SUPPLEMENTARY FIG. S1. (Continued).

Size: px
Start display at page:

Download "SUPPLEMENTARY FIG. S1. (Continued)."

Transcription

1 Supplementary Data SUPPLEMENTARY FIG. S1. Plasmid profile study by PFGE-S1-Nuclease. The gels show the approximate number and size of the large plasmids present in each isolate. Isolates were numbered consecutively above each lane in the same order as they appear in Supplementary Table 1. (A) Escherichia coli harbored one to five plasmids that ranged < kb in size. (B) Klebsiella oxytoca harbored one to six plasmids that ranged < kb in size. (C) Citrobacter freundii harbored one to six plasmids that ranged < kb in size. (D) Serratia marcescens harbored one to three plasmids that ranged < kb in size. *NS, sample not studied; PFGE, pulsed-field gel electrophoresis.

2 SUPPLEMENTARY FIG. S1. (Continued).

3 SUPPLEMENTARY FIG. S2. Number of isolates and hospitals referring KPC-producing non-klebsiella pneumoniae isolates from June 2010 to December The graph shows the number of KPC-producing ETB (squares), the number of hospitals referring isolates (triangles), and the cumulative number of hospitals (diamonds). The study included isolates that were referred until March This year was not included in this graph because it was misleading. ETB, Enterobacteriaceae; KPC, Klebsiella pneumoniae carbapenemase.

4 Specie ID a Supplementary Table S1. Epidemiological and Molecular Characteristics of KPC-Producing Non-K. pneumoniae Enterobacteriaceae HTAL. code Province Date Sex Age Sample PFGE type ESBLs b bla KPC genetic environment c No. of plasmids/mw (Kb) ECO-1 NEU NEUQUEN June-2010 Female 55 Pleural fluid B No.4 4/<48.5; 60; 76; 145 ECO-2 HHE NEUQUEN January-2011 Male 87 Blood G c CTX-M-1/15 No.2 2/<48.5; 135 ECO-3 FAV BA CITY August-2010 ND 45 Rectal screening C No.8 2/<48.5; 83 ECO-4 BAR RIO NEGRO September-2010 Female 19 Rectal screening D c Tn4401a 2/66; 145 ECO-5 JAF BA CITY December-2010 Male 43 Rectal screening F Tn4401a 2/<48.5; 104 ECO-6 SWI BA CITY October-2010 Female 94 Rectal screening E Tn4401a 2/<48.5; 66; 120 ECO-7 HRA CORDOBA March-2011 Male 61 Urine H No.2 1/83 ECO-8 HOC BA CITY May-2011 Male 87 Urine I No.8 2/83; 102 ECO-9 VIR BA CITY May-2011 Female ND Tracheal aspirate J c CTX-M-1/15 Tn4401a 2/91; 135 ECO-10 FAV BA CITY May-2011 Female 44 Urine K No.8 3/83; 86; 140 ECO-11 PEN BA CITY April-2011 Male ND Rectal screening A Tn4401a 2/101; 135 ECO-12 PEN BA CITY June-2011 Female ND Rectal screening A Tn4401a 2/101; 135 ECO-13 HIM CORDOBA June-2011 Female 17 Purulent collection of ileostomy L No.3 1/75 ECO-14 CSF BA CITY September-2011 Female ND Rectal screening M No.14 2/<48.5; 145 ECO-15 HOA BA October-2011 Male 71 Mini bronchoalveolar N c CTX-M-1/15 Tn4401a 1/201 lavage fluid ECO-16 ANC BA CITY February-2012 Female 60 Rectal screening O Tn4401a 2/55; 97 ECO-17 CMM BA April-2012 ND ND Abdominal drainage NT CTX-M-8/25 Tn4401a nd ECO-18 HDB BA August-2012 Male 45 Abdominal drainage P Tn4401a 3/85; 104; 121 ECO-19 HJP CHACO September-2012 Male ND Abdominal drainage Q No.2 2/60; 91 ECO-20 COS BA CITY November-2012 Male ND Rectal screening R CTX-M-9/14 Tn4401a 4/52; 83; 104; 158 ECO-21 ITA BA CITY March-2013 Female 84 Feces S Tn4401a 3/<48.5; 55; 80 ECO-22 ALV BA CITY April-2013 Male ND Rectal screening T CTX-M-8/25 Tn4401a 5/<<48.5; <48.5; 66; 145; 199 ECO-23 ITA BA CITY July-2013 Male 79 Feces U CTX-M-1/15 No.8 3/83; 91; 194 ECO-24 HOB BA CITY August-2013 ND ND Abdominal drainage V Tn4401a 3/62; 130; 255 ECO-25 MIT BA CITY September-2013 Male 32 Bone W Tn4401a 2/80; 178 ECO-26 GUT BA CITY October-2013 Male 5 Retroculture X No.2 3/<48.5; 91; 154 ECO-27 JAF BA CITY January-2014 Male 50 ND Y No.8 3/<48.5; 66; 158 ECO-28 ITA BA CITY March-2014 Male 90 Urine J c CTX-M-1/15 Tn4401a 1/102 ECO-29 DUR BA CITY June-2014 ND 56 Abdominal drainage H No.8 1/83 KOX-1 EVI BA August-2011 Female 5 m Blood E No.2 2/90; 196 KOX-2 POS BA September-2011 Male 9 Retroculture G No.6 4/<48.5; 145; 160; 437 KOX-3 EVI BA November-2012 Male 58 Lymph node biopsy F No.2 3/59; 135; 185 KOX-4 VIR BA CITY Dec-2010 Female 84 Blood K CTX-M-2 No.2 4/<48.5; 145; 129; 310 KOX-5 IFL BA CITY April-2011 Male 82 Rectal screening L PER-2 No.2 3/80; 182; 214 KOX-6 ITA BA CITY August-2011 Male 25 Abdominal drainage A No.2 4/48.5; 59; 129; 176 KOX-7 GUT BA CITY October-2012 Male 3 m Urine B No. 3/150; 199; 299 KOX-8 COS BA CITY November-2012 Male 38 Blood C PER-2 No.2 2/170; 310 KOX-9 GUT BA CITY November-2012 Female 17 m Urine R No.2 2/<48.5; 188 KOX-10 GUT BA CITY October-2013 Female 4 Retroculture G No.6 6/<48.5; 59; 150; 185; 349; 360 KOX-11 GUT BA CITY November-2013 Male 5 cc M PER-2 No.2 3/60; 129; 340 KOX-12 JAF BA CITY Jan-2014 ND ND Dialisis water N PER-2 No.2 4/<48.5; <48.5; 150; 340 KOX-13 ITA BA CITY February-2014 Male 2 m Articular joint fluid O No.10 2/60; 145 KOX-14 HSR CORDOBA October-2010 ND ND Retroculture D No.2 3/59; 145; 373 KOX-15 HIM CORDOBA January-2011 Male 7 Blood D No.2 2/145; 340 KOX-16 HIM CORDOBA July-2011 Male 1 Blood D No.2 3/59; 145; 340 KOX-17 HMU CORDOBA May-2012 Male 52 Skin and soft tissue H PER-2 No.2 4/59; 110; 145; 209 KOX-18 JP2 CORRIENTES December-2013 Male 5 Blood P No.2 4/<48.5; 49; 86; 196 KOX-19 HJP CHACO November-2012 Female ND Urine J PER-2 No.2 4/<48.5; 59; 114; 310 KOX-20 H09 MENDOZA May-2011 ND ND ND A CTX-M-2 No.2 5/48.5; 59; 129; 145; 176 KOX-21 HAC RIO NEGRO October-2013 Female 43 Blood Q PER-2 No.2 3/<48.5; 90; 340 KOX-22 LPT TUCUMAN December-2010 Male ND Urine I No.2 1/237 CFR-1 EVI BA December-2012 Male 72 Drainage G No.2 3/59; 97; 261 CFR-2 ALV BA CITY November-2010 Male ND Urine E No.2 3/52; 62; 108 CFR-3 HVS BA CITY April-2012 Male ND Skin and soft tissue M No.2 1/48.5 CFR-4 ITAL BA CITY October-2012 Male 73 Blood F No. 2/57; 69 CFR-5 GUT BA CITY November-2012 Female ND ND D No. 2/291; 368 CFR-6 GUT BA CITY December-2013 Female ND ND D No. 2/97; 284 CFR-7 ALV BA CITY June-2013 Female ND Urine E PER-2 No. 2/66; 322 CFR-8 ALV BA CITY June-2013 Male 72 Retroculture E No.13 2/66; 291 CFR-9 ALV BA CITY June-2013 Male ND Urine E PER-2 No.13 2/66; 322 CFR-10 GUT BA CITY October-2012 Male 12 Rectal screening D No.5 3/97; 252; 274 CFR-11 GUT BA CITY April-2013 Male 3 Rectal screening D No.2 3/104; 252; 284 CFR-12 HSP CHACO August-2010 Female 50 Skin and soft tissue L No.2 2/48.5; 170 CFR-13 HJP CHACO June-2013 Male ND Skin and soft tissue L No.2 2/<48.5; 194 CFR-14 HSR CORDOBA June-2011 Female 37 Urine H No. 4/<48.5; 48.5; 68; 97; 136; 174 CFR-15 HSR CORDOBA November-2011 Male 61 Urine H No. 5/64; 91; 130; 165 CFR-16 NSM CORDOBA January-2012 Male 56 Blood I No.2 5/64; 91; 130; 267 CFR-17 HMU CORDOBA May-2012 Male 52 Skin and soft tissue N PER-2 No.2 2/55; 173 CFR-18 HPS JUJUY April-2013 Male 49 Urine O CTX-M-2 No. 4/48.5; 58; 97; 123 CFR-19 H09 MENDOZA September-2010 ND ND ND J No.2 5/<48.5; 60; 97; 145; 300 (continued)

