Improvement of Human Melanoma Colony Formation in Soft Agar Using Boiled Instead of Autoclaved Agar

Size: px
Start display at page:

Download "Improvement of Human Melanoma Colony Formation in Soft Agar Using Boiled Instead of Autoclaved Agar"

Transcription

1 International Journal of Cell Cloning 1: 8591 (1983) Improvement of Human Melanoma Colony Formation in Soft Agar Using Boiled Instead of Autoclaved Agar Stephen P. Thomson, Mark D. Wright, Frank L. Meyskens, Jr. Department of Internal Medicine and Cancer Center, University of Arizona, Tucson, AZ, USA Key Words. Soft agar. Human melanoma colony Melanoma Clonogenic. graphics. Abstract. The effect of agar sterilized by either boiling or autoclaving on human melanoma colony formation in soft agar was compared using cells from 17 biopsies of metastatic malignant melanoma. The frequency of colony formation was significantly increased for cells grown in boiled agar in 8 samples (47%), unchanged in 8 samples (47%), and decreased in only one sample (6%). There were increases in both cluster and colony formation for the melanomas which had augmented colony formation when grown in boiled agar. There was also qualitative morphological improvement, including rounder, smoother cells and less extracellular debris surrounding the colonies. These data suggest that melanoma colony formation is enhanced when cells are grown in agar which has been sterilized by boiling rather than autoclaving. Introduction Many types of human tumors are grown in clonogenic assays which use agar as a semisolid support [l41. Sterilization of the agar is typically done by autoclaving. Dixon et al. [5] have recently shown that autoclaved agar contains an inhibitor of granulocytemacrophage colony growth. We therefore have compared agar sterilized by autoclaving to agar sterilized by boiling for the support of formation of human melanoma colonies grown from cells obtained from 17 biopsies of melanoma tissue. Quantitative and qualitative improvement in melanoma colony growth was demonstrated. '@ 1983 AlphaMed Press, Inc /83/$2./

2 Thomson/Wright/ Meyskens 86 Materials and Methods Culture Techniques Tumor tissue was obtained by excisional biopsy of subcutaneous nodules from patients with metastatic malignant melanoma in accord with a protocol approved by the University of Arizona Committee on Human Subjects. The tissue was mechanically dissociated into a single cell suspension as described previously [I]; cells were cryopreserved in 1% dimethylsulfoxide in Ham's F1 medium and 1% heatinactivated fetal calf serum (FCS). We have previously described the culture system which is a simplification [l] of the bilayer agar system developed by Hamburger and Salmon [2]. Briefly, the underlayer was 1. ml of.5% agar (Bacto, Difco Lab, Detroit, MI) in Ham's F1 medium which contained 1% FCS, penicillin (1 pg/ml) and streptomycin (1 unitdml). The plating layer contained 5, nucleated cells in 1. ml of.3% agar in the same medium as the underlayer and was supplemented with insulin (1.54 units/ml), glutamine (.45 pg/ml), pyruvate (.34 pg/ml) and mercaptoethanol (.77 mm). The plates were cultured for 1421 days in a humidified 5% COP, 95% air atmosphere at 37 C. In this study colonies were defined as groups of cells greater than, or equal to, 6 pm in diameter while clusters were defined as groups of cells between 3 and 6 pm in diameter. Clusters and colonies were enumerated using the Omnicon FAS I1 (Bausch and Lomb, Rochester, NY) image analysis system [6]. An inverted microscope equipped with a calibrated reticle was used to obtain measurement of the diameters of clusters and colonies. Preparation of Agar Stock 3% agar (Bacto) solutions were prepared by adding.75 g of agar to 25. ml of distilled HzO and sterilized by two different methods to compare their effect on colony formation. The standard method was to autoclave the stock solutions of agar at 121OC and 15 PSI for 2 min, store at 4OC, and boil immediately before use for 2 to 25 min. Alternatively, the stock solution of agar was boiled immediately before use for 2 to 25 min without prior autoclaving. Results and Discussion The frequency of colony formation using agar sterilized by boiling or autoclaving agar was determined using cells from 17 different biopsies of human malignant melanoma (Table I). Cells from eight samples (47%) produced significantly more colonies when boiled rather than autoclaved agar was used. Cells from eight samples (47%) produced similar numbers of colonies in both agars, including 3 samples which did not grow in either condition; only one sample (6%) had fewer colonies using boiled agar. The median increase in colony formation using boiled agar was 66%. We also counted all the clusters and colonies equal to or greater than 3 micrometers in diameter in 4 of the 8 samples which had significant in

3 Improvement of Melanoma Colony Formation 87 Table I. Effect of autoclaved or boiled agar on frequency of melanoma colony formation from 17 biopsies of human melanoma Patient code No. colonies 1 5 pm 76 change pvaluea diameter/plate Autoclaved Boiled *4 81 *44 81 =46A 8146C 81 * A 82*7B f 21b 119f6 57f9 172 f 2 16f3 13f f f f8 25f8 776 f f f f f f4 87 f f f9 2f I 476 f f13 21 k f f f f a Student s ttest; =not significant; p>.5. b Mean k S.E. creases in the frequency of colony formation to determine whether the increase was secondary to more clusters developing into colonies or represented de novo growth. If the effect of boiled agar was only to allow more clusters to develop into colonies without de now growth, one would expect a decrease in the number of clusters with a concomitant increase in the number of colonies. However, the data in Figure 1 show that boiled agar increased the number of both clusters and colonies. For example, if the increase in the number of colonies for patient B (Fig. 1B) was due solely to an increase in the growth of clusters into the colony size class, most of the clusters grown with autoclaved agar (Fig. 1B) would not be present when boiled agar was used. However, many clusters were present when boiled agar was used (Fig. lb), favoring the explanation that the effect of boiled agar was to allow more de novo growth. Further support is provided by the

