Improvement of Human Melanoma Colony Formation in Soft Agar Using Boiled Instead of Autoclaved Agar
|
|
- Theodora Williams
- 5 years ago
- Views:
Transcription
1 International Journal of Cell Cloning 1: 8591 (1983) Improvement of Human Melanoma Colony Formation in Soft Agar Using Boiled Instead of Autoclaved Agar Stephen P. Thomson, Mark D. Wright, Frank L. Meyskens, Jr. Department of Internal Medicine and Cancer Center, University of Arizona, Tucson, AZ, USA Key Words. Soft agar. Human melanoma colony Melanoma Clonogenic. graphics. Abstract. The effect of agar sterilized by either boiling or autoclaving on human melanoma colony formation in soft agar was compared using cells from 17 biopsies of metastatic malignant melanoma. The frequency of colony formation was significantly increased for cells grown in boiled agar in 8 samples (47%), unchanged in 8 samples (47%), and decreased in only one sample (6%). There were increases in both cluster and colony formation for the melanomas which had augmented colony formation when grown in boiled agar. There was also qualitative morphological improvement, including rounder, smoother cells and less extracellular debris surrounding the colonies. These data suggest that melanoma colony formation is enhanced when cells are grown in agar which has been sterilized by boiling rather than autoclaving. Introduction Many types of human tumors are grown in clonogenic assays which use agar as a semisolid support [l41. Sterilization of the agar is typically done by autoclaving. Dixon et al. [5] have recently shown that autoclaved agar contains an inhibitor of granulocytemacrophage colony growth. We therefore have compared agar sterilized by autoclaving to agar sterilized by boiling for the support of formation of human melanoma colonies grown from cells obtained from 17 biopsies of melanoma tissue. Quantitative and qualitative improvement in melanoma colony growth was demonstrated. '@ 1983 AlphaMed Press, Inc /83/$2./
2 Thomson/Wright/ Meyskens 86 Materials and Methods Culture Techniques Tumor tissue was obtained by excisional biopsy of subcutaneous nodules from patients with metastatic malignant melanoma in accord with a protocol approved by the University of Arizona Committee on Human Subjects. The tissue was mechanically dissociated into a single cell suspension as described previously [I]; cells were cryopreserved in 1% dimethylsulfoxide in Ham's F1 medium and 1% heatinactivated fetal calf serum (FCS). We have previously described the culture system which is a simplification [l] of the bilayer agar system developed by Hamburger and Salmon [2]. Briefly, the underlayer was 1. ml of.5% agar (Bacto, Difco Lab, Detroit, MI) in Ham's F1 medium which contained 1% FCS, penicillin (1 pg/ml) and streptomycin (1 unitdml). The plating layer contained 5, nucleated cells in 1. ml of.3% agar in the same medium as the underlayer and was supplemented with insulin (1.54 units/ml), glutamine (.45 pg/ml), pyruvate (.34 pg/ml) and mercaptoethanol (.77 mm). The plates were cultured for 1421 days in a humidified 5% COP, 95% air atmosphere at 37 C. In this study colonies were defined as groups of cells greater than, or equal to, 6 pm in diameter while clusters were defined as groups of cells between 3 and 6 pm in diameter. Clusters and colonies were enumerated using the Omnicon FAS I1 (Bausch and Lomb, Rochester, NY) image analysis system [6]. An inverted microscope equipped with a calibrated reticle was used to obtain measurement of the diameters of clusters and colonies. Preparation of Agar Stock 3% agar (Bacto) solutions were prepared by adding.75 g of agar to 25. ml of distilled HzO and sterilized by two different methods to compare their effect on colony formation. The standard method was to autoclave the stock solutions of agar at 121OC and 15 PSI for 2 min, store at 4OC, and boil immediately before use for 2 to 25 min. Alternatively, the stock solution of agar was boiled immediately before use for 2 to 25 min without prior autoclaving. Results and Discussion The frequency of colony formation using agar sterilized by boiling or autoclaving agar was determined using cells from 17 different biopsies of human malignant melanoma (Table I). Cells from eight samples (47%) produced significantly more colonies when boiled rather than autoclaved agar was used. Cells from eight samples (47%) produced similar numbers of colonies in both agars, including 3 samples which did not grow in either condition; only one sample (6%) had fewer colonies using boiled agar. The median increase in colony formation using boiled agar was 66%. We also counted all the clusters and colonies equal to or greater than 3 micrometers in diameter in 4 of the 8 samples which had significant in