5 Specie ID a Supplementary Table S1. (Continued) HTAL. code Province Date Sex Age Sample PFGE type bla KPC genetic environment c No. of plasmids/mw (Kb) ESBLs b CFR-20 NJT TUCUMAN August-2012 Male 3 m Catheter K CTX-M-1/15, PER-2 SMA-1 PBA BA CITY June-2010 ND ND Urine E No. 2/<48.5; SMA-2 UOM BA CITY April-2012 Male 43 Abdominal drainage C No.2 2/48.5; 79.5 SMA-3 UOM BA CITY September-2012 Male 31 Abdominal drainage C CTX-M-2 No.2 3/48.5; 79.5; 254 SMA-4 FLE BA CITY September-2012 Female ND Blood F No.7 1/79.5 SMA-5 COS BA CITY Jan-2013 Female ND Blood G No.2 2/<48.5; 48.5 SMA-6 COS BA January-2013 Male ND ND G No.2 1/48.5 No.9 5/48.5; 100; 145; 215; 300 SMA-7 PIR BA CITY November-2013 Male 17 Mini bronchoalveolar lavage fluid D Tn4401a 1/79.5 SMA-8 SAS BA CITY January-2014 Male 41 Cerebrospinal fluid K No.2 1/<48 SMA-9 CEN BA September-2010 Female 20 Blood H No.2 2/<48.5; 70 SMA-10 SML BA April-2013 Male 65 Tracheal aspirate I Tn4401a 1/57 SMA-11 H09 MENDOZA February-2013 ND ND Blood A CTX-M-9/14 No.2 2/<48; SMA-12 H09 MENDOZA February-2013 ND ND Blood A CTX-M-9/14 No.12 2/<48.5; 296 SMA-13 H09 MENDOZA February-2013 ND ND Blood A CTX-M-9/14 No.12 2/<48.5; 296 SMA-14 H09 MENDOZA February-2013 ND ND Blood A CTX-M-9/14 No. 3/<48.5; 70; 296 SMA-15 HRA CORDOBA May-2011 Male ND Blood B No.2 2/70; 333 SMA-16 HRA CORDOBA September-2012 Female 38 Urine B No.11 3/70; 333; 369 SMA-17 HRA CORDOBA September-2012 Female 58 Blood B No.2 2/70; 333 SMA-18 VSW CORDOBA September-2012 Male 46 Abdominal abscess J PER-2 No.2 2/<48.5; 48.5 a The isolates were listed and therefore numbered consecutively as they appear in Supplementary Fig. S1 (PFGE-S1 nuclease assay). b ESBLs were screened by polymerase chain reaction as explained in Materials and Methods section. c Isolates confirmed as Escherichia coli ST131. HTAL., hospital; Date, month, and year in which the isolate was obtained; BA, Buenos Aires; BA City, Buenos Aires City; PFGE, pulsedfield gel electrophoresis; ND, not determined; nt, non-typeable.