4 Thornson/ Wright/ Meyskens 88 Fig. 1. Size distribution of clusters and colonies grown using boiled or autoclaved agar. The dashed line is at a diameter of 6 micrometers and by our definition divides clusters and colonies. Patient A (No ), B (No A), C (No ), and D (No ) observation that boiled agar did not increase the size of colonies formed (Fig. 1AD), a result one would expect if the only effect of boiled agar was to increase the size of groups of cells once they started to'proliferate. These results favor the explanation that the effect of boiled agar was to allow more de novo growth of cells into clusters and colonies rather than to increase the size of clusters after they have begun to proliferate. There were also qualitative morphological differences between the colonies formed in boiled or autoclaved agar. These qualitative differences were noted in 4 of the 8 samples which had quantitative increases in colony formation. The colonies formed in boiled agar typically contained cells that were very smooth edged and rounded (Fig. 2A) while the colonies which formed in autoclaved agar usually contained cells that were ir

5 Improvement of Melanoma Colony Formation 89 Fig. 2. Qualitative morphological differences between colonies formed in boiled and autoclaved agar. Patient No (A) Note the rounded, smoothedged cells and the lack of extracellular material in the colony formed in boiled agar. (B) The colony grown in autoclaved agar contained irregular shaped cells and increased extracellular debris which prevented precise focusing on the cells of the colony. Bar = 5 micrometers.

6 Thomson / W right /Meyskens 9 regularly shaped (Fig. 2B). Additionally, the agar immediately adjacent to the colonies formed in autoclaved agar contained large amounts of extracellular debris and granular material. The colonies which formed in boiled agar were structurally and phenotypically similar to those which developed in autoclaved agar and did not morphologically resemble granulocyte or macrophage clusters or colonies. Previous detailed morphological studies of colonies formed from cells from several different biopsies of melanoma have shown that colonies of nonmelanoma cell types are not present [7]. Additionally, increases in colony growth have been noted from four melanoma cell lines using boiled agar (unpublished observations). These data suggest that the increases in colony formation using boiled agar represent an improvement in melanoma colony growth rather than of other cell types. Our results demonstrate that human melanoma colony formation was improved when boiled rather than autoclaved agar was used. Our data extends the finding of Dixon et al. [5] who demonstrated that autoclaved agar contained an inhibitor of granulocytemacrophage colony formation to include a detrimental effect of autoclaved agar on the growth of melanoma colonies. Our data and those of Dixon et al. [5] suggest that the effect of boiled and autoclaved agar on colony formation of other tumor types should also be compared systematically. Acknowledgments This work was supported in part by a grant from the American Cancer Society (PDT184) and the National Cancer Institute (CA2752, CA1794). We thank L. Kimball for the fine secretarial assistance and preparation of the graphics. References Meyskens, F.L., Jr.; Soehnlen, B.J.; Saxe, D.F.; Casey, W.J.; Salmon, S.E.: In vitro clonal assay for human metastatic malignant melanoma. Stem Cells I: 6172 (1981). Hamburger, A.W.; Salmon, S.E.: Primary bioassay of human tumor stem cells. Science 197: (1977). Courtenay, V.D.; Mills, J.: An in vitro colony assay for human tumors grown in immunesuppressed mice and treated in vivo with cytotoxic agents. Br J Cancer 37: (1978). Tveit, K.M.; Fodstad,.; Pihl, A.: Cultivation of human melanomas in soft

7 Improvement of Melanoma Colony Formation 91 agar. Factors influencing plating efficiency and chemosensitivity. Int J Cancer (1981). 5 Dixon, R.A.; Linch, D.; Baines, P.; Rosendaal, M.: Autoclaved agar contains an inhibitor of granulocytemacrophage colony growth in vitro. Exp Cell Res 132: (1981). 6 Kressner, B.E.; Morton, R.A.; Martens, A.E.; Salmon, S.E.; Von Hoff, D.D.; Soehnlen, B.: Use of an image analysis system to count colonies in stem cell assays of human tumors; in Salmon, Cloning of Human Tunor Stem Cells, pp (Liss, New York 198) 7 Persky, B.; Thomson, S.P.; Meyskens, F.L., Jr.; Hendrix, M.J.C.: Methods for evaluating the morphological and immunohistochemical properties of human tumor colonies grown in soft agar. In Vitro Z8: (1982). Accepted: March 9, 1983 Dr. Frank L. Meyskens, Jr., Department of Internal Medicine and Cancer Center, University of Arizona, Tucson, AZ (USA)

International Journal of Cell Cloning 2: (1984)

International Journal of Cell Cloning 2: (1984) Original Papers International Journal of Cell Cloning 2: 142-160 (1984) Evaluation of an Automated Image Analysis System for Counting Human Tumor Colonies Sydney E. Salmon, Laurie Young, Joyce Lebowitz,

More information

Tetrazolium Staining by Optical Scanning Overestimates Colony Size and Number of Colonies Counted

Tetrazolium Staining by Optical Scanning Overestimates Colony Size and Number of Colonies Counted Original Paper International Journal of Cell Cloning 5:4?2-479 (1987) Tetrazolium Staining by Optical Scanning Overestimates Colony Size and Number of Colonies Counted Marvin D. Bregman, Julie Buckmeier,