3 Improvement of Melanoma Colony Formation 87 Table I. Effect of autoclaved or boiled agar on frequency of melanoma colony formation from 17 biopsies of human melanoma Patient code No. colonies 1 5 pm 76 change pvaluea diameter/plate Autoclaved Boiled *4 81 *44 81 =46A 8146C 81 * A 82*7B f 21b 119f6 57f9 172 f 2 16f3 13f f f f8 25f8 776 f f f f f f4 87 f f f9 2f I 476 f f13 21 k f f f f a Student s ttest; =not significant; p>.5. b Mean k S.E. creases in the frequency of colony formation to determine whether the increase was secondary to more clusters developing into colonies or represented de novo growth. If the effect of boiled agar was only to allow more clusters to develop into colonies without de now growth, one would expect a decrease in the number of clusters with a concomitant increase in the number of colonies. However, the data in Figure 1 show that boiled agar increased the number of both clusters and colonies. For example, if the increase in the number of colonies for patient B (Fig. 1B) was due solely to an increase in the growth of clusters into the colony size class, most of the clusters grown with autoclaved agar (Fig. 1B) would not be present when boiled agar was used. However, many clusters were present when boiled agar was used (Fig. lb), favoring the explanation that the effect of boiled agar was to allow more de novo growth. Further support is provided by the
4 Thornson/ Wright/ Meyskens 88 Fig. 1. Size distribution of clusters and colonies grown using boiled or autoclaved agar. The dashed line is at a diameter of 6 micrometers and by our definition divides clusters and colonies. Patient A (No ), B (No A), C (No ), and D (No ) observation that boiled agar did not increase the size of colonies formed (Fig. 1AD), a result one would expect if the only effect of boiled agar was to increase the size of groups of cells once they started to'proliferate. These results favor the explanation that the effect of boiled agar was to allow more de novo growth of cells into clusters and colonies rather than to increase the size of clusters after they have begun to proliferate. There were also qualitative morphological differences between the colonies formed in boiled or autoclaved agar. These qualitative differences were noted in 4 of the 8 samples which had quantitative increases in colony formation. The colonies formed in boiled agar typically contained cells that were very smooth edged and rounded (Fig. 2A) while the colonies which formed in autoclaved agar usually contained cells that were ir
5 Improvement of Melanoma Colony Formation 89 Fig. 2. Qualitative morphological differences between colonies formed in boiled and autoclaved agar. Patient No (A) Note the rounded, smoothedged cells and the lack of extracellular material in the colony formed in boiled agar. (B) The colony grown in autoclaved agar contained irregular shaped cells and increased extracellular debris which prevented precise focusing on the cells of the colony. Bar = 5 micrometers.
6 Thomson / W right /Meyskens 9 regularly shaped (Fig. 2B). Additionally, the agar immediately adjacent to the colonies formed in autoclaved agar contained large amounts of extracellular debris and granular material. The colonies which formed in boiled agar were structurally and phenotypically similar to those which developed in autoclaved agar and did not morphologically resemble granulocyte or macrophage clusters or colonies. Previous detailed morphological studies of colonies formed from cells from several different biopsies of melanoma have shown that colonies of nonmelanoma cell types are not present [7]. Additionally, increases in colony growth have been noted from four melanoma cell lines using boiled agar (unpublished observations). These data suggest that the increases in colony formation using boiled agar represent an improvement in melanoma colony growth rather than of other cell types. Our results demonstrate that human melanoma colony formation was improved when boiled rather than autoclaved agar was used. Our data extends the finding of Dixon et al. [5] who demonstrated that autoclaved agar contained an inhibitor of granulocytemacrophage colony formation to include a detrimental effect of autoclaved agar on the growth of melanoma colonies. Our