00961 can promote glioma cell proliferation, migration, and invasion in vitro. LINC00961 Regulates Epithelial- Mesenchymal Transition (EMT) As EMT is a biological behavior during cancer progression and metastasis, Western blot analysis was used to determine whether LINC00961 promoted glioma cells migration and invasion by modulating EMT. As shown in Figure 3, we observed that U87 and A172 cells with LINC00961 overexpression had significantly increased expression of E-cadherin and decreased expression of N-cadherin and Vimentin. These data approved that increased expression of LINC0096 suppressed glioma cell metastasis by modulating EMT. Discussion Gliomas are the most common and lethal malignant tumors in the central nervous system 16. Unfortunately, the survival rates of glioma Figure 3. Overexpression of LINC00961 suppressed epithelial-mesenchymal transition (EMT) program. Western blotting images of N-cadherin, Vimentin, and E-cadherin expression in U87 and A172 cells 48 h after transfection of pcdna-linc patients diagnosed at an advanced stage were almost not improved during the past decade 17. To increase the survival rate of patients, early diagnosis, prognosis determination, and timely medical intervention have been proposed 18. Hence, identifying novel targets that may function as biomarkers for early diagnosis and treatment of glioma is urgent. In this study, our attention focused on LINC The results of RT-PCR showed that LINC00961 expression was significantly down-regulated in glioma tissues. This result was in line with previous findings. Then, we analyzed the association between LINC00961 expression and clinicopathological characteristics and prognosis of 151 glioma patients. We observed that low expression of LINC00961 was significantly correlated with WHO grade and KPS score, indicating that low LINC00961 levels contributed to the clinical progression of glioma patients. Furthermore, Kaplan-Meier survival curves revealed that patients with high LINC00961 expression had a more favorable clinical outcome. More importantly, multivariate Cox hazard regression analysis identified low LINC00961 expression as an independent indicator of unfavorable prognosis. Our findings provided the first evidence that LINC00961 may influence the prognosis of glioma patients. Previous authors 19,20 demonstrate that lncrnas play a critical role in tumor initiation, cancer cell growth, and metastasis. In addition, several lncrnas have been identified and serve as oncogene or tumor suppressor in glioma 21. For instance, Ren et al 22 reported that high lncrna SNHG7 expression was associated with poor prognosis of glioma patients and promoted glioma cells migration and invasion by via inhibition of mir-509. Wang et al 23 found that lncrna ENST suppressed the proliferation, survival, and migration by inhibiting MDM2/MAPK pathway in glioma. Wu et al 24 indicated that lncrna HOXA-AS3 knockdown suppressed glioma cells proliferation, migration, and invasion in vitro and in vivo. In addition, Jiang et al 25 found that LINC00961 expression was down-regulated in non-small cell lung cancer and its overexpression inhibits cell invasion and metastasis in non-small cell lung cancer. However, the expression pattern and biological function of LINC00961 in other tumors remain largely unknown. In this study, because LINC00961 expression was down-regulated in both glioma tissues and cell lines, we overexpressed the levels of LINC00961 to explore its effect on glio- 4922
7 LncRNA LINC00961 suppresses glioma metastasis Table III. Univariate and multivariate analysis of prognostic parameters in glioma patients by Cox regression analysis. Univariate analysis Multivariate analysis Variable RR 95% CI p-value RR 95% CI p-value Age Gender Extent of resection Tumor size WHO grade KPS score LINC00961 expression ma behaviors. We found that overexpression of LINC00961 significantly suppressed glioma cells proliferation, migration, and invasion, suggesting that LINC00961 functioned as a tumor suppressor in the development of glioma. The EMT is an initial step toward cancer invasion and metastasis, and is also an identified phenotype of cancer invasion and metastasis in various human cancers 26. In the EMT process, epithelial cells lose their features, gain mesenchymal properties, and become motile and invasive 27. The feature of EMT occurrence is that the epithelial marker E-cadherin is downregulated and mesenchymal marker, like N-cadherin, is upregulated. Furthermore, previous studies 28,29 showed that EMT can be modulated by lncrnas. To explore the potential mechanism by which LINC00961 suppressed glioma migration and invasion, we performed Western blot to observe the effect of LINC00961 on EMT-related proteins. As expected, overexpression of LINC00961 could suppress EMT progression. Our findings imply that LINC00961 might be a good metastasis suppressor in glioma. Conclusions We first report that LINC00961 was lowly expressed in glioma tissues and cell lines, and has the potential to suppress glioma cells proliferation, migration, and invasion in vitro, possibly by inhibition of EMT. Our findings suggested that LINC00961 would be not only a novel prognostic marker but also a potential therapeutic target for glioma. Conflict of Interests The Authors declare that there are no conflicts of interest. References 1) Wen PY, Kesari S. Malignant gliomas in adults. N Engl J Med 2008; 359: ) Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, Scheithauer BW, Kleihues P. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol 2007; 114: ) McLendon RE, Halperin EC. Is the long-term survival of patients with intracranial glioblastoma multiforme overstated? Cancer 2003; 98: ) Van Meir EG, Hadjipanayis CG, Norden AD, Shu HK, Wen PY and Olson JJ. Exciting new advances in neuro-oncology: the avenue to a cure for malignant glioma. CA Cancer J Clin 2010; 60: ) Curry RC, Dahiya S, Alva Venur V, Raizer JJ, Ahluwalia MS. Bevacizumab in high-grade gliomas: past, present, and future. Expert Rev Anticancer Ther 2015; 15: ) Grant R, Kolb L, Moliterno J. Molecular and genetic pathways in gliomas: the future of personalized therapeutics. CNS Oncol 2014; 3: ) Mercer TR, Mattick JS. Structure and function of long noncoding RNAs in epigenetic regulation. Nat Struct Mol Biol 2013; 20: ) Moran VA, Perera RJ, Khalil AM. Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. Nucleic Acids Res 2012; 40: ) Wilusz JE, Sunwoo H, Spector DL. Long noncoding RNAs: functional surprises from the RNA world. Genes Dev 2009; 23: ) Batista PJ, Chang HY. Long noncoding RNAs: cellular address codes in development and disease. Cell 2013; 152: ) Park JY, Lee JE, Park JB, Yoo H, Lee S-H, Kim JH. Roles of long non-coding RNAs on tumorigenesis and glioma development. Brain Tumor Res Treat 2014; 2: ) Jiang N, Wang X, Xie X, Liao Y, Liu N, Liu J, Miao N, Shen J, Peng T. lncrna DANCR promotes tumor progression and cancer stemness features in os- 4923
8 X.-W. Lu, N. Xu, Y.-G. Zheng, Q.-X. Li, J.-S. Shi teosarcoma by upregulating AXL via mir-33a-5p inhibition. Cancer Lett 2017; 405: ) An J, Lv W, Zhang Y. LncRNA NEAT1 contributes to paclitaxel resistance of ovarian cancer cells by regulating ZEB1 expression via mir-194. Onco Targets Ther 2017; 10: ) Ke J, Yao YL, Zheng J, Wang P, Liu YH, Ma J, Li Z, Liu XB, Li ZQ, Wang ZH, Xue YX. Knockdown of long non-coding RNA HOTAIR inhibits malignant biological behaviors of human glioma cells via modulation of mir-326. Oncotarget 2015; 6: ) Chen WJ, Tang RX, He RQ, Li DY, Liang L, Zeng JH, Hu XH, Ma J, Li SK, Chen G. Clinical roles of the aberrantly expressed lncrnas in lung squamous cell carcinoma: a study based on RNA-sequencing and microarray data mining. Oncotarget 2017; 8: ) Popova SN, Bergqvist M, Dimberg A, Edqvist PH, Ekman S, Hesselager G, Ponten F, Smits A, Sooman L, Alafuzoff I. Subtyping of gliomas of various WHO grades by the application of immunohistochemistry. Histopathology 2014; 64: ) Shields LB, Choucair AK. Management of lowgrade gliomas: a review of patient-perceived quality of life and neurocognitive outcome. World Neurosurg 2014; 82: ) Babu R, Kranz PG, Karikari IO, Friedman AH, Adamson C. Clinical characteristics and treatment of malignant brainstem gliomas in elderly patients. J Clin Neurosci 2013; 20: ) Cheetham SW, Gruhl F, Mattick JS, Dinger ME. Long noncoding RNAs and the genetics of cancer. Br J Cancer 2013; 108: ) Zhang T, Wang YR, Zeng F, Cao HY, Zhou HD, Wang YJ. LncRNA H19 is overexpressed in glioma tissue, is negatively associated with patient survival, and promotes tumor growth through its derivative mir-675. Eur Rev Med Pharmacol Sci 2016; 20: ) Zhang XQ, Leung GK. Long non-coding RNAs in glioma: functional roles and clinical perspectives. Neurochem Int 2014; 77: ) Ren J, Yang Y, Xue J, Xi Z, Hu L, Pan SJ, Sun Q. Long noncoding RNA SNHG7 promotes the progression and growth of glioblastoma via inhibition of mir Biochem Biophys Res Commun 2018; 496: ) Wang A, Meng M, Zhao X, Kong L. Long non-coding RNA ENST suppresses the proliferation, survival, and migration by inhibiting MDM2/ MAPK pathway in glioma. Biochem Biophys Res Commun 2017; 485: ) Wu F, Zhang C, Cai J, Yang F, Liang T, Yan X, Wang H, Wang W, Chen J, Jiang T. Upregulation of long noncoding RNA HOXA-AS3 promotes tumor progression and predicts poor prognosis in glioma. Oncotarget 2017; 8: ) Jiang B, Liu J, Zhang YH, Shen D, Liu S, Lin F, Su J, Lin QF, Yan S, Li Y, Mao WD, Liu ZL. Long noncoding RNA LINC00961 inhibits cell invasion and metastasis in human non-small cell lung cancer. Biomed Pharmacother 2018; 97: ) Li L, Li W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther 2015; 150: ) Savagner P. Epithelial-mesenchymal transitions: from cell plasticity to concept elasticity. Curr Top Dev Biol 2015; 112: ) Li N, Gao WJ, Liu NS. LncRNA BCAR4 promotes proliferation, invasion and metastasis of nonsmall cell lung cancer cells by affecting epithelial-mesenchymal transition. Eur Rev Med Pharmacol Sci 2017; 21: ) Xu D, Liu R, Meng L, Zhang Y, Lu G, Ma P. Long non-coding RNA ENST01108 promotes carcinogenesis of glioma by acting as a molecular sponge to modulate mir-489. Biomed Pharmacother 2018; 100:
Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma
JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis
More informationExpression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.
More informationLong noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4
European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing
More informationHigh levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma
European Review for Medical and Pharmacological Sciences 2018; 22: 7640-7645 High levels of long non-coding RNA DICER1-AS1 are associated with poor clinical prognosis in patients with osteosarcoma X.-H.
More informationAssociation between downexpression of mir-1301 and poor prognosis in patients with glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.
More informationLong non-coding RNA TUSC7 expression is independently predictive of outcome in glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 3605-3610 Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma X.-L. MA 1, W.-D. ZHU 2, L.-X. TIAN 2,
More informationDecreased expression of mir-490-3p in osteosarcoma and its clinical significance
European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,
More informationExpression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.
More informationDownregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients
European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,
More informationExpression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.
More informationMir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
More informationOverexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients
European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG
More informationCircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
More informationOriginal Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
More informationHigh Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10621 RESEARCH ARTICLE High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas Yao-Wu Wang 1, Chun-Li Yin 2, Hong-Yi Zhang
More informationLong noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,
More informationIncreased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma
Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital
More informationExpression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationLncRNA LET function as a tumor suppressor in breast cancer development
European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.
More informationKnockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma
Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906
More informationOriginal Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable prognosis
Int J Clin Exp Pathol 2016;9(1):181-185 www.ijcep.com /ISSN:1936-2625/IJCEP0017823 Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable
More informationMiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma
European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:
More informationIncreased long noncoding RNA LINP1 expression and its prognostic significance in human breast cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 8749-8754 Increased long noncoding RNA LINP1 expression and its prognostic significance in human breast cancer X.-M. LIU 1, B. YANG 2,
More informationPrognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma
European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.
More informationLong non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 3808-3812 Long non-coding RNA Loc344887 is a potential prognostic biomarker in non-small cell lung cancer B. WU 1, X.-J. ZHANG 2, X.-G.
More informationAnalysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma
European Review for Medical and Pharmacological Sciences 2017; 21: 498-503 Analysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma J.-J. WEN
More informationEffect of lncrna LET on proliferation and invasion of osteosarcoma cells
European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of
More informationLong non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression
European Review for Medical and Pharmacological Sciences 2017; 21: 4087-4091 Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression C.-H. QU 1, Q.-Y.
More informationClinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer
European Review for Medical and Pharmacological Sciences 2016; 20: 3373-3377 Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer Z.-J. CHEN, Z. ZHANG, B.-B. XIE, H.-Y. ZHANG
More informationUp-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma
European Review for Medical and Pharmacological Sciences 2018; 22: 8624-8629 Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma H.-X. AN 1, B. XU 2, Q. WANG 3, Y.-S.
More informationLncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 2328-2333 LncRNA GHET1 predicts a poor prognosis of the patients with non-small cell lung cancer Q.-M. SHEN 1,2, H.-Y. WANG 1,2, S. XU
More informationIncreased expression of LncRNA BANCR and its prognostic significance in human hepatocellular carcinoma
Zhou and Gao World Journal of Surgical Oncology (2016) 14:8 DOI 10.1186/s12957-015-0757-5 RESEARCH Open Access Increased expression of LncRNA BANCR and its prognostic significance in human hepatocellular
More informationDown-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer
European Review for Medical and Pharmacological Sciences 2016; 20: 5143-5147 Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationCircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,
More informationGLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 6809-6815 GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer M. LIANG 1, X.-C. LIU 1, T. LIU 2, W.-J. LI 3, J.-G. XIANG 1,
More informationLncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma
European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,
More informationOriginal Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer
Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,
More informationCircular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.
More information95% CI: , P=0.037).
Biomedical Research 2017; 28 (21): 9248-9252 Reduced expression level of mir-205 predicts poor prognosis in Qiang Yang 1*#, Peng Sun 2#, Haotian Feng 1, Xin Li 1, Jianmin Li 1 1 Department of Orthopedics,
More informationOriginal Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
Int J Clin Exp Pathol 2015;8(3):2994-3000 www.ijcep.com /ISSN:1936-2625/IJCEP0005023 Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
More informationUp-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis
European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion
More informationOverexpression of LncRNA FER1L4 in endometrial carcinoma is associated with favorable survival outcome
European Review for Medical and Pharmacological Sciences 2018; 22: 8113-8118 Overexpression of LncRNA FER1L4 in endometrial carcinoma is associated with favorable survival outcome Y. KONG 1, Z. REN 2 1
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationLong non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer
European Review for Medical and Pharmacological Sciences 2017; 20: 479-483 Long non-coding RNA CCHE1 overexpression predicts a poor prognosis for cervical cancer Y. CHEN, C.-X. WANG, X.-X. SUN, C. WANG,
More informationLong non-coding RNA XLOC_ correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma
European Review for Medical and Pharmacological Sciences 2017; 21: 4867-4874 Long non-coding RNA XLOC_010235 correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma F. YANG,
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationLong non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3357-3362 Long non-coding RNA FEZF1-AS1 is up-regulated and associated with poor prognosis in patients with cervical cancer H.-H. ZHANG
More informationMicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer
European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.
More informationmir-218 tissue expression level is associated with aggressive progression of gastric cancer
mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,
More informationHigh expression of long non-coding RNA LOC correlates with distant metastasis and exhibits a poor prognosis in patients with osteosarcoma
European Review for Medical and Pharmacological Sciences 2018; 22: 4115-4120 High expression of long non-coding RNA LOC730101 correlates with distant metastasis and exhibits a poor prognosis in patients
More informationCirculating microrna-137 is a potential biomarker for human glioblastoma
European Review for Medical and Pharmacological Sciences Circulating microrna-137 is a potential biomarker for human glioblastoma H.-Y. LI, Y.-M. LI, Y. LI, X.-W. SHI, H. CHEN 2016; 20: 3599-3604 Department
More informationLong noncoding RNA ABHD11-AS1 predicts the prognosis of pancreatic cancer patients and serves as a promoter by activating the PI3K-AKT pathway
European Review for Medical and Pharmacological Sciences 2018; 22: 8630-8639 Long noncoding RNA ABHD11-AS1 predicts the prognosis of pancreatic cancer patients and serves as a promoter by activating the
More informationLncRNA AB promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5
European Review for Medical and Pharmacological Sciences 2019; 23: 2374-2379 LncRNA AB073614 promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5 L.-Y. GUO 1, C.-F.
More informationCorrelation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer
Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,
More informationMir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma
European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.
More informationOriginal Article Long non-coding RNA PANDAR overexpression serves as a poor prognostic biomarker in oral squamous cell carcinoma
Int J Clin Exp Pathol 2018;11(5):2728-2734 www.ijcep.com /ISSN:1936-2625/IJCEP0073509 Original Article Long non-coding RNA PANDAR overexpression serves as a poor prognostic biomarker in oral squamous cell
More informationmir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells
European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.
More informationLong noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer
European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.