More information

In Vitro Activation of Dacarbazine (Dnc) for a Human Tumor Cloning System

In Vitro Activation of Dacarbazine (Dnc) for a Human Tumor Cloning System International Journal of Cell Cloning 1: 24-32 (1983) In Vitro Activation of Dacarbazine (Dnc) for a Human Tumor Cloning System Hans-Robert Metelmanna, Daniel D. Von H op adepartment of Maxillofacial and

More information

Dose-Survival Curves of Cis-platinum, Melphalan, and Velban in Human GranulocyteMacrophage Progenitor Cells

Dose-Survival Curves of Cis-platinum, Melphalan, and Velban in Human GranulocyteMacrophage Progenitor Cells Original Papers International Journal of Cell Cloning 2: 335-340 (1984) Dose-Survival Curves of Cis-platinum, Melphalan, and Velban in Human GranulocyteMacrophage Progenitor Cells Gunter E. Umbach, S.

More information

stem-cell/in vivo clinical correlations for

stem-cell/in vivo clinical correlations for Br. J. Cancer (1981) 44, 787 QUANTITATION OF DRUG SENSITIVITY BY HUMAN METASTATIC MELANOMA COLONY-FORMING UNITS F. L. MEYSKENS, JR, T. E. MOON, B. DANA, E. GILMARTIN, W. J. CASEY, H. S. G-CHEN, D. HOOD

More information

S been applied to the study of the biology of normal

S been applied to the study of the biology of normal Application of In Vitro Soft Agar Techniques for Growth of Tumor Cells to the Study of Colon Cancer RONALD N. BUICK, PHD,* STEPHEN E. FRY, MS,t AND SYDNEY E. SALMON, MD$ An in vitro assay to measure the

More information

Chemotherapeutic Susceptibility of Human Bone Marrow Progenitor Cells and Human Myelogenous Leukemia Cells (HMO) in Co-Culture: Preliminary Report

Chemotherapeutic Susceptibility of Human Bone Marrow Progenitor Cells and Human Myelogenous Leukemia Cells (HMO) in Co-Culture: Preliminary Report International Journal of Cell Cloning 2: 254-262 (1984) Chemotherapeutic Susceptibility of Human Bone Marrow Progenitor Cells and Human Myelogenous Leukemia Cells (HMO) in Co-Culture: Preliminary Report

More information

In Vitro Assays for New Drug Screening: Comparison of a Thymidine Incorporation Assay with the Human Tumor Colony-Forming Assay

In Vitro Assays for New Drug Screening: Comparison of a Thymidine Incorporation Assay with the Human Tumor Colony-Forming Assay Original Paper International Journal of Cell Cloning 5:421-431 (1987) In Vitro Assays for New Drug Screening: Comparison of a Thymidine Incorporation Assay with the Human Tumor Colony-Forming Assay Susanne

More information

MTS assay in A549 cells

MTS assay in A549 cells Project: VIGO MTS assay in A549 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective

More information

Biphasic Effect of Vanadium Salts on In Vitro k o r Colony Growth

Biphasic Effect of Vanadium Salts on In Vitro k o r Colony Growth International Journal of Cell Cloning 5: 170-178 (1987) Biphasic Effect of Vanadium Salts on In Vitro k o r Colony Growth Ulrike Hanauske, Axel-R. Hanauske, Martha H. Marshall, Victoria A. Muggia, Daniel

More information

Effect of Interleukin 10 on the Hematopoietic Progenitor Cells from Patients with Aplastic Anemia

Effect of Interleukin 10 on the Hematopoietic Progenitor Cells from Patients with Aplastic Anemia Effect of Interleukin 10 on the Hematopoietic Progenitor Cells from Patients with Aplastic Anemia YOSHINOBU ASANO, SHOICHIRO SHIBATA, SHINJI KOBAYASHI, SEIICHI OKAMURA, YOSHIYUKI NIHO First Department

More information

Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas

Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas University of Groningen Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas IMPORTANT NOTE: You are advised to consult the publisher's version

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Corning BioCoat Matrigel Invasion Chamber

Corning BioCoat Matrigel Invasion Chamber Corning BioCoat Matrigel Invasion Chamber Catalog No. 354480, 354481 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200 (U.S.) CLSTechServ@Corning.com www.corning.com/lifesciences

More information

In Vitro Predictive Testing: the Sulfonamide Era

In Vitro Predictive Testing: the Sulfonamide Era Concise Review International Journal of Cell Cloning 5: 179-190 (1987) In Vitro Predictive Testing: the Sulfonamide Era Daniel D. Wn Hog The Department of Medicine, Division of Oncology, University of

More information

Appendix A: Preparation of Media and Chemicals. Malt Extract Agar (MEA) weighing g was dissolved in 400 ml of distilled water

Appendix A: Preparation of Media and Chemicals. Malt Extract Agar (MEA) weighing g was dissolved in 400 ml of distilled water Appendix A: Preparation of Media and Chemicals Preparation of Malt Extract Agar (MEA) Malt Extract Agar (MEA) weighing 13.44 g was dissolved in 400 ml of distilled water in an Erlenmeyer flask using a

More information

Normal Human Marrow Stromal Cells Induce Clonal Growth of Human Malignant T-Lymphoblasts