data and those of Dixon et al. [5] suggest that the effect of boiled and autoclaved agar on colony formation of other tumor types should also be compared systematically. Acknowledgments This work was supported in part by a grant from the American Cancer Society (PDT184) and the National Cancer Institute (CA2752, CA1794). We thank L. Kimball for the fine secretarial assistance and preparation of the graphics. References Meyskens, F.L., Jr.; Soehnlen, B.J.; Saxe, D.F.; Casey, W.J.; Salmon, S.E.: In vitro clonal assay for human metastatic malignant melanoma. Stem Cells I: 6172 (1981). Hamburger, A.W.; Salmon, S.E.: Primary bioassay of human tumor stem cells. Science 197: (1977). Courtenay, V.D.; Mills, J.: An in vitro colony assay for human tumors grown in immunesuppressed mice and treated in vivo with cytotoxic agents. Br J Cancer 37: (1978). Tveit, K.M.; Fodstad,.; Pihl, A.: Cultivation of human melanomas in soft
7 Improvement of Melanoma Colony Formation 91 agar. Factors influencing plating efficiency and chemosensitivity. Int J Cancer (1981). 5 Dixon, R.A.; Linch, D.; Baines, P.; Rosendaal, M.: Autoclaved agar contains an inhibitor of granulocytemacrophage colony growth in vitro. Exp Cell Res 132: (1981). 6 Kressner, B.E.; Morton, R.A.; Martens, A.E.; Salmon, S.E.; Von Hoff, D.D.; Soehnlen, B.: Use of an image analysis system to count colonies in stem cell assays of human tumors; in Salmon, Cloning of Human Tunor Stem Cells, pp (Liss, New York 198) 7 Persky, B.; Thomson, S.P.; Meyskens, F.L., Jr.; Hendrix, M.J.C.: Methods for evaluating the morphological and immunohistochemical properties of human tumor colonies grown in soft agar. In Vitro Z8: (1982). Accepted: March 9, 1983 Dr. Frank L. Meyskens, Jr., Department of Internal Medicine and Cancer Center, University of Arizona, Tucson, AZ (USA)
International Journal of Cell Cloning 2: (1984)
Original Papers International Journal of Cell Cloning 2: 142-160 (1984) Evaluation of an Automated Image Analysis System for Counting Human Tumor Colonies Sydney E. Salmon, Laurie Young, Joyce Lebowitz,
More informationTetrazolium Staining by Optical Scanning Overestimates Colony Size and Number of Colonies Counted
Original Paper International Journal of Cell Cloning 5:4?2-479 (1987) Tetrazolium Staining by Optical Scanning Overestimates Colony Size and Number of Colonies Counted Marvin D. Bregman, Julie Buckmeier,
More informationIn Vitro Activation of Dacarbazine (Dnc) for a Human Tumor Cloning System
International Journal of Cell Cloning 1: 24-32 (1983) In Vitro Activation of Dacarbazine (Dnc) for a Human Tumor Cloning System Hans-Robert Metelmanna, Daniel D. Von H op adepartment of Maxillofacial and
More informationDose-Survival Curves of Cis-platinum, Melphalan, and Velban in Human GranulocyteMacrophage Progenitor Cells
Original Papers International Journal of Cell Cloning 2: 335-340 (1984) Dose-Survival Curves of Cis-platinum, Melphalan, and Velban in Human GranulocyteMacrophage Progenitor Cells Gunter E. Umbach, S.
More informationstem-cell/in vivo clinical correlations for
Br. J. Cancer (1981) 44, 787 QUANTITATION OF DRUG SENSITIVITY BY HUMAN METASTATIC MELANOMA COLONY-FORMING UNITS F. L. MEYSKENS, JR, T. E. MOON, B. DANA, E. GILMARTIN, W. J. CASEY, H. S. G-CHEN, D. HOOD
More informationS been applied to the study of the biology of normal
Application of In Vitro Soft Agar Techniques for Growth of Tumor Cells to the Study of Colon Cancer RONALD N. BUICK, PHD,* STEPHEN E. FRY, MS,t AND SYDNEY E. SALMON, MD$ An in vitro assay to measure the
More informationChemotherapeutic Susceptibility of Human Bone Marrow Progenitor Cells and Human Myelogenous Leukemia Cells (HMO) in Co-Culture: Preliminary Report
International Journal of Cell Cloning 2: 254-262 (1984) Chemotherapeutic Susceptibility of Human Bone Marrow Progenitor Cells and Human Myelogenous Leukemia Cells (HMO) in Co-Culture: Preliminary Report
More informationIn Vitro Assays for New Drug Screening: Comparison of a Thymidine Incorporation Assay with the Human Tumor Colony-Forming Assay
Original Paper International Journal of Cell Cloning 5:421-431 (1987) In Vitro Assays for New Drug Screening: Comparison of a Thymidine Incorporation Assay with the Human Tumor Colony-Forming Assay Susanne
More informationMTS assay in A549 cells
Project: VIGO MTS assay in A549 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective
More informationBiphasic Effect of Vanadium Salts on In Vitro k o r Colony Growth