6 Supplementary Table S2. List of Primers Used in the Study Primer name Nucleotide sequence Refs. CTX-MU1 ATGTGCAGYACCAGTAARGT Pagani et al. 1 CTX-MU2 TGGGTRAARTARGTSACCAGA Pagani et al. 1 CTX-F GCCGCTCAATGTTAACGGTGA Melano et al. 2 CTX-R ACCGTGGGTTACGATTTTCGC Melano et al. 2 CTXM8/25G-F CTGGAGAAAAGCAGCGGGGG This work CTXM8/25G-R CGCTGCCGGTTTTATCCCCGAC This work CTXM9G-F ATGGTGACAAAGAGAGTGCAACG This work CTXM9G-R GCGGCTGGGTAAAATAGGTCACC This work CTXM1/15G-F CAGTTCACGCTGATGGCGACG This work CTXM1/15G-R CGGCGCACGATCTTTTGGCCA This work PER-1-578F GGCCTGACGATCTGGAACCTT This work PER-6F GCCCTGATGATCTGGAGCCTT This work PER-U1-8R TAACCGCTsTGGTCCTGTGGT This work PER-2-PLUS GTA GTA TCA GCC CAA TCC CC Melano et al. 2 PER-2-MINUS CCA ATA AAG GCC GTC CAT CA Melano et al. 2 rfb.1bis mplx ATACCGACGACGCCGATCTG Blanco, et al. 3 rfbo25b.r mplx TGCTATTCATTATGCGCAGC Blanco, et al. 3 1 Pagani, L., E. Dell Amico, R. Migliavacca, M.M. D Andrea, E. Giacobone, G. Amicosante, E. Romero, and G.M. Rossolini Multiple CTX-M-type extended-spectrum b-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J. Clin. Microbiol. 41: Melano, R., A. Corso, A. Petroni, D. Centrón, B. Orman, A. Pereyra, N. Moreno, and M. Galas Multiple antibiotic-resistance mechanisms including a novel combination of extended-spectrum beta-lactamases in a Klebsiella pneumoniae clinical strain isolated in Argentina. J Antimicrob. Chemother. 52: Blanco, M., M.P. Alonso, M.H. Nicolas-Chanoine, G. Dahbi, A. Mora, J.E. Blanco, C. López, P. Cortés, M. Llagostera, V. Leflon- Guibout, B. Puentes, R. Mamani, A. Herrera, M.A. Coira, F. García-Garrote, J.M. Pita, and J. Blanco Molecular epidemiology of Escherichia coli producing extended-spectrum b-lactamases in Lugo (Spain): dissemination of clone O25b:H4-ST131 producing CTX-M- 15. J. Antimicrob. Chemother. 63:

Received 31 January 2011/Returned for modification 2 March 2011/Accepted 15 March 2011

Received 31 January 2011/Returned for modification 2 March 2011/Accepted 15 March 2011 JOURNAL OF CLINICAL MICROBIOLOGY, May 2011, p. 1965 1969 Vol. 49, No. 5 0095-1137/11/$12.00 doi:10.1128/jcm.00203-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Comparative

More information

ST11 KPC-2 Klebsiella pneumoniae detected in Taiwan

ST11 KPC-2 Klebsiella pneumoniae detected in Taiwan AAC Accepts, published online ahead of print on 30 January 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.05576-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5

More information

#Corresponding author: Pathology Department, Singapore General Hospital, 20 College. Road, Academia, Level 7, Diagnostics Tower, , Singapore

#Corresponding author: Pathology Department, Singapore General Hospital, 20 College. Road, Academia, Level 7, Diagnostics Tower, , Singapore AAC Accepts, published online ahead of print on 21 October 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01754-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 Title: Escherichia

More information

Spread of carbapenems resistant Enterobacteriaceae in South Africa; report from National Antimicrobial Resistance Reference Laboratory

Spread of carbapenems resistant Enterobacteriaceae in South Africa; report from National Antimicrobial Resistance Reference Laboratory Spread of carbapenems resistant Enterobacteriaceae in South Africa; report from National Antimicrobial Resistance Reference Laboratory Olga Perovic*, Ashika Singh-Moodley, Samantha Iyaloo 5 th November

More information

bla TEM bla CTX-M محمد مرتضي اردوني Extended-spectrum beta-lactamases ESBL Avian pathogenic Escherichia coli ESBLs (ESBLs)

bla TEM bla CTX-M محمد مرتضي اردوني Extended-spectrum beta-lactamases ESBL Avian pathogenic Escherichia coli ESBLs (ESBLs) bla bla -M 2 محمد مرتضي اردوني () -M ESBL bla bla -M -M bla bla -M Extended-spectrum beta-lactamases ESBL bla bla -M Avian pathogenic AEC Escherichia coli پست الکترونيک نويسندهي مسؤول: mjahantig@yahoo.com

More information

Determining the Optimal Carbapenem MIC that Distinguishes Carbapenemase-Producing

Determining the Optimal Carbapenem MIC that Distinguishes Carbapenemase-Producing AAC Accepted Manuscript Posted Online 8 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.00838-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 1 2 Determining the

More information

PROFESSOR PETER M. HAWKEY

PROFESSOR PETER M. HAWKEY Multi-drug resistant Escherichia coli PROFESSOR PETER M. HAWKEY School of Immunity and Infection College of Medical and Dental Sciences University of Birmingham Birmingham B15 2TT Health Protection Agency

More information

Carbapenemases in Enterobacteriaceae: Prof P. Nordmann Bicêtre hospital, South-Paris Med School

Carbapenemases in Enterobacteriaceae: Prof P. Nordmann Bicêtre hospital, South-Paris Med School Carbapenemases in Enterobacteriaceae: 2012 Prof P. Nordmann Bicêtre hospital, South-Paris Med School March 21, 2012 Trends in Molecular Medecine NDM IMP OXA-48 KPC VIM ALERT VI M KPC KPC NDM I MP OXA-

More information

Emergence of carbapenemase-producing Enterobacteriaceae in France, 2004 to 2011.

Emergence of carbapenemase-producing Enterobacteriaceae in France, 2004 to 2011. Emergence of carbapenemase-producing Enterobacteriaceae in France, 2004 to 2011. Sophie Vaux, Anne Carbonne, Jean-Michel Thiolet, Vincent Jarlier, Bruno Coignard, the RAISIN and Expert Laboratories Group

More information

Klebsiella pneumoniae 21 PCR

Klebsiella pneumoniae 21 PCR 2011 11 TEM-132 ESBL Klebsiella pneumoniae 1) 2) 1) 1) 3) 2) 1) 2) 3) 19 6 27 22 10 20 2003 4 2004 11 95 ceftazidime (CAZ) Klebsiella pneumoniae 21 PCR b- (ESBL) PCR (PFGE) PCR bla TEM-132 PFGE 19 TEM-132

More information

Emergence of non-kpc carbapenemases: NDM and more

Emergence of non-kpc carbapenemases: NDM and more Emergence of non-kpc carbapenemases: NDM and more --- David Livermore Health Protection Agency, UK The first acquired carbapenemase to be recognised in gram-negative bacteria was IMP-1, a metallo-type,

More information

Clin Microbiol Infect Feb;21(2):e11-3. doi: /j.cmi Epub 2014 Oct 29.