Normal Human Marrow Stromal Cells Induce Clonal Growth of Human Malignant T-Lymphoblasts International Journal of Cell Cloning 3: 169-175 (1985) Normal Human Marrow Stromal Cells Induce Clonal Growth of Human Malignant T-Lymphoblasts Rafael L. Gallardo, Harinder S. Juneja, Frank H. Gardner,

More information

Automated and Standardized Counting of Mouse Bone Marrow CFU Assays

Automated and Standardized Counting of Mouse Bone Marrow CFU Assays Automated and Standardized Counting of Mouse Bone Marrow CFU Assays 2 Automated and Standardized Colony Counting Table of Contents 4 Colony-Forming Unit (CFU) Assays for Mouse Bone Marrow 5 Automated Assay

More information

Continuous Cell Culture From a Patient With Chronic Myelogenous Leukemia. I. Propagation and Presence of Philadelphia Chromosome 1

Continuous Cell Culture From a Patient With Chronic Myelogenous Leukemia. I. Propagation and Presence of Philadelphia Chromosome 1 Continuous Cell Culture From a Patient With Chronic Myelogenous Leukemia. I. Propagation and Presence of Philadelphia Chromosome 1 LINDA S. LUCAS,2 JACQUELINE J. K..WHANG,3 J. H. TJIO,4 ROBERT A. MANAKER,2

More information

Primary cell culture from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts

Primary cell culture from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts Songklanakarin J. Sci. Technol. 32 (4), 327-331, Jul. - Aug. 2010 Original Article Primary cell culture from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts

More information

9700 BIOLOGY. Mark schemes should be read in conjunction with the question paper and the Principal Examiner Report for Teachers.

9700 BIOLOGY. Mark schemes should be read in conjunction with the question paper and the Principal Examiner Report for Teachers. CAMBRIDGE INTERNATIONAL EXAMINATIONS GCE Advanced Subsidiary Level and GCE Advanced Level MARK SCHEME for the May/June 2013 series 9700 BIOLOGY 9700/53 Paper 5 (Planning, Analysis and Evaluation), maximum

More information

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values

More information

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal

More information

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative

More information

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy

More information

Coenzyme Q-10 Effects on Mammalian Cell Behavior. Clayton Gentilcore Grade 11 Central Catholic High School PJAS 2013

Coenzyme Q-10 Effects on Mammalian Cell Behavior. Clayton Gentilcore Grade 11 Central Catholic High School PJAS 2013 Coenzyme Q-10 Effects on Mammalian Cell Behavior Clayton Gentilcore Grade 11 Central Catholic High School PJAS 2013 An Overview of Stem Cells Unspecialized cells capable of renewing themselves through

More information

Rapid Decline of Clonogenic Hemopoietic Progenitors in Semisolid Cultures of Bone Marrow Samples Derived from Patients with Chronic Myeloid Leukemia

Rapid Decline of Clonogenic Hemopoietic Progenitors in Semisolid Cultures of Bone Marrow Samples Derived from Patients with Chronic Myeloid Leukemia Original Manuscript International Journal of Cell Cloning 7314-321 (1989) Rapid Decline of Clonogenic Hemopoietic Progenitors in Semisolid Cultures of Bone Marrow Samples Derived from Patients with Chronic

More information

MTS assay in THP-1 cells

MTS assay in THP-1 cells Project: VIGO MTS assay in THP-1 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective

More information

Establishment of Human Cancer Cell Clones with Different Characteristics: A Model for Screening Chemopreventive Agents

Establishment of Human Cancer Cell Clones with Different Characteristics: A Model for Screening Chemopreventive Agents Establishment of Human Cancer Cell Clones with Different Characteristics: A Model for Screening Chemopreventive Agents JEFFREY H. WARE 1, ZHAOZONG ZHOU 1, JUN GUAN 1, ANN R. KENNEDY 1 and LEVY KOPELOVICH

More information

Inhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor

Inhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor International Journal of Cell Cloning 1: 142-150 (1983) Inhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor Giuseppe Pigoli, Lina Mangoni, Cecilia CaFamatti,

More information

ELECTRON MICROSCOPY OF A SMALL PIGMENTED CUTANEOUS LESION*

ELECTRON MICROSCOPY OF A SMALL PIGMENTED CUTANEOUS LESION* ELECTRON MICROSCOPY OF A SMALL PIGMENTED CUTANEOUS LESION* The description of the lesion in the title of this rcport is intentionally non-committal. Diagnosed clinically as a lentigo, it was removed as

More information

NINDS Repository Human Induced Pluripotent Stem Cell (ipsc) Handling Protocols (Matrigel and mtesr Media)

NINDS Repository Human Induced Pluripotent Stem Cell (ipsc) Handling Protocols (Matrigel and mtesr Media) General Guidelines for Handling Human ipsc cells ipsc are cryopreserved in plastic cryovials and shipped on dry ice. If storing the ipsc before thawing, store in liquid nitrogen vapor. Storage directly

More information

Quantitative Assay of Paravaccinia Virus Based

Quantitative Assay of Paravaccinia Virus Based APPrU MICROBIOLOGY, JUly 1972, p. 138-142 Copyright 1972 American Society for Microbiology Vol. 24, No. 1 Printed in U.S.A. Quantitative Assay of Paravaccinia Virus Based on Enumeration of Inclusion-Containing

More information

Human Induced Plutipotent Stem Cell (ipsc) Handling Protocols: Matrigel and mtesr/e8 Media