More informationLong non-coding RNA FOXD2-AS1 functions as a tumor promoter in colorectal cancer by regulating EMT and Notch signaling pathway
European Review for Medical and Pharmacological Sciences 2017; 21: 3586-3591 Long non-coding RNA FOXD2-AS1 functions as a tumor promoter in colorectal cancer by regulating EMT and Notch signaling pathway
More informationKnockdown of long noncoding RNA linc-it- GB1 suppresses migration, invasion of hepatocellular carcinoma via regulating ZEB1
European Review for Medical and Pharmacological Sciences 2017; 21: 5089-5095 Knockdown of long noncoding RNA linc-it- GB1 suppresses migration, invasion of hepatocellular carcinoma via regulating ZEB1
More informationIncreasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis
European Review for Medical and Pharmacological Sciences 2017; 21: 3592-3597 Increasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis T. WANG 1, X. LIU 1, Q. TIAN
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationThe diagnostic value of determination of serum GOLPH3 associated with CA125, CA19.9 in patients with ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4039-4044 The diagnostic value of determination of serum GOLPH3 associated with CA125, CA19.9 in patients with ovarian cancer H.-Y. FAN
More informationOriginal Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome
Int J Clin Exp Pathol 2017;10(2):2030-2035 www.ijcep.com /ISSN:1936-2625/IJCEP0009456 Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical
More informationLncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway
Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,
More informationSafranal inhibits the migration and invasion of human oral squamous cell carcinoma cells by overcoming epithelial-mesenchymal transition.
Biomedical Research 2017; 28 (2): 817-821 ISSN 0970-938X www.biomedres.info Safranal inhibits the migration and invasion of human oral squamous cell carcinoma cells by overcoming epithelial-mesenchymal
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationResearch Article Expression and Clinical Significance of the Novel Long Noncoding RNA ZNF674-AS1 in Human Hepatocellular Carcinoma
BioMed Research International Volume 2016, Article ID 3608914, 5 pages http://dx.doi.org/10.1155/2016/3608914 Research Article Expression and Clinical Significance of the Novel Long Noncoding RNA ZNF674-AS1
More informationAm J Cancer Res 2018;8(10): /ISSN: /ajcr Luming Wang, Di Meng, Yiqing Wang, Jian Hu
Am J Cancer Res 2018;8(10):2020-2029 www.ajcr.us /ISSN:2156-6976/ajcr0061054 Original Article Long non-coding RNA LINC01296 promotes esophageal squamous cell carcinoma cell proliferation and invasion by
More informationOriginal Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma
Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for
More informationClinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer
Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer P. Liu 1, F. Xin 1 and C.F. Ma 2 1 Department of Obstetrics & Gynecology, Baoding Second Central Hospital,
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationThe clinical significance of HPIP and the associated prognosis in cervical cancer
/, 2017, Vol. 8, (No. 41), pp: 70262-70270 The clinical significance of HPIP and the associated prognosis in cervical cancer Fanling Meng 1,*, Haixia Liu 1,*, Shuang Liu 1 and Rong Ma 1 1 Department of
More informationOriginal Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer
Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun
More informationLncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p
European Review for Medical and Pharmacological Sciences 2018; 22: 6838-6844 LncRNA SNHG15 promotes proliferation and migration of lung cancer via targeting microrna-211-3p H.-X. CUI, M.-Y. ZHANG, K. LIU,
More informationClinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study
European Review for Medical and Pharmacological Sciences 2018; 22: 7704-7709 Clinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study Z.-Y. LIU, L. YANG,
More informationUCA1 impacts progress of rheumatoid arthritis by inducing the apoptosis of fibroblast-like synoviocyte
European Review for Medical and Pharmacological Sciences 2018; 22: 914-920 UCA1 impacts progress of rheumatoid arthritis by inducing the apoptosis of fibroblast-like synoviocyte Z.-F. YAN 1, X.-Y. ZHAO
More informationReview Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association with Pathological Features
BioMed Research International Volume 2016, Article ID 4863609, 8 pages http://dx.doi.org/10.1155/2016/4863609 Review Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association
More informationOriginal Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma
Int J Clin Exp Pathol 2016;9(6):6506-6510 www.ijcep.com /ISSN:1936-2625/IJCEP0024531 Original Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma Zhihong
More informationOriginal Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas
Int J Clin Exp Pathol 2017;10(4):4363-4369 www.ijcep.com /ISSN:1936-2625/IJCEP0043994 Original Article B7-H3 repression by mir-539 suppresses cell proliferation in human gliomas Rong-Gang Li 1, Zhuo Gao
More informationReduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis
Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital
More informationCancer Cell Research 19 (2018)
Available at http:// www.cancercellresearch.org ISSN 2161-2609 LncRNA RP11-597D13.9 expression and clinical significance in serous Ovarian Cancer based on TCGA database Xiaoyan Gu 1, Pengfei Xu 2, Sujuan
More informationHighly expressed lncrna FAL1 promotes the progression of gastric cancer by inhibiting PTEN
European Review for Medical and Pharmacological Sciences 2018; 22: 8257-8264 Highly expressed lncrna FAL1 promotes the progression of gastric cancer by inhibiting PTEN C.-H. ZHU, D.-S. XIAO, L.-B. DAI,
More informationPositive nin one binding protein expression predicts poor outcome in prostate cancer
MOLECULAR MEDICINE REPORTS 11: 2671-2676, 2015 Positive nin one binding protein expression predicts poor outcome in prostate cancer JIE CHEN *, JUNKAI WANG *, XINGANG CUI, YUSHAN LIU, LEI YIN, YAO LI,
More informationGACAT3 promoted proliferation of osteoarthritis synoviocytes by IL-6/STAT3 signaling pathway
European Review for Medical and Pharmacological Sciences 2018; 22: 5114-5120 GACAT3 promoted proliferation of osteoarthritis synoviocytes by IL-6/STAT3 signaling pathway X. LI, W. REN, Z.-Y. XIAO, L.-F.
