A Panel of TMPRSS2:ERG Fusion Transcript Markers for Urine-Based Prostate Cancer Detection with High Specificity and Sensitivity

Transcription

1 EUROPEAN UROLOGY 59 (2011) available at journal homepage: Prostate Cancer A Panel of TMPRSS2:ERG Fusion Transcript Markers for Urine-Based Prostate Cancer Detection with High Specificity and Sensitivity Phuong-Nam Nguyen, Philippe Violette, Sam Chan, Simon Tanguay, Wassim Kassouf, Armen Aprikian, Junjian Z. Chen * Department of Surgery/Division of Urology, McGill University Health Center, Montreal, Quebec, H3G 1A4 Canada Article info Article history: Accepted November 17, 2010 Published online ahead of print on November 26, 2010 Keywords: TMPRSS2:ERG fusion Prostate cancer Urine test ERG Cancer diagnosis Abstract Background: The TMPRSS2:ERG fusion is both prevalent and unique to prostate cancer (PCa) and has great potential for noninvasive diagnosis of PCa in bodily fluids. Objectives: To evaluate the specificity and sensitivity of the TMPRSS2:ERG fusion in urine from diverse clinical contexts and to explore potential clinical applications. Design, setting, and participants: A total of 101 subjects were enrolled in 2008 from urologic oncology clinics to form three study groups: 44 PCa free, 46 confirmed PCa, and 11 negative prostate biopsies. The PCa-free group included females, healthy young men, and post radical prostatectomy (RP) patients. The confirmed PCa group was composed of patients under active surveillance, scheduled for treatment, or with metastatic disease. Measurements: Urine was collected after attentive digital rectal exam (DRE) and coded to blind group allocation for laboratory test. RNA from urine sediments was analyzed using a panel of four TMPRSS2:ERG fusion markers with quantitative polymerase chain reaction (qpcr). Results and limitations: Our fusion markers demonstrated very high technical specificity and sensitivity for detecting a single fusion-positive cancer cell (VCaP) in the presence of at least 3000 cells in urine sediments. In clinical analysis, there were no fusion-positive samples in the PCa-free group (0 of 44 samples), while there were 16 of 46 (34.8%) fusion-positive samples in the confirmed PCa group. The fusion incidence varied significantly among the three PCa subgroups. The clinical sensitivity increased to 45.4% in cancer patients prior to treatments. The fusion markers were detected in 2 of 11 (18.2%) biopsy-negative patients, suggesting potentially false negative biopsies. This study is not prospective and is limited in sample sizes. Conclusions: Our novel panel of TMPRSS2:ERG fusion markers provided a very specific and sensitive tool for urine-based detection of PCa. Theses markers can potentially be used to diagnose patients with PCa who have negative biopsies. # 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved. * Corresponding author. Department of Surgery/Division of Urology, Research Institute McGill University Health Center, Room R2.133, 1650 Cedar Avenue, Montreal, Quebec, H3G 1A4 Canada. Tel x44601; Fax: address: junjian.chen@mcgill.ca (J.Z. Chen) /$ see back matter # 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved. doi: /j.eururo

2 408 EUROPEAN UROLOGY 59 (2011) Introduction As a seminal discovery, many prostate tumors contain a specific genetic change that involves the fusion of two genes [1,2]. The fusion of an androgen-regulated gene, TMPRSS2, to a nearby E twenty-six (ETS) transformation-specific transcription factor gene, ERG, has been reported as the most common genetic change in prostate cancer (PCa), found in approximately 50% of surgical tumors [3 8]. The TMPRSS2 gene also becomes fused to other ETS genes in approximately 10% of cancer cases [1 3,9]. Such fusion events provide a novel mechanism for androgen-regulated overexpression of the ETS genes, with immediate implications in PCa progression [10,11]. ERG overexpression has recently been shown to inhibit normal prostate differentiation by shutting down androgen signaling [12] and to induce an embryonic stem cell like dedifferentiation program by turning on EZH2 expression [12 14]. Meanwhile, diverse TMPRSS2:ERG fusion subtypes have been uncovered, ranging from chromosomal rearrangements to fusion transcripts [6,8,15 17]. Such fusion subtypes not only allow stratification of clinically aggressive