Human Induced Plutipotent Stem Cell (ipsc) Handling Protocols: Matrigel and mtesr/e8 Media General Guidelines for Handling Human ipsc cells ipsc are cryopreserved in plastic cryovials and shipped on dry ice. If storing the ipsc before thawing, store in liquid nitrogen vapor. Storage directly

More information

Simpson (1928), Julianelle (1937), Thompson and Khorazo. that the pathogenic strains, (Staphylococcus aureus and Staphylococcus

Simpson (1928), Julianelle (1937), Thompson and Khorazo. that the pathogenic strains, (Staphylococcus aureus and Staphylococcus THE RELATION OF AEROBIOSIS TO THE FERMENTATION OF MANNITOL BY STAPHYLOCOCCI EUGENIA VALENTINE COLWELL Laboratory of Industrial Hygiene Inc., New York City Received for publication August 5, 1938 While

More information

Microbiological Methods V-A- 1 SALMONELLA SPECIES PRESUMPTIVE AND CONFIRMATION TESTS

Microbiological Methods V-A- 1 SALMONELLA SPECIES PRESUMPTIVE AND CONFIRMATION TESTS Microbiological Methods V-A- 1 PRESUMPTIVE AND CONFIRMATION TESTS PRINCIPLE SCOPE Enrichment and selective procedures are used to provide a reasonably sensitive, definitive and versatile means of qualitatively

More information

Type 1 Diabetes: Islet expressing GAD65 (green) with DAPI (Blue) Islet expressing Insulin (red) in 3D confocal imaging

Type 1 Diabetes: Islet expressing GAD65 (green) with DAPI (Blue) Islet expressing Insulin (red) in 3D confocal imaging Type 1 Diabetes: Our group has been studying autoimmune diabetes for many years. Recently, we have developed a humanized mouse model of Type 1 Diabetes (T1D). We believe this model will help understand

More information

PDF hosted at the Radboud Repository of the Radboud University Nijmegen

PDF hosted at the Radboud Repository of the Radboud University Nijmegen PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/14752

More information

ERYSIPELOTHRIX RHUSIOPATHIAE1. ordinary culture media. This is especially true when pathogens are to be isolated SELECTIVE MEDIUM FOR STREPTOCOCCI AND

ERYSIPELOTHRIX RHUSIOPATHIAE1. ordinary culture media. This is especially true when pathogens are to be isolated SELECTIVE MEDIUM FOR STREPTOCOCCI AND THE USE OF SODIUM AZIDE (NaNs) AND CRYSTAL VIOLET IN A SELECTIVE MEDIUM FOR STREPTOCOCCI AND ERYSIPELOTHRIX RHUSIOPATHIAE1 Department of Veterinary Hygiene, Division of Veterinary Medicine, Iowa State

More information

Marshall T Bell Research Resident University of Colorado Grand Rounds Nov. 21, 2011

Marshall T Bell Research Resident University of Colorado Grand Rounds Nov. 21, 2011 Marshall T Bell Research Resident University of Colorado Grand Rounds Nov. 21, 2011 Most common form of cancer in adults ages 25-29 3-5% of skin cancers but 65-75% of deaths Most common metastasis to small

More information

The Effects of Shampoo on Microbial Flora. Andrew Walker Grade 9 Central Catholic High School

The Effects of Shampoo on Microbial Flora. Andrew Walker Grade 9 Central Catholic High School The Effects of Shampoo on Microbial Flora Andrew Walker Grade 9 Central Catholic High School Shampoo Hair care product used to clean hair of unwanted build up Combined soap, water, and herbs to make hair

More information

T agar culture system to attempt to grow human

T agar culture system to attempt to grow human Direct Cloning of Human Breast Cancer in Soft Agar Culture JOHN SANDBACH MD; DANIEL D. VON HOFF, MD,t GARY CLARK, PHD,t ANATOLIO B. CRUZ, JR., MD,* MICHAEL OBRIEN, MD.5 AND THE SOUTH CENTRAL TEXAS HUMAN

More information

Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region

Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery

More information

Aplastic anemia. Case report. Effect of antithymocyte globulin on erythroid colony formation

Aplastic anemia. Case report. Effect of antithymocyte globulin on erythroid colony formation Case report Aplastic anemia Effect of antithymocyte globulin on erythroid colony formation Susan A. Rothmann Hamburger, Ph.D. Department of Laboratory Hematology and Blood Banking James H. Finke, Ph.D.

More information

Anaplastic Large Cell Lymphoma (of T cell lineage)

Anaplastic Large Cell Lymphoma (of T cell lineage) Anaplastic Large Cell Lymphoma (of T cell lineage) Definition T-cell lymphoma comprised of large cells with abundant cytoplasm and pleomorphic, often horseshoe-shaped nuclei CD30+ Most express cytotoxic

More information

Bacterial Interference in Chick Embryos *

Bacterial Interference in Chick Embryos * Journal of Clinical Investigation Vol. 46, No. 3, 1967 Bacterial Interference in Chick Embryos * JOHN C. RIBBLE t AND HENRY R. SHINEFIELD (From the Department of Medicine, The New York Hospital-Cornell

More information

Experimental Skin Sarcoidosis In A Doctor Volunteer

Experimental Skin Sarcoidosis In A Doctor Volunteer ISPUB.COM The Internet Journal of Internal Medicine Volume 5 Number 1 E Kalfin Citation E Kalfin.. The Internet Journal of Internal Medicine. 2003 Volume 5 Number 1. Abstract Scientists couldn't discover