Clin Microbiol Infect Feb;21(2):e11-3. doi: /j.cmi Epub 2014 Oct 29. This Accepted Author Manuscript (AAM) is copyrighted and published by Elsevier. It is posted here by agreement between Elsevier and the University of Turin. Changes resulting from the publishing process

More information

ALERT. Clinical microbiology considerations related to the emergence of. New Delhi metallo beta lactamases (NDM 1) and Klebsiella

ALERT. Clinical microbiology considerations related to the emergence of. New Delhi metallo beta lactamases (NDM 1) and Klebsiella ALERT Clinical microbiology considerations related to the emergence of New Delhi metallo beta lactamases (NDM 1) and Klebsiella pneumoniae carbapenemases (KPC) amongst hospitalized patients in South Africa

More information

Rate of Transmission of Extended-Spectrum

Rate of Transmission of Extended-Spectrum MAJOR ARTICLE Rate of Transmission of Extended-Spectrum Beta-Lactamase Producing Enterobacteriaceae Without Contact Isolation Sarah Tschudin-Sutter, 1 Reno Frei, 2 Marc Dangel, 1 Anne Stranden, 1 and Andreas

More information

Impact of Extended Spectrum Beta-Lactamase Producing Klebsiella pneumoniae Infections in Severely Burned Patients

Impact of Extended Spectrum Beta-Lactamase Producing Klebsiella pneumoniae Infections in Severely Burned Patients Impact of Extended Spectrum Beta-Lactamase Producing Klebsiella pneumoniae Infections in Severely Burned Patients Jason W Bennett, MD, MSPH, Janelle L Robertson, MD, Duane R Hospenthal, MD, PhD, Steven

More information

Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); July 2014.

Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); July 2014. Annual survey of extended-spectrum -lactamase (ESBL)-producing Enterobacteriaceae, 2013 Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research

More information

KPC around the world Maria Virginia Villegas, MD, MSC

KPC around the world Maria Virginia Villegas, MD, MSC KPC around the world Maria Virginia Villegas, MD, MSC Scientific Director Bacterial Resistance and Nosocomial Infections Research Area International Center for Medical Research and Training, CIDEIM, Cali,

More information

A new diagnostic microarray (Check-KPC ESBL) for detection and. identification of extended-spectrum beta-lactamases in highly resistant

A new diagnostic microarray (Check-KPC ESBL) for detection and. identification of extended-spectrum beta-lactamases in highly resistant JCM Accepts, published online ahead of print on 8 June 2011 J. Clin. Microbiol. doi:10.1128/jcm.02087-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Epidemiology of the β-lactamase resistome among Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae in the Chicago region

Epidemiology of the β-lactamase resistome among Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae in the Chicago region Epidemiology of the β-lactamase resistome among Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae in the Chicago region Michael Y. Lin MD MPH 1, Karen Lolans BS 1, Rosie D. Lyles,

More information

Revised AAC Version 2» New-Data Letter to the Editor ACCEPTED. Plasmid-Mediated Carbapenem-Hydrolyzing β-lactamase KPC-2 in

Revised AAC Version 2» New-Data Letter to the Editor ACCEPTED. Plasmid-Mediated Carbapenem-Hydrolyzing β-lactamase KPC-2 in AAC Accepts, published online ahead of print on 3 December 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.01180-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

High diversity of extended-spectrum b-lactamases among clinical isolates of Enterobacteriaceae from Portugal

High diversity of extended-spectrum b-lactamases among clinical isolates of Enterobacteriaceae from Portugal Journal of Antimicrobial Chemotherapy Advance Access published October 3, 2007 Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dkm381 High diversity of extended-spectrum b-lactamases among clinical

More information

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material and Methods Characterization of isolates by the

More information

International transfer of NDM-1-producing Klebsiella. pneumoniae from Iraq to France

International transfer of NDM-1-producing Klebsiella. pneumoniae from Iraq to France AAC Accepts, published online ahead of print on 18 January 2011 Antimicrob. Agents Chemother. doi:10.1128/aac.01761-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

AAC Accepts, published online ahead of print on 13 October 2008 Antimicrob. Agents Chemother. doi: /aac

AAC Accepts, published online ahead of print on 13 October 2008 Antimicrob. Agents Chemother. doi: /aac AAC Accepts, published online ahead of print on 13 October 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.00931-08 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Detection of NDM-1, VIM-1, KPC, OXA-48, and OXA-162 carbapenemases by MALDI- TOF mass spectrometry

Detection of NDM-1, VIM-1, KPC, OXA-48, and OXA-162 carbapenemases by MALDI- TOF mass spectrometry JCM Accepts, published online ahead of print on 2 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.01002-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12

More information

Navigating Through Current and Emerging Issues in Outbreaks

Navigating Through Current and Emerging Issues in Outbreaks Navigating Through Current and Emerging Issues in Outbreaks 7th GCC Conference on Infection Prevention and Control December 1-3, 2013 Kuwait City, Kuwait William R. Jarvis, M.D. Jason and Jarvis Associates,

More information

Sensitive Screening Tests for Suspected Class A Carbapenemase Production in Species of Enterobacteriaceae

Sensitive Screening Tests for Suspected Class A Carbapenemase Production in Species of Enterobacteriaceae JOURNAL OF CLINICAL MICROBIOLOGY, June 2009, p. 1631 1639 Vol. 47, No. 6 0095-1137/09/$08.00 0 doi:10.1128/jcm.00130-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Sensitive

More information

The Public Health Benefit of CRE Colonization Testing

The Public Health Benefit of CRE Colonization Testing The Public Health Benefit of CRE Colonization Testing Allison C Brown, PhD MPH Team Lead, AR Capacities and Special Studies Division of Healthcare Quality Promotion CDC Carbapenem Resistance Serious threat

More information

Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test

Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test Published in which should be cited to refer to this work. Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test Carbapenem

More information

Discussion points CLSI M100 S19 Update. #1 format of tables has changed. #2 non susceptible category

Discussion points CLSI M100 S19 Update. #1 format of tables has changed. #2 non susceptible category Discussion points 2009 CLSI M100 S19 Update Nebraska Public Health Laboratory Changes most important to routine antimicrobial susceptibility testing. Documents available Janet Hindler discussion slide

More information

Emerging Mechanisms of Resistance in Gram (-) Bacteria: Plasmid-Mediated MCR-1 and Fosfomycin Resistance

Emerging Mechanisms of Resistance in Gram (-) Bacteria: Plasmid-Mediated MCR-1 and Fosfomycin Resistance Emerging Mechanisms of Resistance in Gram (-) Bacteria: Plasmid-Mediated MCR-1 and Fosfomycin Resistance Yohei Doi, MD, PhD Division of Infectious Diseases University of Pittsburgh School of Medicine Colistin