forms of cancer [6,15] but also provide redundant and cancer-specific transcript markers for potentially noninvasive cancer detection in bodily fluids. Indeed, a common TMPRSS2:ERG fusion isoform is shown to be detectable in the urine of men with PCa and has been coupled with other molecular markers in urinebased cancer detection [18 20]. However, critical evaluations remain scarce on the specificity, sensitivity, and clinical utility of one or multiple fusion markers in urine-based detection. In this study, we aim to evaluate the specificity and sensitivity from both technical and clinical perspectives of multiple TMPRSS2:ERG fusion isoforms in diverse clinical contexts and to explore their potential clinical applications. 2. Materials and methods 2.1. Human subjects Human subjects were enrolled through an institutional review board approved protocol and written informed consent at the McGill University Health Center to form three distinctive study groups: PCa-free subjects (n = 44), confirmed PCa patients (n = 46), and patients with negative biopsies (n = 11). The PCa-free group was designed as a negative control to test the specificity of fusion markers. It included females (n = 18), healthy males <37 yr of age (n =14),andpost radical prostatectomy (RP) patients with a prostate-specific antigen (PSA) of 0(n = 12). The confirmed PCa group was designed for comparative analysis of fusion markers among different cancer cohorts. It was composed of patients under active surveillance (n =21), those scheduled for treatment (n = 11), and those with metastasis (n =14). The active surveillance cohort consisted of patients with biopsyproven PCa who were followed clinically for signs of cancer progression but were not receiving active therapy. The pretreatment cohort consisted of patients who had biopsy-proven PCa and were scheduled foreitherrporradiationtherapy(rt). The metastatic cohort consisted of patients with biopsy-proven PCa and evidence of metastasis. This late definition was independent of therapies (eg, androgen-deprivation therapy [ADT] or RT) but excluded patients who received RP. Finally, urine samples from patients with negative biopsies were used to identify potentially false-negative biopsies. The baseline clinical characteristics of each cohort and 1-yr follow-up of treatments are provided in Table Urine collection and prostate cancer cell lines The first voided urine after attentive digital rectal examination (DRE) was collected from male subjects. Female and post-rp subjects were exempted from DRE because of the absence of a prostate, and ml of urine was collected from each subject in a sterile collection cup containing RNA/DNA preservatives (Sierra Diagnostics). Urine sediments were collected by low-speed centrifugation at 4 8C and resuspended in TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) for immediate RNA extraction or stored at 80 8C until use. The PCa cell lines, VCaP and NCI- H660, were gifts from Dr. van Bokhoven at the University of Colorado Denver Health Sciences Center Preparation of whole transcriptome amplification complementary DNA libraries Total RNA was extracted from urine sediment and cancer cell lines using the TRIzol Reagent. A whole transcriptome amplification (WTA) step was used to generate a complementary DNA (cdna) library from a limited amount of RNA from each sample using a TransPlex WTA kit (Sigma- Aldrich, St. Louis, MO, USA) according to the manufacturer s instructions [18]. Table 1 The baseline clinical and pathologic characteristics of distinctive clinical cohorts Clinical parameters a PCa-free group Confirmed PCa group Negative biopsy Female Young men Post-RP Active surveillance Pretreatment Metastatic Samples, no Age, yr 67 (34 79) 27.5 (19 37) 61 (48 82) 73 (55 82) 68 (53 85) 77 (73 88) 67 (51 81) Presample PSA 0.01 ( ) 5.29 ( ) ( ) ( ) Gleason score 6 (6 8) 6 (6 7) 6 (6 9) 9 (7 10) Metastasis No No No No No Yes (14) No RP (12) RP (6) b Treatment (1-yr follow-up) ADT (3) RT (3) ADT(13) RT (2) PCa = prostate cancer; RP = radical prostatectomy; PSA = prostate-specific antigen; ADT = androgen-deprivation therapy; RT = radiation therapy. a Values expressed as median, with ranges in parentheses. b Treatments received after urine collection ( )