More information

Hassan Pyar Kok-Khiang Peh *

Hassan Pyar Kok-Khiang Peh * Isolation of probiotics Lactobacillus acidophilus from commercial yoghurt Hassan Pyar Kok-Khiang Peh * School of Pharmaceutical Sciences, University Sains Malaysia, 11800 Minden, Penang, Malaysia. Telephone

More information

Supplemental materials

Supplemental materials Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

Supplementary information on Colourless agar for enhancing colour contrast between microbial colonies and agar

Supplementary information on Colourless agar for enhancing colour contrast between microbial colonies and agar Supplementary information on Colourless agar for enhancing colour contrast between microbial colonies and agar Wenfa Ng Department of Chemical and Biomolecular Engineering, National University of Singapore

More information

EXPERIMENTAL PNEUMONIA IN MICE FOLLOWING THE INHALATION OF STREPTOCOCCUS H2EMOLYTICUS AND OF FRIEDLANDER'S BACILLUS.

EXPERIMENTAL PNEUMONIA IN MICE FOLLOWING THE INHALATION OF STREPTOCOCCUS H2EMOLYTICUS AND OF FRIEDLANDER'S BACILLUS. EXPERIMENTAL PNEUMONIA IN MICE FOLLOWING THE INHALATION OF STREPTOCOCCUS H2EMOLYTICUS AND OF FRIEDLANDER'S BACILLUS. BY ERNEST G. STILLMAN, M.D., AND ARNOLD BRANCH, M.D. (From the Hospital of The Rockefeller

More information

TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis

TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis Award Number: W81XWH-10-1-0304 TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis PRINCIPAL INVESTIGATOR: Minji Kim CONTRACTING ORGANIZATION: Columbia University New York, NY 10032 REPORT

More information

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

Biological Consulting Services

Biological Consulting Services Biological Consulting Services of North Florida/ Inc. May 13, 2009 Aphex BioCleanse Systems, Inc. Dear Sirs, We have completed antimicrobial efficacy study on the supplied Multi-Purpose Solution. The testing

More information

10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)

10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml) RESEARCH ARTICLE Penh (100% of PBS) 1 PBS 8.00 +anti-hmgb1 6.00 4.00 p=0.054 Cellular & Molecular Immunology advance online publication, PBS 3.12 6.25 Methatroline (mg/ml) Neutrophil isolation and culture

More information

Williams Lab Recipes ANTIBIOTICS

Williams Lab Recipes ANTIBIOTICS Williams Lab Recipes ANTIBIOTICS 1000x Ampicillin (sodium salt) 100mg/ml recipe 1. Measure out 1 g of Ampicillin tri hydrate 2. Add Milli-Q H2O to 10 ml 3. Add ~.1 g of NaOH pellets (half pellet or more

More information

In Vitro Growth of Erythropoietic Progenitor Cells in Long-%rm Remission of Acute Leukemia

In Vitro Growth of Erythropoietic Progenitor Cells in Long-%rm Remission of Acute Leukemia International Journal of Cell Cloning 4: 186-191 (1986) In Vitro Growth of Erythropoietic Progenitor Cells in Long-%rm Remission of Acute Leukemia C. Peschel, G. Konwalinka, D. Geissler, H. Bmunsteiner

More information

Evaluation of Antibacterial Effect of Odor Eliminating Compounds

Evaluation of Antibacterial Effect of Odor Eliminating Compounds Evaluation of Antibacterial Effect of Odor Eliminating Compounds Yuan Zeng, Bingyu Li, Anwar Kalalah, Sang-Jin Suh, and S.S. Ditchkoff Summary Antibiotic activity of ten commercially available odor eliminating

More information

Morphogenesis by dissociated immature rat testicular cells in primary culture

Morphogenesis by dissociated immature rat testicular cells in primary culture /. Einhryol. exp. Morph. Vol. 44, pp. 297-302, 1978 297 Printed in Great Britain (p Company of Biologists Limited 1978 SHORT PAPER Morphogenesis by dissociated immature rat testicular cells in primary

More information

individual lung metastases (cancer/phenotypic stability)

individual lung metastases (cancer/phenotypic stability) Proc. Nati cad. Sci. US Vol. 79, pp. 6574-6578, November 1982 Cell Biology Evolution of tumor cell heterogeneity during progressive growth of individual lung metastases (cancer/phenotypic stability) GEORGE

More information

You Are Going to Cut How Much Skin? Locoregional Surgical Treatment. Justin Rivard MD, MSc, FRCSC September 21, 2018

You Are Going to Cut How Much Skin? Locoregional Surgical Treatment. Justin Rivard MD, MSc, FRCSC September 21, 2018 You Are Going to Cut How Much Skin? Locoregional Surgical Treatment Justin Rivard MD, MSc, FRCSC September 21, 2018 Presenter Disclosure Faculty/Speaker: Justin Rivard Relationships with financial sponsors:

More information

HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY

HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEMATOCRIT Hematocrit is a measure of the percentage of the total blood volume that is made up by the red blood cells The hematocrit can be determined directly

More information

Case Scenario 1 Worksheet. Primary Site C44.4 Morphology 8743/3 Laterality 0 Stage/ Prognostic Factors

Case Scenario 1 Worksheet. Primary Site C44.4 Morphology 8743/3 Laterality 0 Stage/ Prognostic Factors CASE SCENARIO 1 9/10/13 HISTORY: Patient is a 67-year-old white male and presents with lesion located 4-5cm above his right ear. The lesion has been present for years. No lymphadenopathy. 9/10/13 anterior