More information

Enterobacteriaceae in Bamako, Mali. Laboratoire de Bactériologie-Virologie-Hygiène Hospitalière, CHU Reims, UFR Médecine

Enterobacteriaceae in Bamako, Mali. Laboratoire de Bactériologie-Virologie-Hygiène Hospitalière, CHU Reims, UFR Médecine AAC Accepts, published online ahead of print on 31 August 2009 Antimicrob. Agents Chemother. doi:10.1128/aac.00675-09 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Abstract. a Jann-Tay Wang 1, Un-In Wu 2, Tsai-Ling Yang Lauderdale 3, Mei-Chen Chen 3, Shu-Ying Li 4, Le-Yin Hsu 5, Shan-Chwen Chang 1,6 *

Abstract. a Jann-Tay Wang 1, Un-In Wu 2, Tsai-Ling Yang Lauderdale 3, Mei-Chen Chen 3, Shu-Ying Li 4, Le-Yin Hsu 5, Shan-Chwen Chang 1,6 * RESEARCH ARTICLE Carbapenem-Nonsusceptible Enterobacteriaceae in Taiwan Jann-Tay Wang 1, Un-In Wu 2, Tsai-Ling Yang Lauderdale 3, Mei-Chen Chen 3, Shu-Ying Li 4, Le-Yin Hsu 5, Shan-Chwen Chang 1,6 * 1

More information

suspected KPC and other carbapenemase producers among species of Nacional de Enfermedades Infecciosas (INEI)- ANLIS Dr. Carlos G.

suspected KPC and other carbapenemase producers among species of Nacional de Enfermedades Infecciosas (INEI)- ANLIS Dr. Carlos G. JCM Accepts, published online ahead of print on 1 December 0 J. Clin. Microbiol. doi:./jcm.0- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Carbapenem Disks on MacConkey agar as screening methods for the detection of. Carbapenem-Resistant Gram negative rods in stools.

Carbapenem Disks on MacConkey agar as screening methods for the detection of. Carbapenem-Resistant Gram negative rods in stools. JCM Accepts, published online ahead of print on 7 November 2012 J. Clin. Microbiol. doi:10.1128/jcm.02878-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Carbapenem Disks

More information

Sensitive and specific Modified Hodge Test for KPC and metallo-beta-lactamase

Sensitive and specific Modified Hodge Test for KPC and metallo-beta-lactamase JCM Accepts, published online ahead of print on 19 October 2011 J. Clin. Microbiol. doi:10.1128/jcm.05602-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All

More information

The Year in Infection Control

The Year in Infection Control The Year in Infection Control Andie Lee Departments of Infectious Diseases and Microbiology Royal Prince Alfred Hospital Sydney, Australia 1 1.223 million Pubmed publications last 12 months 2 Selection

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

Overcoming the PosESBLities of Enterobacteriaceae Resistance

Overcoming the PosESBLities of Enterobacteriaceae Resistance Overcoming the PosESBLities of Enterobacteriaceae Resistance Review of current treatment options Jamie Reed, PharmD Pharmacy Grand Rounds August 28, 2018 Rochester, MN 2018 MFMER slide-1 Disclosure No

More information

jmb Research Article Review Semi Kim 1, Ji Youn Sung 2, Hye Hyun Cho 3, Kye Chul Kwon 1, and Sun Hoe Koo 1 *

jmb Research Article Review Semi Kim 1, Ji Youn Sung 2, Hye Hyun Cho 3, Kye Chul Kwon 1, and Sun Hoe Koo 1 * J. Microbiol. Biotechnol. (2014), 24(6), 765 770 http://dx.doi.org/10.4014/jmb.1306.06036 Review Research Article jmb Characterization of CTX-M-14- and CTX-M-15-Producing Escherichia coli and Klebsiella

More information

Strain-specific transmission in an outbreak of ESBL-producing Enterobacteriaceae in the hemato-oncology care unit: a cohort study

Strain-specific transmission in an outbreak of ESBL-producing Enterobacteriaceae in the hemato-oncology care unit: a cohort study Uemura et al. BMC Infectious Diseases (2017) 17:26 DOI 10.1186/s12879-016-2144-4 RESEARCH ARTICLE Open Access Strain-specific transmission in an outbreak of ESBL-producing Enterobacteriaceae in the hemato-oncology

More information

Screening and detection of carbapenemases

Screening and detection of carbapenemases Screening and detection of carbapenemases For many isolates with carbapenemases the MICs of carbapenems are around the susceptible breakpoint making resistance difficult to detect - particularly with automated

More information

Sepsis Treatment: Early Identification Remains the Key Issue

Sepsis Treatment: Early Identification Remains the Key Issue Sepsis Treatment: Early Identification Remains the Key Issue Marin H. Kollef, MD Professor of Medicine Washington University School of Medicine Director, Medical Critical Care Director, Respiratory Care

More information

Title: Detection of OXA-48 carbapenemase in the pandemic clone Escherichia coli O25b:H4-

Title: Detection of OXA-48 carbapenemase in the pandemic clone Escherichia coli O25b:H4- AAC Accepts, published online ahead of print on 7 May 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.00638-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Title: Detection

More information

Update on CLSI and EUCAST

Update on CLSI and EUCAST Update on CLSI and EUCAST 1 Completed work» Cephalosporin breakpoints for Enterobacteriaceae ESBL screens MIC versus resistance mechanism» Carbapenem breakpoints for Enterobacteriaceae Modified Hodge Test»

More information

Controlling the false positive results of the Hodge and Masuda assays for class A. carbapenemase detection in species of Enterobacteriaceae

Controlling the false positive results of the Hodge and Masuda assays for class A. carbapenemase detection in species of Enterobacteriaceae JCM Accepts, published online ahead of print on February 0 J. Clin. Microbiol. doi:./jcm.0-0 Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Keywords: Carbapenem-resistant; Klebsiella pneumoniae; Micronet; surveillance systems; infection control

Keywords: Carbapenem-resistant; Klebsiella pneumoniae; Micronet; surveillance systems; infection control Title: Carbapenem non-susceptible Klebsiella pneumoniae Authors: Rocchetti A.; 1 Type: Original Article Keywords: Carbapenem-resistant; Klebsiella pneumoniae; Micronet; surveillance systems; infection

More information

The Carbapenemase Producing Enterobacteriaceae (CPE) Epidemic Why it matters? What it is? What Can You Do About It?