3 EUROPEAN UROLOGY 59 (2011) Table 2 Primer sequences of TMPRSS2:ERG fusion markers and additional molecular markers Gene Primer Sequence Amplicon (bp) Annealing Tm a (8C) TM-e1:ER-e4; isoform I TM-e2:ER-e4; isoform II TM-e1:ER-e2; isoform III TM-e1:ER-e5; isoform IV Isoform I and II flanking Isoform III flanking ERG(5-6) ERG(6-7) GAPDH TM-e1:ER-e4F ERG-e4R(1) TM-e2:ER-e4F ERG-e4R(2) TM-e1:ER-e2F ERG-e2R(1) TM-e1:ER-e5F ERG-e5R(1) TM-e1F ERG-e4R(3) TM-e1F ERG-e2R(2) ERG5-6F ERG5-6R ERG6-7F ERG6-7R GAPDH(3)f GAPDH(3)r CTGGAGCGCGGCAGGAA GTAGGCACACTCAAACAACGACTGG GATGGCTTTGAACTCAGAAGC TCCGTAGGCACACTCAAACAAC TGGAGCGCGGCAGGTTATT TTGTCTTGCTTTTGGTCAACACG GGAGCGCGGCAGGAACT GTTCATCCCAACGGTGTCTGG GGAGCGCCGCCTGGAG GTCTTAGCCAGGTGTGGCGTTC GGAGCGCCGCCTGGAG TTGCCCTTGGTTCTGCCATC CGCAGAGTTATCGTGCCAGCAGAT CCATATTCTTTCACCGCCCACTCC AGCTACAACGCCGACATCC GAAGTCAAATGTGGAAGAGGAGTC AAGGTCGGAGTCAACGGATTT ACCAGAGTTAAAAGCAGCCCTG or qpcr = quantitative polymerase chain reaction. a The qpcr program consisted of initial denaturing at 95 8C for 1.5 min, followed by 50 cycles of a two-step reaction at 95 8C for 15 s and C (varying for each marker) for 30 s. The qpcr was performed using the MyiQ real-time PCR system (Bio-Rad) Detection of TMPRSS2:ERG fusion and other markers Real-time quantitative polymerase chain reaction (qpcr) was used to detect a panel of TMPRSS2:ERG fusion markers. Additional markers were also quantified, including two ERG markers targeting exons 5-6 and 6-7 and a housekeeping gene GADPH. The primer sequences are listed in Table 2. For qpcr, 9 ng of cdna were amplified in a 20-ml reaction containing 1X SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) and 300 nm each of forward and reverse primers using a two-step program (see Table 2). A melt-curve analysis step was enabled at the end of the amplification, and the threshold cycle (Ct) was calculated using the MyiQ software (Bio-Rad). The relative expression of each target gene was normalized to the housekeeping gene GAPDH using the comparative Ct method (Applied Biosystems User Bulletin 2) Data analysis The Mann-Whitney U test was used to compare the log-transformed relative expression of molecular markers from clinical cohorts. This nonparametric test was also used to assess statistical significance in the clinical cohorts stratified by fusion status for ERG markers. The x 2 test was used to establish an association between confirmed PCa subgroups and the presence of TMPRSS2:ERG fusion markers; it was also used to assess an association between the ERG expression level and fusion status in PCa patients or between ERG overexpression and ADT in fusionnegative PCa patients. All statistical analyses were run on GraphPad Prism v.4 software (GraphPad, La Jolla, CA, USA). Two-sided p values <0.05 were considered statistically significant. 3. Results 3.1. Validation of a new panel of TMPRSS2:ERG fusion markers for urine detection A panel of isoform-specific fusion probes was designed based on fusion junction sequences and validated for the common fusion isoform I and three additional reported isoforms (II, III, and IV; Table 2). The technical specificity of the new probe for fusion isoform I was confirmed by the expected melt-curve and fragment size of amplified products in a fusion-positive cell line (VCaP) and by the absence of unspecific amplification in fusion-negative urine samples within a 50-cycle qpcr reaction (Fig. 1A and B). The technical sensitivity of the fusion marker was evaluated in a titration experiment that mixed various amounts of VCaP RNA with fusion-negative urine RNA for a total of 100 ng prior to WTA amplification. We demonstrated that as little as 0.01% fusion-positive cancer RNA (ie, 10 pg) could be effectively detected for fusion isoform I using this approach (Fig. 1C) Urine-based detection of TMPRSS2:ERG fusion markers in diverse clinical cohorts The WTA cdna templates from 101 urine samples were analyzed using the new fusion markers in a blind fashion and without prior selection with urine PSA (Fig. 2). No fusion isoforms were detected in 44 PCa-free cases, representing a very high clinical specificity. In contrast, 16 urine samples were detected with at least one fusion marker in 46 confirmed PCa cases, representing a clinical sensitivity of 34.8%. However, the distribution of fusionpositive cases varied significantly between cancer cohorts, with 47.6% in the active surveillance