More informationNasopharyngeal carcinoma (NPC) is one of the most common
Long non-coding RNA ROR promotes proliferation, migration and chemoresistance of nasopharyngeal carcinoma Li Li, 1 Miao Gu, 1 Bo You, Si Shi, Ying Shan, Lili Bao and Yiwen You Department of Otorhinolaryngology
More informationOriginal Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2
Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang
More informationOriginal Article LncRNA HOXD-AS1 promotes melanoma cell proliferation and invasion by suppressing RUNX3 expression
Am J Cancer Res 2017;7(12):2526-2535 www.ajcr.us /ISSN:2156-6976/ajcr0064925 Original Article LncRNA HOXD-AS1 promotes melanoma cell proliferation and invasion by suppressing RUNX3 expression Hailin Zhang,
More informationOriginal Article High expression of long non-coding RNA SPRY4-IT1 predicts poor prognosis of clear cell renal cell carcinoma
Int J Clin Exp Pathol 2014;7(9):5801-5809 www.ijcep.com /ISSN:1936-2625/IJCEP0001286 Original Article High expression of long non-coding RNA SPRY4-IT1 predicts poor prognosis of clear cell renal cell carcinoma
More informationMicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1
European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.
More informationmir-135a inhibits glioma cell proliferation and invasion by directly targeting FOXO1
European Review for Medical and Pharmacological Sciences 2018; 22: 4215-4223 mir-135a inhibits glioma cell proliferation and invasion by directly targeting FOXO1 H.-Z. SHI 1, D.-N. WANG 2, F. XU 3, J.-H.
More informationIncreased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates with poor prognosis
Lin et al. Diagnostic Pathology (2015) 10:14 DOI 10.1186/s13000-015-0247-7 RESEARCH Open Access Increased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationDepartment of Oral Medicine, Qilu Hospital, Institute of Stomatology, Shandong University, Jinan, Shandong, China 2
European Review for Medical and Pharmacological Sciences 2018; 22: 8306-8314 Increased expression of lncrna FTH1P3 promotes oral squamous cell carcinoma cells migration and invasion by enhancing PI3K/Akt/
More informationClinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 5696-5701 Clinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer G.-H. ZHOU 1, W.-H. YANG 2, B. SUN
More informationClinical value of combined detection of mir 1202 and mir 195 in early diagnosis of cervical cancer
ONCOLOGY LETTERS 17: 3387-3391, 2019 Clinical value of combined detection of mir 1202 and mir 195 in early diagnosis of cervical cancer XIELAN YANG 1, ZHILING YAN 1, HONGYING YANG 1, HUIJING NI 1, LEI
More informationMicroRNA-21 expression is associated with overall survival in patients with glioma
Wu et al. Diagnostic Pathology 2013, 8:200 RESEARCH Open Access MicroRNA-21 expression is associated with overall survival in patients with glioma Lin Wu 1, Gang Li 2, Dayun Feng 2, Huaizhou Qin 2, Li
More informationOriginal Article Rab13 silencing causes inhibition of growth and induction of apoptosis in human glioma cells
Int J Clin Exp Pathol 2016;9(3):3007-3014 www.ijcep.com /ISSN:1936-2625/IJCEP0016546 Original Article Rab13 silencing causes inhibition of growth and induction of apoptosis in human glioma cells Bo Diao,
More information