The Carbapenemase Producing Enterobacteriaceae (CPE) Epidemic Why it matters? What it is? What Can You Do About It? The Carbapenemase Producing Enterobacteriaceae (CPE) Epidemic Why it matters? What it is? What Can You Do About It? Martin Cormican National Lead for Health Care Associated Infection and Antimicrobial

More information

Cefotaxime Rationale for the EUCAST clinical breakpoints, version th September 2010

Cefotaxime Rationale for the EUCAST clinical breakpoints, version th September 2010 Cefotaxime Rationale for the EUCAST clinical breakpoints, version 1.0 26 th September 2010 Foreword EUCAST The European Committee on Antimicrobial Susceptibility Testing (EUCAST) is organised by the European

More information

Emergence of Klebsiella pneumoniae ST258 with KPC-2 in Hong Kong. Title. Ho, PL; Tse, CWS; Lai, EL; Lo, WU; Chow, KH

Emergence of Klebsiella pneumoniae ST258 with KPC-2 in Hong Kong. Title. Ho, PL; Tse, CWS; Lai, EL; Lo, WU; Chow, KH Title Emergence of Klebsiella pneumoniae ST258 with KPC-2 in Hong Kong Author(s) Ho, PL; Tse, CWS; Lai, EL; Lo, WU; Chow, KH Citation International Journal Of Antimicrobial Agents, 2011, v. 37 n. 4, p.

More information

Development of a phenotypic method for fecal carriage detection of OXA-48-producing

Development of a phenotypic method for fecal carriage detection of OXA-48-producing JCM Accepts, published online ahead of print on 11 May 2011 J. Clin. Microbiol. doi:10.1128/jcm.00055-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

(Plasmid mediated) Carbapenemases. Timothy R. Walsh, Cardiff University, Wales

(Plasmid mediated) Carbapenemases. Timothy R. Walsh, Cardiff University, Wales (Plasmid mediated) Carbapenemases Timothy R. Walsh, Cardiff University, Wales What is a carbapenemase? How much carbapenem do they need to breakdown before they are called a carbapenemase? ESBL-enzymes

More information

Evaluation of Six Phenotypic Methods for the Detection of Carbapenemases in Gram-Negative Bacteria With Characterized Resistance Mechanisms

Evaluation of Six Phenotypic Methods for the Detection of Carbapenemases in Gram-Negative Bacteria With Characterized Resistance Mechanisms Original Article Clinical Microbiology Ann Lab Med 2017;37:305-312 https://doi.org/10.3343/alm.2017.37.4.305 ISSN 2234-3806 eissn 2234-3814 Evaluation of Six Phenotypic Methods for the Detection of Carbapenemases

More information

1. Department of Medical Microbiology and Infectious Disease, Division of Infection and Immunity, Cardiff University, Cardiff CF14 4XN, UK

1. Department of Medical Microbiology and Infectious Disease, Division of Infection and Immunity, Cardiff University, Cardiff CF14 4XN, UK AAC Accepted Manuscript Posted Online 5 March 2018 Antimicrob. Agents Chemother. doi:10.1128/aac.02642-17 Copyright 2018 Yang et al. This is an open-access article distributed under the terms of the Creative

More information

Enterobacteriaceae with acquired carbapenemases, 2016

Enterobacteriaceae with acquired carbapenemases, 2016 Enterobacteriaceae with acquired carbapenemases, 2016 Background The acquired or transferable (as opposed to chromosomally encoded) carbapenemases found in Enterobacteriaceae belong to three of the four

More information

Prevalence of Extended Spectrum -Lactamases In E.coli and Klebsiella spp. in a Tertiary Care Hospital

Prevalence of Extended Spectrum -Lactamases In E.coli and Klebsiella spp. in a Tertiary Care Hospital ISSN: 2319-7706 Volume 3 Number 10 (2014) pp. 474-478 http://www.ijcmas.com Original Research Article Prevalence of Extended Spectrum -Lactamases In E.coli and Klebsiella spp. in a Tertiary Care Hospital

More information

Faecal carriage of ESBL-producing Enterobacteriaceae and carbapenemresistant Gram-negative bacilli in community settings

Faecal carriage of ESBL-producing Enterobacteriaceae and carbapenemresistant Gram-negative bacilli in community settings Brief Original Article Faecal carriage of ESBL-producing Enterobacteriaceae and carbapenemresistant Gram-negative bacilli in community settings Hugo Edgardo Villar, Marisa Noemí Baserni, Monica Beatriz

More information

Isolation and Characterization of Potentially Pathogenic Antimicrobial-Resistant Escherichia coli Strains from Chicken and Pig Farms in Spain

Isolation and Characterization of Potentially Pathogenic Antimicrobial-Resistant Escherichia coli Strains from Chicken and Pig Farms in Spain APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2010, p. 2799 2805 Vol. 76, No. 9 0099-2240/10/$12.00 doi:10.1128/aem.02421-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Isolation

More information

Under the radar. Two prolonged outbreaks of carbapenemase-producing Enterobacteriaceae (CPE) at a tertiary hospital in Canberra, Australia

Under the radar. Two prolonged outbreaks of carbapenemase-producing Enterobacteriaceae (CPE) at a tertiary hospital in Canberra, Australia Under the radar Two prolonged outbreaks of carbapenemase-producing Enterobacteriaceae (CPE) at a tertiary hospital in Canberra, ustralia lexandra armor, Kathryn Daveson, Karina Kennedy & David Harley No

More information

Sep Oct Nov Dec Total

Sep Oct Nov Dec Total LB PAGE 2 LB PAGE 3 Sep Oct Nov Dec 2007 2007 2007 2007 Total Repeat Information Total Repeats 35 15 17 9 76 Repeat Rate 6.01% 0.17% 1.12% 0.39% 2.07% Repeat Chemistry 25 0 2 0 27 Repeat Extraction 1 0

More information

9/7/2017. If You Did This Today You Probably Got Poo On Your Hands Do You Know How to Get it Off! The Tongue Twister & The Pantomine TITLE

9/7/2017. If You Did This Today You Probably Got Poo On Your Hands Do You Know How to Get it Off! The Tongue Twister & The Pantomine TITLE TITLE Martin Cormican National Lead for Health Care Associated Infection and Antimicrobial Resistance hcainational.lead@hse.ie If You Did This Today You Probably Got Poo On Your Hands Do You Know How to

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

In Vitro Activity of Ceftazidime-Avibactam Against Isolates. in a Phase 3 Open-label Clinical Trial for Complicated

In Vitro Activity of Ceftazidime-Avibactam Against Isolates. in a Phase 3 Open-label Clinical Trial for Complicated AAC Accepted Manuscript Posted Online 21 November 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01820-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10

More information

In Vitro Susceptibility Pattern of Cephalosporin- Resistant Gram-Negative Bacteria