cohort and 14.3% in the metastatic cohort. All metastatic patients except one had received ADT at the time of urine collection. Coincidentally, the sole hormone-naïve case was detected with multiple fusion isoforms. Thus, the low fusion incidence in the metastatic cohort could be associated with ADT treatment. When the negative-biopsy cohort was screened for fusion markers, 2 of 11 (18.2%) patients were found to be fusion positive, one of whom was subsequently diagnosed with PCa on repeat biopsy. In contrast, of the 18 fusion-positive samples, 17 were detected with the common isoform I, and 7 contained two or more fusion isoforms (Table 3). All fusion-positive samples were confirmed independently

4 410 EUROPEAN UROLOGY 59 (2011) probably because of the limited number of samples and short follow-up time Associations of ERG overexpression in urine with TMPRSS2:ERG fusion and metastasis Two ERG markers targeting exons 5-6 and 6-7 were detectable in all seven clinical cohorts (Fig. 3A). When confirmed PCa cases were stratified by the TMPRSS2:ERG fusion status, a 6- to 15-fold increase in urine ERG expression was observed among fusion-positive versus fusion-negative samples ( p < 0.01; Fig. 3B). When the median ERG expression in fusion-positive cancer cases was used as a cutoff, 11 of 16 fusion-positive samples were found to overexpress one or both ERG markers in urine. Thus, the ERG overexpression in urine was strongly associated with the fusion status in cancer samples ( p < 0.001; x 2 test; Fig. 3C). In contrast, 5 of 30 fusionnegative cancer samples exhibited ERG overexpression; four of the overexpressed samples were distributed in 12 fusion-negative metastatic cases ( p < 0.05; x 2 test; Fig. 3D). 4. Discussion Fig. 1 Validation of the TMPRSS2:ERG fusion marker with a prostate cancer cell line and urine samples. (A) A melt-curve specific to the fusion isoform I amplified from a fusion-positive cell line (VCaP) using the MyiQ real-time polymerase chain reaction (PCR) system. (B) Gel electrophoresis of PCR products generated by specific (upper panel) versus unspecific (lower panel) markers for fusion isoform I. A new marker designed in the current study generated an expected PCR fragment only in the VCaP cell line but not in fusion-negative urine samples (upper panel); a less-specific marker generated the expected PCR fragment not only in the VCaP cell line but also in fusion-negative urine samples after 35 cycles (lower panel). (C) Detection of titrated VCaP RNA (fusion isoform I) in fusion-negative urine RNA. The log value of relative amplification was normalized to the signal of 100% VCaP RNA. The 0.0% amplification was defined by the lack of specific amplification in a 50-cycle reaction. Ct = threshold cycle; WTA = whole transcriptome amplification. using probes flanking the fusion markers, which also ruled out potential cross-contamination from fusion PCR products. However, the fusion status was not associated with Gleason score or cancer progression in the current study, The TMPRSS2:ERG fusion is both prevalent and unique to PCa [21] and hence has great potential for noninvasive diagnosis and prognosis of PCa. The main challenges of urine-based fusion detection are technical demands for detecting rare fusion markers and the need to clarify the specificity of fusion markers in complex urine specimens. In the current study, we developed a new panel of TMPRSS2:ERG fusion markers for a urine-based qpcr test and evaluated their specificity and sensitivity using fusion-positive cancer cell lines (VCaP and NCI-H660) and in diverse clinical contexts. We demonstrate that no fusion markers are detectable in fusion-negative templates in the qpcr test, while as little as 10 pg of VCaP RNA could be effectively detected in the presence of 100 ng of fusion-negative urine RNA. This translates into superior technical specificity and sensitivity for detecting a single VCaP cancer cell in the presence of at least 3000 cells in urine sediments. The clinical specificity and sensitivity of the fusion markers were evaluated in diverse clinical subjects. We demonstrate in a blind analysis that no fusion markers are detectable in 44 subjects from the PCa-free group. The very high specificity in both technical and clinical terms suggests that the detectable presence of one or more fusion