International Journal of Cell Cloning 5: 170-178 (1987) Biphasic Effect of Vanadium Salts on In Vitro k o r Colony Growth Ulrike Hanauske, Axel-R. Hanauske, Martha H. Marshall, Victoria A. Muggia, Daniel
More informationEffect of Interleukin 10 on the Hematopoietic Progenitor Cells from Patients with Aplastic Anemia
Effect of Interleukin 10 on the Hematopoietic Progenitor Cells from Patients with Aplastic Anemia YOSHINOBU ASANO, SHOICHIRO SHIBATA, SHINJI KOBAYASHI, SEIICHI OKAMURA, YOSHIYUKI NIHO First Department
More informationFeasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas
University of Groningen Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas IMPORTANT NOTE: You are advised to consult the publisher's version
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationCorning BioCoat Matrigel Invasion Chamber
Corning BioCoat Matrigel Invasion Chamber Catalog No. 354480, 354481 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200 (U.S.) CLSTechServ@Corning.com www.corning.com/lifesciences
More informationIn Vitro Predictive Testing: the Sulfonamide Era
Concise Review International Journal of Cell Cloning 5: 179-190 (1987) In Vitro Predictive Testing: the Sulfonamide Era Daniel D. Wn Hog The Department of Medicine, Division of Oncology, University of
More informationAppendix A: Preparation of Media and Chemicals. Malt Extract Agar (MEA) weighing g was dissolved in 400 ml of distilled water
Appendix A: Preparation of Media and Chemicals Preparation of Malt Extract Agar (MEA) Malt Extract Agar (MEA) weighing 13.44 g was dissolved in 400 ml of distilled water in an Erlenmeyer flask using a
More informationNormal Human Marrow Stromal Cells Induce Clonal Growth of Human Malignant T-Lymphoblasts
International Journal of Cell Cloning 3: 169-175 (1985) Normal Human Marrow Stromal Cells Induce Clonal Growth of Human Malignant T-Lymphoblasts Rafael L. Gallardo, Harinder S. Juneja, Frank H. Gardner,
More informationAutomated and Standardized Counting of Mouse Bone Marrow CFU Assays
Automated and Standardized Counting of Mouse Bone Marrow CFU Assays 2 Automated and Standardized Colony Counting Table of Contents 4 Colony-Forming Unit (CFU) Assays for Mouse Bone Marrow 5 Automated Assay
More informationContinuous Cell Culture From a Patient With Chronic Myelogenous Leukemia. I. Propagation and Presence of Philadelphia Chromosome 1
Continuous Cell Culture From a Patient With Chronic Myelogenous Leukemia. I. Propagation and Presence of Philadelphia Chromosome 1 LINDA S. LUCAS,2 JACQUELINE J. K..WHANG,3 J. H. TJIO,4 ROBERT A. MANAKER,2
More informationPrimary cell culture from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts
Songklanakarin J. Sci. Technol. 32 (4), 327-331, Jul. - Aug. 2010 Original Article Primary cell culture from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts
More information9700 BIOLOGY. Mark schemes should be read in conjunction with the question paper and the Principal Examiner Report for Teachers.
CAMBRIDGE INTERNATIONAL EXAMINATIONS GCE Advanced Subsidiary Level and GCE Advanced Level MARK SCHEME for the May/June 2013 series 9700 BIOLOGY 9700/53 Paper 5 (Planning, Analysis and Evaluation), maximum
More informationFigure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.
Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values
More informationVETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION
VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal
More informationFrom Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport
From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative
More informationSupplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent
Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy
More informationCoenzyme Q-10 Effects on Mammalian Cell Behavior. Clayton Gentilcore Grade 11 Central Catholic High School PJAS 2013
Coenzyme Q-10 Effects on Mammalian Cell Behavior Clayton Gentilcore Grade 11 Central Catholic High School PJAS 2013 An Overview of Stem Cells Unspecialized cells capable of renewing themselves through
More informationRapid Decline of Clonogenic Hemopoietic Progenitors in Semisolid Cultures of Bone Marrow Samples Derived from Patients with Chronic Myeloid Leukemia
Original Manuscript International Journal of Cell Cloning 7314-321 (1989) Rapid Decline of Clonogenic Hemopoietic Progenitors in Semisolid Cultures of Bone Marrow Samples Derived from Patients with Chronic
More informationMTS assay in THP-1 cells
Project: VIGO MTS assay in THP-1 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective
More informationEstablishment of Human Cancer Cell Clones with Different Characteristics: A Model for Screening Chemopreventive Agents
Establishment of Human Cancer Cell Clones with Different Characteristics: A Model for Screening Chemopreventive Agents JEFFREY H. WARE 1, ZHAOZONG ZHOU 1, JUN GUAN 1, ANN R. KENNEDY 1 and LEVY KOPELOVICH
More informationInhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor
International Journal of Cell Cloning 1: 142-150 (1983) Inhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor Giuseppe Pigoli, Lina Mangoni, Cecilia CaFamatti,
More informationELECTRON MICROSCOPY OF A SMALL PIGMENTED CUTANEOUS LESION*
ELECTRON MICROSCOPY OF A SMALL PIGMENTED CUTANEOUS LESION* The description of the lesion in the title of this rcport is intentionally non-committal. Diagnosed clinically as a lentigo, it was removed as
More informationNINDS Repository Human Induced Pluripotent Stem Cell (ipsc) Handling Protocols (Matrigel and mtesr Media)
General Guidelines for Handling Human ipsc cells ipsc are cryopreserved in plastic cryovials and shipped on dry ice. If storing the ipsc before thawing, store in liquid nitrogen vapor. Storage directly
More informationQuantitative Assay of Paravaccinia Virus Based
APPrU MICROBIOLOGY, JUly 1972, p. 138-142 Copyright 1972 American Society for Microbiology Vol. 24, No. 1 Printed in U.S.A. Quantitative Assay of Paravaccinia Virus Based on Enumeration of Inclusion-Containing
More informationHuman Induced Plutipotent Stem Cell (ipsc) Handling Protocols: Matrigel and mtesr/e8 Media
General Guidelines for Handling Human ipsc cells ipsc are cryopreserved in plastic cryovials and shipped on dry ice. If storing the ipsc before thawing, store in liquid nitrogen vapor. Storage directly
More informationSimpson (1928), Julianelle (1937), Thompson and Khorazo. that the pathogenic strains, (Staphylococcus aureus and Staphylococcus
THE RELATION OF AEROBIOSIS TO THE FERMENTATION OF MANNITOL BY STAPHYLOCOCCI EUGENIA VALENTINE COLWELL Laboratory of Industrial Hygiene Inc., New York City Received for publication August 5, 1938 While
More informationMicrobiological Methods V-A- 1 SALMONELLA SPECIES PRESUMPTIVE AND CONFIRMATION TESTS
Microbiological Methods V-A- 1 PRESUMPTIVE AND CONFIRMATION TESTS PRINCIPLE SCOPE Enrichment and selective procedures are used to provide a reasonably sensitive, definitive and versatile means of qualitatively
More informationType 1 Diabetes: Islet expressing GAD65 (green) with DAPI (Blue) Islet expressing Insulin (red) in 3D confocal imaging
Type 1 Diabetes: Our group has been studying autoimmune diabetes for many years. Recently, we have developed a humanized mouse model of Type 1 Diabetes (T1D). We believe this model will help understand
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/14752
More informationERYSIPELOTHRIX RHUSIOPATHIAE1. ordinary culture media. This is especially true when pathogens are to be isolated SELECTIVE MEDIUM FOR STREPTOCOCCI AND
THE USE OF SODIUM AZIDE (NaNs) AND CRYSTAL VIOLET IN A SELECTIVE MEDIUM FOR STREPTOCOCCI AND ERYSIPELOTHRIX RHUSIOPATHIAE1 Department of Veterinary Hygiene, Division of Veterinary Medicine, Iowa State
More informationMarshall T Bell Research Resident University of Colorado Grand Rounds Nov. 21, 2011
Marshall T Bell Research Resident University of Colorado Grand Rounds Nov. 21, 2011 Most common form of cancer in adults ages 25-29 3-5% of skin cancers but 65-75% of deaths Most common metastasis to small
More informationThe Effects of Shampoo on Microbial Flora. Andrew Walker Grade 9 Central Catholic High School
The Effects of Shampoo on Microbial Flora Andrew Walker Grade 9 Central Catholic High School Shampoo Hair care product used to clean hair of unwanted build up Combined soap, water, and herbs to make hair
More informationT agar culture system to attempt to grow human
Direct Cloning of Human Breast Cancer in Soft Agar Culture JOHN SANDBACH MD; DANIEL D. VON HOFF, MD,t GARY CLARK, PHD,t ANATOLIO B. CRUZ, JR., MD,* MICHAEL OBRIEN, MD.5 AND THE SOUTH CENTRAL TEXAS HUMAN
More informationAlan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region
Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery
More informationAplastic anemia. Case report. Effect of antithymocyte globulin on erythroid colony formation
Case report Aplastic anemia Effect of antithymocyte globulin on erythroid colony formation Susan A. Rothmann Hamburger, Ph.D. Department of Laboratory Hematology and Blood Banking James H. Finke, Ph.D.