In Vitro Susceptibility Pattern of Cephalosporin- Resistant Gram-Negative Bacteria In Vitro Susceptibility Pattern of Cephalosporin- Resistant Gram-Negative Bacteria Warunee Punpanich MD*, Worraporn Tantichattanon MD**, Siriporn Wongwatcharapaiboon MD**, Vipa Treeratweeraphong BSc, MSc***

More information

Molecular characterisation of CTX-M-type extendedspectrum β-lactamases of Escherichia coli isolated from a Portuguese University Hospital

Molecular characterisation of CTX-M-type extendedspectrum β-lactamases of Escherichia coli isolated from a Portuguese University Hospital EJHP Science Volume 17 2011 Issue 3 P. 1-5 2011 Pharma Publishing and Media Europe. All rights reserved 1781-7595 25 www.ejhp.eu Molecular characterisation of CTX-M-type extendedspectrum β-lactamases of

More information

Detection of the KPC-2 Carbapenem-Hydrolyzing Enzyme in Clinical Isolates of ACCEPTED

Detection of the KPC-2 Carbapenem-Hydrolyzing Enzyme in Clinical Isolates of ACCEPTED JCM Accepts, published online ahead of print on April 00 J. Clin. Microbiol. doi:./jcm.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

ISF criteria (International sepsis forum consensus conference of infection in the ICU) Secondary peritonitis

ISF criteria (International sepsis forum consensus conference of infection in the ICU) Secondary peritonitis Appendix with supplementary material. This appendix was part of the submitted manuscript and has been peer reviewed. It is posted as supplied by the authors. Supplementary Tables Table S1. Definitions

More information

Detection of NDM-1-producing Klebsiella pneumoniae in Kenya

Detection of NDM-1-producing Klebsiella pneumoniae in Kenya AAC Accepts, published online ahead of print on 29 November 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.01247-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Fernando Pasteran, Tania Mendez, Melina Rapoport, Leonor Guerriero, and Alejandra Corso*

Fernando Pasteran, Tania Mendez, Melina Rapoport, Leonor Guerriero, and Alejandra Corso* JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2010, p. 1323 1332 Vol. 48, No. 4 0095-1137/10/$12.00 doi:10.1128/jcm.01771-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Controlling

More information

Molecular Epidemiology, Sequence Types, and Plasmid Analyses of KPC-Producing Klebsiella pneumoniae Strains in Israel

Molecular Epidemiology, Sequence Types, and Plasmid Analyses of KPC-Producing Klebsiella pneumoniae Strains in Israel ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2010, p. 3002 3006 Vol. 54, No. 7 0066-4804/10/$12.00 doi:10.1128/aac.01818-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Molecular

More information

Downloaded from ismj.bpums.ac.ir at 10: on Friday March 8th 2019

Downloaded from ismj.bpums.ac.ir at 10: on Friday March 8th 2019 - ( ) - * :... (MDR) (ESBLs: Extended-Spectrum Beta Lactamases). :.. (CLSI:Clinical and Laboratory Standards Institute). ESBL. combined disk method ESBL : / / / / / B / ( /). / / combined disk method.

More information

β-lactamase inhibitors

β-lactamase inhibitors β-lactamase inhibitors Properties, microbiology & enzymology DAVID M LIVERMORE Professor of Medical Microbiology, UEA Lead on Antibiotic Resistance, Public Health England β-lactamase classes A B C D Serine

More information

Epidemiology of ESBL in hospitals and in the community

Epidemiology of ESBL in hospitals and in the community Epidemiology of ESBL in hospitals and in the community Dietrich Mack Chair of Medical Microbiology and Infectious Diseases The School of Medicine - University of Wales Swansea P R I F Y S G O L C Y M R

More information

BMJ Open. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: A systematic review and meta-analysis.

BMJ Open. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: A systematic review and meta-analysis. Epidemic potential of Escherichia coli ST and Klebsiella pneumoniae ST: A systematic review and meta-analysis. Journal: Manuscript ID bmjopen-- Article Type: Research Date Submitted by the Author: -Sep-

More information

Rapid identification of emerging resistance in Gram negatives. Prof. Patrice Nordmann

Rapid identification of emerging resistance in Gram negatives. Prof. Patrice Nordmann Rapid identification of emerging resistance in Gram negatives Prof. Patrice Nordmann Emerging Resistance threats, CDC USA-2013 Enterobacteriaceae producing extendedspectrum β-lactamases (ESBL) Multi-resistant

More information

Public Health Surveillance for Multi Drug Resistant Organisms in Orange County

Public Health Surveillance for Multi Drug Resistant Organisms in Orange County Public Health Surveillance for Multi Drug Resistant Organisms in Orange County Matt Zahn, MD Medical Director Epidemiology and Assessment Orange County Public Health Antimicrobial Mechanisms of Action

More information

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

More information

Surveillance of Enterococci in Belgium. M. Ieven, K. Loens, B. Jans and H. Goossens

Surveillance of Enterococci in Belgium. M. Ieven, K. Loens, B. Jans and H. Goossens Surveillance of Enterococci in Belgium M. Ieven, K. Loens, B. Jans and H. Goossens Surveillance of Enterococci in Belgium Overview Introduction and epidemiological surveillance Results of isolates received

More information

Laboratory Surveillance for Prospective Plasmid-Mediated AmpC -Lactamases in the Kinki Region of Japan

Laboratory Surveillance for Prospective Plasmid-Mediated AmpC -Lactamases in the Kinki Region of Japan JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2010, p. 3267 3273 Vol. 48, No. 9 0095-1137/10/$12.00 doi:10.1128/jcm.02111-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Laboratory

More information

Expert rules. for Gram-negatives

Expert rules. for Gram-negatives Academic Perspective in Expert rules Emerging Issues of Resistance in Gram-ve Bacteria for Gram-negatives Trevor Winstanley Sheffield Teaching Hospitals Presented on behalf of David Livermore University

More information

Outcome of carbapenem resistant Klebsiella pneumoniae bloodstream infections

Outcome of carbapenem resistant Klebsiella pneumoniae bloodstream infections ORIGINAL ARTICLE BACTERIOLOGY Outcome of carbapenem resistant Klebsiella pneumoniae bloodstream infections D. Ben-David, R. Kordevani, N. Keller, I. Tal, A. Marzel, O. Gal-Mor, Y. Maor and G. Rahav Infectious

More information

Abstract. Introduction. Methods. Editor: R. Canton

Abstract. Introduction. Methods. Editor: R. Canton ORIGINAL ARTICLE BACTERIOLOGY High rate of faecal carriage of extended-spectrum b-lactamase and OXA-48 carbapenemase-producing Enterobacteriaceae at a University hospital in Morocco D. Girlich 1, N. Bouihat