More information

The Effects of Spray Sunscreen on MG63 Cancer Cell Lines. Anthony Williams Pittsburgh Central Catholic High School Grade 11

The Effects of Spray Sunscreen on MG63 Cancer Cell Lines. Anthony Williams Pittsburgh Central Catholic High School Grade 11 The Effects of Spray Sunscreen on MG63 Cancer Cell Lines Anthony Williams Pittsburgh Central Catholic High School Grade 11 Sunscreen Meant to protect against harmful UV rays that can be carcinogenic Comes

More information

Hematology Unit Lab 2 Review Material

Hematology Unit Lab 2 Review Material Objectives Hematology Unit Lab 2 Review Material - 2018 Laboratory Instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided

More information

Cultivation of Yeast Cells and Induction of Autophagy Hayashi Yamamoto, Hitoshi Nakatogawa

Cultivation of Yeast Cells and Induction of Autophagy Hayashi Yamamoto, Hitoshi Nakatogawa Cultivation of Yeast Cells and Induction of Autophagy Hayashi Yamamoto, Hitoshi Nakatogawa METHOD Preculture 1. Inoculate yeast cells (from a single colony) into 2 ml of liquid medium (YPD, SD/CA, or SD/DO

More information

Pitfalls in thyroid tumor pathology. Prof.Valdi Pešutić-Pisac MD, PhD

Pitfalls in thyroid tumor pathology. Prof.Valdi Pešutić-Pisac MD, PhD Pitfalls in thyroid tumor pathology Prof.Valdi Pešutić-Pisac MD, PhD Too many or... Tumour herniation through a torn capsule simulating capsular invasion fibrous capsule with a sharp discontinuity, suggestive

More information

Lung Cytology: Lessons Learned from Errors in Practice

Lung Cytology: Lessons Learned from Errors in Practice Lung Cytology: Lessons Learned from Errors in Practice Stephen S. Raab, M.D. Department of Laboratory Medicine Eastern Health and Memorial University of Newfoundland, St. John s, NL and University of Washington,

More information

Studies on the Seif-Disinfecting

Studies on the Seif-Disinfecting Studies on the Seif-Disinfecting Power of the Skin* JOHN F. NORTON, PH. D., F. A. P. H. A., AND MARGUERITE F. NOVY Department of Health, Detroit, Mich. A RNOLD and his coworkers' have reported experiments

More information

CATRIX WOUND DRESSING CARTILAGE POWDER

CATRIX WOUND DRESSING CARTILAGE POWDER CATRIX WOUND DRESSING CARTILAGE POWDER Distributed By: Lescarden Inc. NY, NY (USA) Customer Relations: Toll Free (USA) (888) 581-2076. (212) 687-1050 Internet: www.catrix.com E-mail: info@catrix.com CATRIX

More information

Sideroblastic colonies in erythroid cultures grown

Sideroblastic colonies in erythroid cultures grown J Clin Pathol 1985;38:68-72 Sideroblastic colonies in erythroid cultures grown from normal human marrow S KAABA, A JACOBS, K BARNES From the Department ofhaematology, University of Wales College of Medicine,

More information

Dermatopathology: The tumor is composed of keratinocytes which show atypia, increase mitoses and abnormal mitoses.

Dermatopathology: The tumor is composed of keratinocytes which show atypia, increase mitoses and abnormal mitoses. Squamous cell carcinoma (SCC): A common malignant tumor of keratinocytes arising in the epidermis, usually from a precancerous condition: 1- UV induced actinic keratosis, usually of low grade malignancy.

More information

African Trypanosomes

African Trypanosomes African Trypanosomes Giemsa-stained blood smear of African trypanosomes viewed under the 100X objective lens. The block arrows denote trypomastigote forms of the African trypanosomes found within the blood

More information

Recipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones)

Recipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones) Protocol: 300 ml Yeast culture preparation Equipment and Reagents needed: Autoclaved toothpicks Shaker Incubator set at 30 C Incubator set at 30 C 60 mm 2 sterile petri dishes Autoclaved glass test tubes

More information

The Whitley Internal HEPA filtration system bacteriological testing

The Whitley Internal HEPA filtration system bacteriological testing The Whitley Internal HEPA filtration system bacteriological testing Andrew Pridmore July 2014 Introduction As described in Technical Note HE03, Whitley Workstations equipped with our Whitley Internal HEPA

More information

Papillary Lesions of the Breast: WHO Update

Papillary Lesions of the Breast: WHO Update Papillary Lesions of the Breast: WHO Update Stuart J. Schnitt, M.D. Department of Pathology Beth Israel Deaconess Medical Center and Harvard Medical School Boston, MA, USA Papillary Lesions of the Breast

More information

Diplomate of the American Board of Pathology in Anatomic and Clinical Pathology

Diplomate of the American Board of Pathology in Anatomic and Clinical Pathology A 33-year-old male with a left lower leg mass. Contributed by Shaoxiong Chen, MD, PhD Assistant Professor Indiana University School of Medicine/ IU Health Partners Department of Pathology and Laboratory

More information

Immature organoids appear after hours.