isoforms may be sufficient to detect a positive result in bodily fluids. This nonthreshold feature distinguishes the TMPRSS2:ERG fusion marker from other quantitative markers that require arbitrary cutoff values [22]. In contrast, one or more fusion markers are detected in 16 of 46 (34.8%) confirmed PCa patients. Considering a suppressing effect of ADT on fusion incidence, the actual clinical sensitivity of fusion markers will increase to 45.4% in cancer patients prior to any treatment. This sensitivity is not only higher than previously reported values [18,19] but is achieved without prescreening urine specimens. It is useful to point out that PCa cell lines and urine specimens have limitations in the

5 [()TD$FIG] EUROPEAN UROLOGY 59 (2011) Fig. 2 Urine-based detection of TMPRSS2:ERG fusion markers in diverse clinical cohorts. The prostate cancer (PCa) free group consisted of female, young men, and post radical prostatectomy cohorts, while the confirmed PCa group consisted of active surveillance, pretreatment, and metastatic cohorts. The bar with vertical lines indicates the number of cases in each cohort; the bar with horizontal lines indicates the number of cases detected with at least one of the fusion markers. The fusion detection rate is indicated above the fusion-positive bar. Values were compared for statistical significance as indicated by solid lines between clinical groups or subgroups. PCa = prostate cancer. * p < **<0.01. ***< development of new markers and that the usability of the panel of TMPRSS2:ERG fusion markers could be further strengthened by validating fusion status in both urine and surgical tissues of the same patient in future prospective studies. With exceptional specificity and 35 45% sensitivity, the urine-based test is used to test the feasibility of detecting potentially false-negative biopsy cases. As a significant clinical issue, a typical patient population undergoing a prostate biopsy based on serum PSA and DRE has a 65 70% biopsy-negative rate, among which about 20% of biopsynegative subjects are diagnosed with PCa in repeat biopsies [23 26]. Surprisingly, two fusion-positive cases were identified in 11 biopsy-negative patients, with one of the positive cases confirmed as PCa in a subsequent biopsy in the current study. This result is not only supported by the detection of TMPRSS2:ERG fusion markers in the urine of biopsy-negative patients in a previous study [19] but represents one of the first successful attempts to validate a false-negative biopsy patient using urine-based fusion detection. Thus, the detection of the TMPRSS2:ERG fusion markers in biopsynegative patients may represent a distinctive molecular subgroup, with significant clinical implications in the Table 3 The TMPRSS:ERG fusion isoform and combination detected in 18 fusion-positive urine samples and 2 fusion-positive prostate cancer cell lines Samples, no. Age, yr Gleason score Fusion I Fusion II Fusion III Fusion IV (TM-e1:ER-e4) (TM-e2:ER-e4) (TM-e1:ER-e2) (TM-e1:ER-e5) (Ct) a (Ct) (Ct) (Ct) (55 82) 6 (6 7) 34.0 ( ) NQ NQ NQ 3 75 (66 82) 7 (6 9) 32.3 ( ) 32.9 ( ) NQ NQ NQ 36.5 NQ NQ NQ NQ 32.5 NQ NQ NQ NQ NCI-H660 b NQ NQ VCaP b 17.8 NQ NQ 26.1 Ct = threshold cycle; NQ = not quantifiable; PCa = prostate cancer. a Cutoff Ct value is 50 cycles. b Fusion-positive PCa cell lines.

6 412 EUROPEAN UROLOGY 59 (2011) Fig. 3 Associations of ERG overexpression in urine with TMPRSS2:ERG fusion and metastasis. (A) The prevalence of two ERG markers targeting exons 5-6 and 6-7 in urine from diverse clinical cohorts. The detection rate in each cohort was calculated as the percentage of positive samples for each marker. (B) The expression levels of two ERG markers in urine were stratified by fusion status in 46 cases in the confirmed prostate cancer (PCa) group. The relative expression was based on a DD threshold cycle method and transformed into log 2 values. (C) ERG overexpression in urine was stratified with fusion status in the confirmed PCa group. ERG overexpression was defined as a relative expression that was greater than the median expression of either exon 5-6 or 6-7 in fusion-positive cancer cases. (D) ERG overexpression in urine was stratified with androgen-deprivation therapy in fusion-negative cancer cases. RP = radical prostatectomy; ADT = androgen-deprivation therapy.