More information

Presence of the KPC carbapenemase gene in Enterobacteriaceae causing bacteremia and its correlation with in vitro carbapenem susceptibility

Presence of the KPC carbapenemase gene in Enterobacteriaceae causing bacteremia and its correlation with in vitro carbapenem susceptibility Washington University School of Medicine Digital Commons@Becker ICTS Faculty Publications Institute of Clinical and Translational Sciences 2009 Presence of the KPC carbapenemase gene in Enterobacteriaceae

More information

Phenotypic Detection Methods of Carbapenemase Production in Enterobacteriaceae

Phenotypic Detection Methods of Carbapenemase Production in Enterobacteriaceae ISSN: 2319-7706 Volume 4 Number 6 (2015) pp. 547-552 http://www.ijcmas.com Original Research Article Phenotypic Detection Methods of Carbapenemase Production in Enterobacteriaceae Sathya Pandurangan 1,

More information

Surveillance of antimicrobial susceptibility of Enterobacteriaceae pathogens isolated from intensive care units and surgical units in Russia

Surveillance of antimicrobial susceptibility of Enterobacteriaceae pathogens isolated from intensive care units and surgical units in Russia Feb. 2016 THE JAPANESE JOURNAL OF ANTIBIOTICS 69 1 41 41 Surveillance of antimicrobial susceptibility of Enterobacteriaceae pathogens isolated from intensive care units and surgical units in Russia IRINA

More information

Differentiation of Carbapenemase producing Enterobacteriaceae by Triple disc Test

Differentiation of Carbapenemase producing Enterobacteriaceae by Triple disc Test Original article: Differentiation of Carbapenemase producing Enterobacteriaceae by Triple disc Test Manish Bansal 1, Nitya Vyas 2, Babita Sharma 3, R.K.Maheshwari 4 1PG Resident, 2 Professor, 3 Assistant

More information

K. Lee, Y. S. Lim, D. Yong, J. H. Yum, and Y. Chong*

K. Lee, Y. S. Lim, D. Yong, J. H. Yum, and Y. Chong* JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2003, p. 4623 4629 Vol. 41, No. 10 0095-1137/03/$08.00 0 DOI: 10.1128/JCM.41.10.4623 4629.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

More information

Carbapenemase Producing Enterobacteriaceae: Screening

Carbapenemase Producing Enterobacteriaceae: Screening Carbapenemase Producing Enterobacteriaceae: Screening Dr David Harvey Consultant Microbiology and Infection Prevention and Control Nov 2015 Aims Is CPE a problem? Does screening have the potential to help?

More information

Faecal carriage of extended-spectrum b-lactamase-producing Escherichia coli: prevalence, risk factors and molecular epidemiology

Faecal carriage of extended-spectrum b-lactamase-producing Escherichia coli: prevalence, risk factors and molecular epidemiology Journal of Antimicrobial Chemotherapy (2008) 62, 1142 1149 doi:10.1093/jac/dkn293 Advance Access publication 18 July 2008 Faecal carriage of extended-spectrum b-lactamase-producing Escherichia coli: prevalence,

More information

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

(DHA-1): Microbiologic and Clinical Implications

(DHA-1): Microbiologic and Clinical Implications AAC Accepts, published online ahead of print on 20 September 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.00083-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

High Rate of Fatal Cases of Pediatric Septicemia Caused by Gram-Negative Bacteria with Extended-Spectrum Beta-Lactamases in Dar es Salaam, Tanzania

High Rate of Fatal Cases of Pediatric Septicemia Caused by Gram-Negative Bacteria with Extended-Spectrum Beta-Lactamases in Dar es Salaam, Tanzania JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2005, p. 745 749 Vol. 43, No. 2 0095-1137/05/$08.00 0 doi:10.1128/jcm.43.2.745 749.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. High

More information

MANAGEMENT OF KLEBSIELLA PNEUMONIAE KPC OUTBREAK IN INTERNAL MEDICINE

MANAGEMENT OF KLEBSIELLA PNEUMONIAE KPC OUTBREAK IN INTERNAL MEDICINE Acta Medica Mediterranea, 2016, 32: 823 MANAGEMENT OF KLEBSIELLA PNEUMONIAE KPC OUTBREAK IN INTERNAL MEDICINE ANDREA BELLODI 1*, LISETTE DEL CORSO 1, SERENA FAVORINI 1, ELISA MOLINARI 1, ERIKA COPPO 2,

More information

Original Article Clinical Microbiology

Original Article Clinical Microbiology Original Article Clinical Microbiology Ann Lab Med 2015;35:212-219 http://dx.doi.org/10.3343/alm.2015.35.2.212 ISSN 2234-3806 eissn 2234-3814 Combined Use of the Modified Hodge Test and Carbapenemase Inhibition

More information

Laboratory testing for carbapenems resistant Enterobacteriacae (CRE)

Laboratory testing for carbapenems resistant Enterobacteriacae (CRE) Laboratory testing for carbapenems resistant Enterobacteriacae (CRE) Olga Perovic, Principal Pathologist, Center for Opportunistic, Tropical and Hospital Infections, Senior lecturer WITS, 9 th March 2013

More information

The role of an AMR reference laboratory

The role of an AMR reference laboratory The role of an AMR reference laboratory Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright Primary purpose: regional AMR threats

More information

REVIEW. Prevalence of extended-spectrum b-lactamases in South America M. V. Villegas 1, J. N. Kattan 1, M. G. Quinteros 2 and J. M.

REVIEW. Prevalence of extended-spectrum b-lactamases in South America M. V. Villegas 1, J. N. Kattan 1, M. G. Quinteros 2 and J. M. REVIEW Prevalence of extended-spectrum b-lactamases in South America M. V. Villegas 1, J. N. Kattan 1, M. G. Quinteros 2 and J. M. Casellas 3 1 International Center for Medical Research and Training (CIDEIM),

More information

Carbapenems and Enterobacteriaceae

Carbapenems and Enterobacteriaceae Title Carbapenems and Enterobacteriaceae Presenter s details NHLS Dr Khine Swe Swe/Han FC Path ( Micro), SA MMed( micro), SA DTMH(Wits univ),sa PDIC(Stellen univ)sa MB,BS(Yangon),Myanmar Pathologist,Consultant/Lecturer,

More information

β- Lactamase Gene carrying Klebsiella pneumoniae and its Clinical Implication

β- Lactamase Gene carrying Klebsiella pneumoniae and its Clinical Implication Prevalence of Carbapenem-Hydrolyzing β- Lactamase Gene carrying Klebsiella pneumoniae and its Clinical Implication David Alcid M.D Balaji Yegneswaran M.D. Wanpen Numsuwan Introduction Klebsiella pneumoniae

More information