More informationAnaplastic Large Cell Lymphoma (of T cell lineage)
Anaplastic Large Cell Lymphoma (of T cell lineage) Definition T-cell lymphoma comprised of large cells with abundant cytoplasm and pleomorphic, often horseshoe-shaped nuclei CD30+ Most express cytotoxic
More informationBacterial Interference in Chick Embryos *
Journal of Clinical Investigation Vol. 46, No. 3, 1967 Bacterial Interference in Chick Embryos * JOHN C. RIBBLE t AND HENRY R. SHINEFIELD (From the Department of Medicine, The New York Hospital-Cornell
More informationExperimental Skin Sarcoidosis In A Doctor Volunteer
ISPUB.COM The Internet Journal of Internal Medicine Volume 5 Number 1 E Kalfin Citation E Kalfin.. The Internet Journal of Internal Medicine. 2003 Volume 5 Number 1. Abstract Scientists couldn't discover
More informationHassan Pyar Kok-Khiang Peh *
Isolation of probiotics Lactobacillus acidophilus from commercial yoghurt Hassan Pyar Kok-Khiang Peh * School of Pharmaceutical Sciences, University Sains Malaysia, 11800 Minden, Penang, Malaysia. Telephone
More informationSupplemental materials
Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSupplementary information on Colourless agar for enhancing colour contrast between microbial colonies and agar
Supplementary information on Colourless agar for enhancing colour contrast between microbial colonies and agar Wenfa Ng Department of Chemical and Biomolecular Engineering, National University of Singapore
More informationEXPERIMENTAL PNEUMONIA IN MICE FOLLOWING THE INHALATION OF STREPTOCOCCUS H2EMOLYTICUS AND OF FRIEDLANDER'S BACILLUS.
EXPERIMENTAL PNEUMONIA IN MICE FOLLOWING THE INHALATION OF STREPTOCOCCUS H2EMOLYTICUS AND OF FRIEDLANDER'S BACILLUS. BY ERNEST G. STILLMAN, M.D., AND ARNOLD BRANCH, M.D. (From the Hospital of The Rockefeller
More informationTITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis
Award Number: W81XWH-10-1-0304 TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis PRINCIPAL INVESTIGATOR: Minji Kim CONTRACTING ORGANIZATION: Columbia University New York, NY 10032 REPORT
More informationHOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)
HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationBiological Consulting Services
Biological Consulting Services of North Florida/ Inc. May 13, 2009 Aphex BioCleanse Systems, Inc. Dear Sirs, We have completed antimicrobial efficacy study on the supplied Multi-Purpose Solution. The testing
More information10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)
RESEARCH ARTICLE Penh (100% of PBS) 1 PBS 8.00 +anti-hmgb1 6.00 4.00 p=0.054 Cellular & Molecular Immunology advance online publication, PBS 3.12 6.25 Methatroline (mg/ml) Neutrophil isolation and culture
More informationWilliams Lab Recipes ANTIBIOTICS
Williams Lab Recipes ANTIBIOTICS 1000x Ampicillin (sodium salt) 100mg/ml recipe 1. Measure out 1 g of Ampicillin tri hydrate 2. Add Milli-Q H2O to 10 ml 3. Add ~.1 g of NaOH pellets (half pellet or more
More informationIn Vitro Growth of Erythropoietic Progenitor Cells in Long-%rm Remission of Acute Leukemia
International Journal of Cell Cloning 4: 186-191 (1986) In Vitro Growth of Erythropoietic Progenitor Cells in Long-%rm Remission of Acute Leukemia C. Peschel, G. Konwalinka, D. Geissler, H. Bmunsteiner
More informationEvaluation of Antibacterial Effect of Odor Eliminating Compounds
Evaluation of Antibacterial Effect of Odor Eliminating Compounds Yuan Zeng, Bingyu Li, Anwar Kalalah, Sang-Jin Suh, and S.S. Ditchkoff Summary Antibiotic activity of ten commercially available odor eliminating
More informationMorphogenesis by dissociated immature rat testicular cells in primary culture
/. Einhryol. exp. Morph. Vol. 44, pp. 297-302, 1978 297 Printed in Great Britain (p Company of Biologists Limited 1978 SHORT PAPER Morphogenesis by dissociated immature rat testicular cells in primary
More informationindividual lung metastases (cancer/phenotypic stability)
Proc. Nati cad. Sci. US Vol. 79, pp. 6574-6578, November 1982 Cell Biology Evolution of tumor cell heterogeneity during progressive growth of individual lung metastases (cancer/phenotypic stability) GEORGE
More informationYou Are Going to Cut How Much Skin? Locoregional Surgical Treatment. Justin Rivard MD, MSc, FRCSC September 21, 2018
You Are Going to Cut How Much Skin? Locoregional Surgical Treatment Justin Rivard MD, MSc, FRCSC September 21, 2018 Presenter Disclosure Faculty/Speaker: Justin Rivard Relationships with financial sponsors:
More informationHEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY
HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEMATOCRIT Hematocrit is a measure of the percentage of the total blood volume that is made up by the red blood cells The hematocrit can be determined directly
More informationCase Scenario 1 Worksheet. Primary Site C44.4 Morphology 8743/3 Laterality 0 Stage/ Prognostic Factors
CASE SCENARIO 1 9/10/13 HISTORY: Patient is a 67-year-old white male and presents with lesion located 4-5cm above his right ear. The lesion has been present for years. No lymphadenopathy. 9/10/13 anterior
More informationThe Effects of Spray Sunscreen on MG63 Cancer Cell Lines. Anthony Williams Pittsburgh Central Catholic High School Grade 11
The Effects of Spray Sunscreen on MG63 Cancer Cell Lines Anthony Williams Pittsburgh Central Catholic High School Grade 11 Sunscreen Meant to protect against harmful UV rays that can be carcinogenic Comes
More informationHematology Unit Lab 2 Review Material
Objectives Hematology Unit Lab 2 Review Material - 2018 Laboratory Instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided
More informationCultivation of Yeast Cells and Induction of Autophagy Hayashi Yamamoto, Hitoshi Nakatogawa
Cultivation of Yeast Cells and Induction of Autophagy Hayashi Yamamoto, Hitoshi Nakatogawa METHOD Preculture 1. Inoculate yeast cells (from a single colony) into 2 ml of liquid medium (YPD, SD/CA, or SD/DO
More informationPitfalls in thyroid tumor pathology. Prof.Valdi Pešutić-Pisac MD, PhD
Pitfalls in thyroid tumor pathology Prof.Valdi Pešutić-Pisac MD, PhD Too many or... Tumour herniation through a torn capsule simulating capsular invasion fibrous capsule with a sharp discontinuity, suggestive
More informationLung Cytology: Lessons Learned from Errors in Practice
Lung Cytology: Lessons Learned from Errors in Practice Stephen S. Raab, M.D. Department of Laboratory Medicine Eastern Health and Memorial University of Newfoundland, St. John s, NL and University of Washington,
More informationStudies on the Seif-Disinfecting
Studies on the Seif-Disinfecting Power of the Skin* JOHN F. NORTON, PH. D., F. A. P. H. A., AND MARGUERITE F. NOVY Department of Health, Detroit, Mich. A RNOLD and his coworkers' have reported experiments
More informationCATRIX WOUND DRESSING CARTILAGE POWDER
CATRIX WOUND DRESSING CARTILAGE POWDER Distributed By: Lescarden Inc. NY, NY (USA) Customer Relations: Toll Free (USA) (888) 581-2076. (212) 687-1050 Internet: www.catrix.com E-mail: info@catrix.com CATRIX
More informationSideroblastic colonies in erythroid cultures grown
J Clin Pathol 1985;38:68-72 Sideroblastic colonies in erythroid cultures grown from normal human marrow S KAABA, A JACOBS, K BARNES From the Department ofhaematology, University of Wales College of Medicine,
More informationDermatopathology: The tumor is composed of keratinocytes which show atypia, increase mitoses and abnormal mitoses.
Squamous cell carcinoma (SCC): A common malignant tumor of keratinocytes arising in the epidermis, usually from a precancerous condition: 1- UV induced actinic keratosis, usually of low grade malignancy.
More informationAfrican Trypanosomes
African Trypanosomes Giemsa-stained blood smear of African trypanosomes viewed under the 100X objective lens. The block arrows denote trypomastigote forms of the African trypanosomes found within the blood
More informationRecipes for Media and Solution Preparation SC-ura/Glucose Agar Dishes (20mL/dish, enough for 8 clones)
Protocol: 300 ml Yeast culture preparation Equipment and Reagents needed: Autoclaved toothpicks Shaker Incubator set at 30 C Incubator set at 30 C 60 mm 2 sterile petri dishes Autoclaved glass test tubes
More informationThe Whitley Internal HEPA filtration system bacteriological testing
The Whitley Internal HEPA filtration system bacteriological testing Andrew Pridmore July 2014 Introduction As described in Technical Note HE03, Whitley Workstations equipped with our Whitley Internal HEPA
More informationPapillary Lesions of the Breast: WHO Update
Papillary Lesions of the Breast: WHO Update Stuart J. Schnitt, M.D. Department of Pathology Beth Israel Deaconess Medical Center and Harvard Medical School Boston, MA, USA Papillary Lesions of the Breast
More informationDiplomate of the American Board of Pathology in Anatomic and Clinical Pathology
A 33-year-old male with a left lower leg mass. Contributed by Shaoxiong Chen, MD, PhD Assistant Professor Indiana University School of Medicine/ IU Health Partners Department of Pathology and Laboratory
More informationImmature organoids appear after hours.
THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED Allison Ruchinskas, B.S., and James Clinton, Ph.D. ATCC Cell Systems, Gaithersburg, MD INTRODUCTION Figure 1. Mouse small intestinal organoid
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationالعصوي الوعاي ي الورام = angiomatosis Bacillary
1 / 7 BACILLARY ANGIOMATOSIS Epidemiology BA is most commonly seen in patients with acquired immunodeficiency syndrome (AIDS) and a CD4 count less than 50 cells/mm 3, with an incidence of 1.2 cases per
More informationRole of Interferon in the Propagation of MM Virus in L Cells
APPLIED MICROBIOLOGY, Oct. 1969, p. 584-588 Copyright ( 1969 American Society for Microbiology Vol. 18, No. 4 Printed in U S A. Role of Interferon in the Propagation of MM Virus in L Cells DAVID J. GIRON
More informationIN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS
CHAPTER 3 IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS 3. INTRODUCTION Plants are the basic source of knowledge of modern medicine. Almost all the parts of the plant, namely
More informationMicroinsemination (Intracytoplasmic Sperm Injection) Microinsemination schedule. 1. Preparation of mediums
Microinsemination (Intracytoplasmic Sperm Injection) Masumi Hirabayashi Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, National
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationThe Effect of Celite Formulated Rhizobium Rubi AT3-4RS/6 and Tryptophan on Velvetleaf Plant Growth
Andrews University Digital Commons @ Andrews University Honors Theses Undergraduate Research 2014 The Effect of Celite Formulated Rhizobium Rubi AT3-4RS/6 and Tryptophan on Velvetleaf Plant Growth Jonathon
More informationMETACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY
METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME
More informationSubcutaneous Mycosis
Subcutaneous Mycosis Fungal infections 1. Superficial mycosis. 2. Coetaneous mycosis: Dermatophytoses. 3. Subcutaneous mycosis. 4. Systemic mycosis. 5. Opportunistic mycosis. Subcutanus mycoses Fungal
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationIn Vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth
C A N C E R S U P P O R T : GRAMINEX Flower Pollen Extract In Vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth F.K. HABIB, MARGARET ROSS, A.C. BUCK, L. EBELING
More informationAmino Acid Requirements for Legionella pneumophila Growth
JOURNAL OF CLINICAL MICROBIOLOGY, May 1981, p. 865-869 0095-1137/81/050865-05$02.00/0 Vol. 13, No. 5 Amino Acid Requirements for Legionella pneumophila Growth MARTHA J. TESH AND RICHARD D. MILLER* Department
More informationMcAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells
Effects of McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells X.C. Wei, D.D. Yang, X.R. Han, Y.A. Zhao, Y.C. Li, L.J. Zhang and J.J. Wang Institute of hematological research,
More informationP R O S T A T E S U P P O R T :
P R O S T A T E S U P P O R T : GRAMINEX Flower Pollen Extract In vitro Evaluation of the Pollen Extract, Cernitin T-60, in the Regulation of Prostate Cell Growth F.K. HABIB, MARGARET ROSS, A.C. BUCK,
More informationMorphological characteristics of the primary tumor and micrometastases in sentinel lymph nodes as a predictor of melanoma progression
Morphological characteristics of the primary tumor and micrometastases in sentinel lymph nodes as a predictor of melanoma progression M.N. Kukushkina, S.I. Korovin, O.I. Solodyannikova, G.G. Sukach, A.Yu.
More informationAACE/ACE Advanced Endocrine Neck Ultrasound Training Course 2016
AACE/ACE Advanced Endocrine Neck Ultrasound Training Course 2016 This 9mm left inferior nodule should remind us all why we re here! There is no absolute number of images required for documentation
More informationIn Vitro Cytotoxic Drug Sensitivity of Human Normal and Malignant Lymphocyte-Clone-Forming Cells
International Journal of Cell Cloning 5: 149-157 (1987) In Vitro Cytotoxic Drug Sensitivity of Human Normal and Malignant Lymphocyte-Clone-Forming Cells Chris Matthews, Bob Kutlaca, Ram Seshadri Department
More informationTest Report TOBACCO SMOKE VS. E-LIQUID VAPOUR
Page 1 (8) Dartsch Scientific GmbH Oskar-von-Miller-Str. 10 D-86956 Schongau Firma Happy People GmbH Lindwurmstr. 5 80337 München Oskar-von-Miller-Straße 10 D-86956 Schongau, Germany Fon Diessen: +49 8807
More informationACTG Laboratory Technologist Committee Revised Version 2.0 ACTG Lab Man HIV Quantitative PBMC culture May 2004
HIV QUANTITATIVE PBMC MICROCOCULTURE ASSAY 1 PRINCIPLE The quantitative PBMC micrococulture assay estimates the number of infectious units of HIV per million mononuclear cells (IUPM) in peripheral blood
More information