7 EUROPEAN UROLOGY 59 (2011) management of biopsy-negative patients a topic that we are actively investigating in an ongoing prospective study. The biologic implication of TMPRSS2:ERG fusion is upregulation of oncogenic ERG expression in PCa cells [27,28]. We demonstrate that the fusion-positive status is strongly associated with ERG overexpression in the urine of cancer patients prior to any treatment (Fig. 3B and C). Interestingly, ADT significantly reduces TMPRSS2:ERG fusion incidence in the urine of metastatic patients but has little effect on ERG overexpression. Although limited in sample size, the frequent ERG overexpression in TMPRSS2:ERG fusion-negative metastatic patients can be explained by the possible existence of additional fusion events or because of altered signal pathways associated with hormone-refractory cancers. Regardless of the basis, ERG overexpression may be essential to both androgen-dependent primary cancer and hormone-refractory cancer [12]. Thus, ERG overexpression in urine may serve as a useful surrogate for potential fusion events associated with PCa [29]. 5. Conclusions We have developed a new panel of TMPRSS2:ERG fusion markers for a urine-based qpcr test with exceptional technical specificity and sensitivity. Using these new markers, we have demonstrated a lack of fusion-positive samples in PCa-free subjects and a clinical sensitivity of 45.4% in PCa patients prior to treatments. We suggest that our TMPRSS2:ERG fusion markers may serve as nonthreshold markers in urine-based PCa detection and find direct applications in identifying false-negative biopsy cases. It is anticipated that the clinical application of the panel of TMPRSS2:ERG fusion markers could be further improved by simultaneous detection of all fusion isoforms and additional fusion genes in a single test. Author contributions: Junjian Z. Chen had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Chen, Aprikian, Violette. Acquisition of data: Chen, Nguyen, Violette, Chan, Aprikian, Kassouf, Tanguay. Analysis and interpretation of data: Chen, Nguyen. Drafting of the manuscript: Chen. Critical revision of the manuscript for important intellectual content: Chen, Aprikian, Violette, Kassouf, Tanguay. Statistical analysis: Chen, Nguyen. Obtaining funding: Chen, Aprikian. Administrative, technical, or material support: Chen, Nguyen, Chan. Supervision: Chen, Aprikian. Other (specify): None. Financial disclosures: I certify that all conflicts of interest, including specific financial interests and relationships and affiliations relevant to the subject matter or materials discussed in the manuscript (eg, employment/ affiliation, grants or funding, consultancies, honoraria, stock ownership or options, expert testimony, royalties, or patents filed, received, or pending), are the following: None. Funding/Support and role of the sponsor: Canadian Institute of Health Research (NGH99087) provided support to JZ Chen and A Aprikian, and the Canada Foundation for Innovation (11623) provided support to JZ Chen for data collection. Acknowledgment statement: The authors acknowledge M Chevrette for comments on an earlier version of the manuscript and D Ayele for statistical assistance. References [1] Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 2005;310: [2] Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE. TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res 2006;66: [3] Hermans KG, van Marion R, van Dekken H, Jenster G, van Weerden WM, Trapman J. TMPRSS2:ERG fusion by translocation or interstitial deletion is highly relevant in androgen-dependent prostate cancer, but is bypassed in late-stage androgen receptor-negative prostate cancer. Cancer Res 2006;66: [4] Perner S, Demichelis F, Beroukhim R, Schmidt FH, Mosquera JM, Setlur S. TMPRSS2:ERG fusion-associated deletions provide insight into the heterogeneity of prostate cancer. Cancer Res 2006;66: [5] Iljin K, Wolf M, Edgren H, et al. TMPRSS2 fusions with oncogenic ETS factors in prostate cancer involve unbalanced genomic rearrangements and