Immature organoids appear after hours. THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED Allison Ruchinskas, B.S., and James Clinton, Ph.D. ATCC Cell Systems, Gaithersburg, MD INTRODUCTION Figure 1. Mouse small intestinal organoid

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

العصوي الوعاي ي الورام = angiomatosis Bacillary

العصوي الوعاي ي الورام = angiomatosis Bacillary 1 / 7 BACILLARY ANGIOMATOSIS Epidemiology BA is most commonly seen in patients with acquired immunodeficiency syndrome (AIDS) and a CD4 count less than 50 cells/mm 3, with an incidence of 1.2 cases per

More information

Role of Interferon in the Propagation of MM Virus in L Cells

Role of Interferon in the Propagation of MM Virus in L Cells APPLIED MICROBIOLOGY, Oct. 1969, p. 584-588 Copyright ( 1969 American Society for Microbiology Vol. 18, No. 4 Printed in U S A. Role of Interferon in the Propagation of MM Virus in L Cells DAVID J. GIRON

More information

IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS

IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS CHAPTER 3 IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS 3. INTRODUCTION Plants are the basic source of knowledge of modern medicine. Almost all the parts of the plant, namely

More information

Microinsemination (Intracytoplasmic Sperm Injection) Microinsemination schedule. 1. Preparation of mediums

Microinsemination (Intracytoplasmic Sperm Injection) Microinsemination schedule. 1. Preparation of mediums Microinsemination (Intracytoplasmic Sperm Injection) Masumi Hirabayashi Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, National

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

The Effect of Celite Formulated Rhizobium Rubi AT3-4RS/6 and Tryptophan on Velvetleaf Plant Growth

The Effect of Celite Formulated Rhizobium Rubi AT3-4RS/6 and Tryptophan on Velvetleaf Plant Growth Andrews University Digital Commons @ Andrews University Honors Theses Undergraduate Research 2014 The Effect of Celite Formulated Rhizobium Rubi AT3-4RS/6 and Tryptophan on Velvetleaf Plant Growth Jonathon

More information

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME

More information

Subcutaneous Mycosis

Subcutaneous Mycosis Subcutaneous Mycosis Fungal infections 1. Superficial mycosis. 2. Coetaneous mycosis: Dermatophytoses. 3. Subcutaneous mycosis. 4. Systemic mycosis. 5. Opportunistic mycosis. Subcutanus mycoses Fungal

More information

Supplemental Experimental Procedures

Supplemental Experimental Procedures Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,

More information

In Vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth

In Vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth C A N C E R S U P P O R T : GRAMINEX Flower Pollen Extract In Vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth F.K. HABIB, MARGARET ROSS, A.C. BUCK, L. EBELING

More information

Amino Acid Requirements for Legionella pneumophila Growth

Amino Acid Requirements for Legionella pneumophila Growth JOURNAL OF CLINICAL MICROBIOLOGY, May 1981, p. 865-869 0095-1137/81/050865-05$02.00/0 Vol. 13, No. 5 Amino Acid Requirements for Legionella pneumophila Growth MARTHA J. TESH AND RICHARD D. MILLER* Department

More information

McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells

McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells Effects of McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells X.C. Wei, D.D. Yang, X.R. Han, Y.A. Zhao, Y.C. Li, L.J. Zhang and J.J. Wang Institute of hematological research,

More information

P R O S T A T E S U P P O R T :

P R O S T A T E S U P P O R T : P R O S T A T E S U P P O R T : GRAMINEX Flower Pollen Extract In vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth F.K. HABIB, MARGARET ROSS, A.C. BUCK,

More information

Morphological characteristics of the primary tumor and micrometastases in sentinel lymph nodes as a predictor of melanoma progression

Morphological characteristics of the primary tumor and micrometastases in sentinel lymph nodes as a predictor of melanoma progression Morphological characteristics of the primary tumor and micrometastases in sentinel lymph nodes as a predictor of melanoma progression M.N. Kukushkina, S.I. Korovin, O.I. Solodyannikova, G.G. Sukach, A.Yu.

More information

AACE/ACE Advanced Endocrine Neck Ultrasound Training Course 2016

AACE/ACE Advanced Endocrine Neck Ultrasound Training Course 2016 AACE/ACE Advanced Endocrine Neck Ultrasound Training Course 2016 This 9mm left inferior nodule should remind us all why we re here! There is no absolute number of images required for documentation

More information

In Vitro Cytotoxic Drug Sensitivity of Human Normal and Malignant Lymphocyte-Clone-Forming Cells

In Vitro Cytotoxic Drug Sensitivity of Human Normal and Malignant Lymphocyte-Clone-Forming Cells International Journal of Cell Cloning 5: 149-157 (1987) In Vitro Cytotoxic Drug Sensitivity of Human Normal and Malignant Lymphocyte-Clone-Forming Cells Chris Matthews, Bob Kutlaca, Ram Seshadri Department

More information

Test Report TOBACCO SMOKE VS. E-LIQUID VAPOUR

Test Report TOBACCO SMOKE VS. E-LIQUID VAPOUR Page 1 (8) Dartsch Scientific GmbH Oskar-von-Miller-Str. 10 D-86956 Schongau Firma Happy People GmbH Lindwurmstr. 5 80337 München Oskar-von-Miller-Straße 10 D-86956 Schongau, Germany Fon Diessen: +49 8807

More information

ACTG Laboratory Technologist Committee Revised Version 2.0 ACTG Lab Man HIV Quantitative PBMC culture May 2004

ACTG Laboratory Technologist Committee Revised Version 2.0 ACTG Lab Man HIV Quantitative PBMC culture May 2004 HIV QUANTITATIVE PBMC MICROCOCULTURE ASSAY 1 PRINCIPLE The quantitative PBMC micrococulture assay estimates the number of infectious units of HIV per million mononuclear cells (IUPM) in peripheral blood

More information