are associated with HDAC1 and epigenetic reprogramming. Cancer Res 2006;66: [6] Wang J, Cai Y, Ren C, Ittmann M. Expression of variant TMPRSS2/ ERG fusion messenger RNAs is associated with aggressive prostate cancer. Cancer Res 2006;66: [7] Yoshimoto M, Joshua AM, Chilton-Macneill S, Bayani J, Selvarajah S, Evans AJ. Three-color FISH analysis of TMPRSS2/ERG fusions in prostate cancer indicates that genomic microdeletion of chromosome 21 is associated with rearrangement. Neoplasia 2006;8: [8] Clark J, Merson S, Jhavar S, Flohr P, Edwards S, Foster CS. Diversity of TMPRSS2-ERG fusion transcripts in the human prostate. Oncogene 2007;26: [9] Hegeson BE, Tomlins SA, Shah N, et al. Characterization of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusion in prostate cancer. Cancer Res 2008;68: [10] Kumar-Sinha C, Tomlins SA, Chinnaiyan AM. Recurrent gene fusions in prostate cancer. Nat Rev Cancer 2008;8: [11] Zong Y, Xin L, Goldstein AS, Lawson DA, Teitell MA, Witte ON. ETS family transcription factors collaborate with alternative signaling pathways to induce carcinoma from adult murine prostate cells. Proc Natl Acad Sci U S A 2009;106: [12] Yu J, Yu J, Mani RS, et al. An integrated network of androgen receptor, polycomb, and TMPRSS2-ERG gene fusions in prostate cancer progression. Cancer Cell 2010;17: [13] Kunderfranco P, Mello-Grand M, Cangemi R, et al. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer. PLoS One 2010;5: e [14] Rostad K, Mannelqvist M, Halvorsen OJ, et al. ERG upregulation and related ETS transcription factors in prostate cancer. Int J Oncol 2007; 30: [15] Attard G, Clark J, Ambroisine L, et al. Duplication of the fusion of TMPRSS2 to ERG sequences identifies fatal human prostate cancer. Oncogene 2008;27:

8 414 EUROPEAN UROLOGY 59 (2011) [16] Demichelis F, Fall K, Perner S, et al. TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene 2007;26: [17] Nam RK, Sugar L, Wang Z, et al. Expression of TMPRSS2 ERG gene fusion in prostate cancer cells is an important prognostic factor for cancer progression. Cancer Biol Ther 2007;6:40 5. [18] Laxman B, Tomlins SA, Mehra R, et al. Noninvasive detection of TMPRSS2:ERG fusion transcripts in the urine of men with prostate cancer. Neoplasia 2006;8: [19] Hessels D, Smit FP, Verhaegh GW, Witjes JA, Cornel EB, Schalken JA. Detection of TMPRSS2-ERG fusion transcripts and prostate cancer antigen 3 in urinary sediments may improve diagnosis of prostate cancer. Clin Cancer Res 2007;13: [20] Laxman B, Morris DS, Yu J, et al. A first-generation multiplex biomarker analysis of urine for the early detection of prostate cancer. Cancer Res 2008;68: [21] Scheble VJ, Braun M, Beroukhim R, et al. ERG rearrangement is specific to prostate cancer and does not occur in any other common tumor. Mod Pathol 2010;23: [22] Downes MR, Byrne JC, Pennington SR, Dunn MJ, Fitzpatrick JM, Watson RW. Urinary markers for prostate cancer. BJU Int 2007;99: [23] Djavan B, Remzi M, Schulman CC, Marberger M, Zlotta AR. Repeat prostate biopsy: who, how and when? A review. Eur Urol 2002; 42: [24] Thompson IM, Pauler DK, Goodman PJ, et al. Prevalence of prostate cancer among men with a prostate-specific antigen level 4.0 ng per milliliter. N Engl J Med 2004;350: [25] Babaian RJ, Johnston DA, Naccarato W, Ayala A, Bhadkamkar VA, Fritsche HA. The incidence of prostate cancer in a screening population with a serum prostate specific antigen between 2.5 and 4.0 ng/ml: relation to biopsy strategy. J Urol 2001;165: [26] Schroder FH, van der Cruijsen-Koeter I, de Koning HJ, Vis AN, Hoedemaeker RF, Kranse R. Prostate cancer detection at low prostate specific antigen. J Urol 2000;163: [27] Kumar-Sinha C, Tomlins SA, Chinnaiyan AM. Evidence of recurrent gene fusions in common epithelial tumors. Trends Mol Med 2006; 12: [28] Kumar-Sinha C, Tomlins SA, Chinnaiyan AM. Recurrent gene fusions in prostate cancer. Nat Rev Cancer 2008;8: [29] Rice KR, Chen Y, Ali A, et al. Evaluation of the ETS-related gene mrna in urine for the detection of prostate cancer. Clin Cancer Res 2010;16: