Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region
|
|
|
- Adelia Grant
- 5 years ago
- Views:
Transcription
1 Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region Ronghua Zhao MD PhD Cancer Stem Cell Research Group & Department of Surgery
2 CANCER BIOLOGY CLONAL EVOLUTION Multistep process Accumulation of genetic mutations Modulated by oncogenes, tumor suppressor genes, epigenetic factors etc. Does not entirely explain: latency heterogeneity cellular de-differentiation
3 CANCER BIOLOGY CLONAL EVOLUTION vs. STEM CELL MODELS (Till & McCulloch, 1963; Dick 1997) SELF RENEWAL STEM CELL DIFFERENTIATION continued division and maturation Multistep process Accumulation of genetic mutations Modulated by oncogenes, tumor suppressor genes, epigenetic factors etc. Does not entirely explain: latency heterogeneity cellular de-differentiation Cell surface markers (flow cytometry) AML CD34 + CD38 Myeloma CD19 + CD138 Glioma CD133 + nestin + Colon / GI CD133 + CD166 + EpCAM high Lgr5 Functional assays in vitro - sphere formation in cell culture - soft agar assays (clonogenicity, drug resistance) in vivo - xenograft formation in immunodeficient mice
4 EVIDENCE FOR STEM CELLS IN BARRETT ESOPHAGUS & ESOPHAGEAL MALIGNANCY Reviewed in Barbera & Fitzgerald: Biochem. Soc. Trans 2010 Murine tissues: Integrin α6 / CD71 (Croagh et al Stem Cells 2007) CD43 (Kalabis et al J. Clin Invest 2008) Human tissues & cell lines: GPR49 (Lgr5) (Yang et al Proc. AACR, abstract, 2009) None (CD24, CD29, CD34, CD44, (Grotenhuis et al J. Pathol 2010) CD133, CD166, EpCAM, β-catenin) Musashi-1 (Bobryshev et al Dis. Esoph 2010) Mid-IR spectrum (Zhao et al Analyst 2010) Bone Marrow-derived cells (Hutchinson et al Stem Cells Dev. 2011) CD44 / CD24 (OE19, OE33 cell lines) (Honing et al Proc. AACR, abstract, 2012)
5 RATIONALE, OBJECTIVES, MODEL Changing epidemiology / poor outcomes associated with esophageal malignancy Improved understanding of esophageal tumor biology, specifically to identify subpopulations of cancer stem-like cells Human esophageal cell lines derived from: Primary esophageal adenocarcinomas OE33 JH-EsoAd1 (Rockett et al Br. J. Cancer 1997; ECCC, Porton Down UK) (Alvarez et al Cancer Biol. Ther. 2008; Johns Hopkins) Immortalized normal esophageal epithelium Het-1A (Stoner et al Cancer Res 1991; ATCC, Manassas VA)
6 METHODS Esophageal cells grown in serum-free media to form spheres (enriched with stem-like cells) Parent cells Spheroids Flow cytometry, cell sorting (CD24, CD34, CD44, CD71, CD133, EpCAM, integrin α6, Musashi-1, Oct4) Soft-agar colony formation assays (clonogenicity) Xenotransplantation (tumorigenicity, immunohistochemistry) Cell proliferation / MTT assays (chemosensitivity to Cisplatin & 5-Fu) PCR array (mrna expression of 253 cancer stem cell related genes; SABiosciences) Western Blot analysis (protein expression of selected genes)
7 RESULTS: Clonogenicity All Het-1A, OE33 and JH-EsoAd1 cells (parent & spheroids) formed colonies in soft agar. Spheroids exhibited significantly enhanced clonogenicity compared with parent cells Estimated frequencies were quantitated using Extreme Limiting Dilution Analysis (ELDA) Hu & Smyth J. Immunol. Methods 2009 lones / number of cells X100% Number of cl cells Het-1A spheroid cells OE33 Cell line PARENT CELLS Median frequency x 10 5 (95% CI) Het-1A 1 / 51.5 (1 / / 28.5) OE33 1 / 49.4 (1 / / 28.5) JH-EsoAd1 1 / (1 / / 94.2) SPHEROID CELLS Median frequency x 10 5 (95% CI) 1 / 8.1 (1 / / 4.3) 1 / 15.1 (1 / / 8.6) 1 / 72.4 (1 / / 42.2) P-value <0.01 <0.01 <0.05
8 RESULTS: Tumorigenicity No xenograft tumors from Het-1A cells (parent or spheroids) Cell line (termination) PARENT CELLS Number of Tumors (%) PARENT CELLS Median tumor volume (mm 3 ) SPHEROID Number of Tumors (%) SPHEROID Median tumor volume (mm 3 ) OE33 (29 weeks) 2 / 15 (13%) / 15 (40%) JH-EsoAd1 (13 6 / / 15 weeks) (40%) (87%) 500 1,098 All xenografts were adenocarcinomas (spheroids higher grade) CD71 & CD133 negative; Positive staining for CD44 & Integrin α6 Increased frequency of tumors resulting from spheroids (Kaplan-Meier & ELDA) Cell line PARENT CELLS Median frequency x 10 5 (95% CI) OE33 1 / 36.1 (1 / / 8.9) JH-EsoAd1 1 / 4.6 (1 / / 1.9) SPHEROIDS Median frequency x 10 5 (95% CI) 1 / 8.7 (1 / /3.7) 1 / 0.4 (1 / / 0.1) P-value 0.06 <0.05
9 RESULTS: Chemosensitivity Compared with parent cells, spheroids: had lower proliferation rates were resistant to 5-Fu For Cisplatin (CDDP): Het-1A & OE33 spheroids were resistant JH-EsoAd1 spheroid and parent cells exhibited similar chemosensitivity
10 RESULTS: Cell surface markers - 1 NEGATIVE: CD24 CD34 CD133 HIGH POSITIVITY: CD44 (>90%) Oct 4 MODERATE POSITIVITY: Musashi-1 (30-70%) CD71 Integrin α6 Het-1A (5.0%) (regulates cell adhesion in the ECM) OE33 (0.2%) JH-EsoAd1 (44%) Integrin α6 bright / CD71 dim Het-1A (0.11%) OE33 (0.01%) JH-EsoAd1 (0.21%)
11 RESULTS: Cell surface markers - 2 Integrin α6 bright / CD71 dim Het-1A OE33 JH-EsoAd1 Parent 0.11 % 0.01% 0.21% Spheroid 21.3% 5.73% 11.3% Subpopulations of Het-1A, OE33 and JH-EsoAd1 cells expressing Integrin α6 bright / CD71 dim were found to have enhanced clonogenicity and spherogenicity Reported to enrich stem-like progenitor cells in: Human keratinocytes (Terunuma et al Stem Cells 2007) Human cornea (Hayashi et al Biochem. Biophys. Res. Comm. 2008) Murine esophageal basal cells (Croagh et al Stem Cells 2007) Musashi-1: No differences between parent cells or spheroids
12 RESULTS: mrna expression profiles & Western analysis Ascl2 (Achaete-schute complex homolog 2) direct transcriptional target of Wnt regulates cell proliferation by modulating cell cycle progression at G2/M overexpressed in colorectal adenocarcinomas implicated in maintenance of human intestinal stem cells & drug resistance (5-Fu) Lgr5 expression was consistently negative in all cell lines (parent & spheroids) and xenografts
13 SUMMARY & CONCLUSIONS 1. Human esophageal cells grown in serum-free media to form spheroids exhibited increased clonogenicity, tumorigenicity and drug resistance, reflecting enrichment of stem-like cell populations. 2. Esophageal cells enriched for Integrin α6 bright / CD71 dim and/or overexpressing Ascl2 would appear to represent a subpopulation of stem-like cells. 3. Limitations of human cell line / spheroid models. These findings should be considered preliminary, and require confirmation in human tissues. 4. The role of stem cells in human solid tumors remains controversial. Future studies will lead to an improved understanding of fundamental esophageal tumor biology with potential to direct future therapeutic strategies. Funded, in part, by the Saskatchewan Health Research Foundation, the Jean Murray Cancer Research Trust Fund & the FH Wigmore Trust Fund (College of Medicine)
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Stem Cells. Induced Stem Cells
Induced Stem Cells Stem Cells Mouse and human somatic cells can either be reprogrammed to a pluripotent state or converted to another lineage with a combination of transcription factors suggesting that
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Characteristics of Cancer Stem Cells (CSCs)
GENReports: Market & Tech Analysis Characteristics of Cancer Stem Cells (CSCs) > Enal Razvi, Ph.D. Biotechnology Analyst, Managing Director Select Biosciences, Inc. enal@selectbio.us! Topic,IntroducEon,and,Scope!
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
CRIPTO-1 A POSSIBLE NEW BIOMARKER IN GLIOBLASTOMA MULTIFORME PIA OLESEN, MD, PHD STUDENT
CRIPTO-1 A POSSIBLE NEW BIOMARKER IN GLIOBLASTOMA MULTIFORME PIA OLESEN, MD, PHD STUDENT Glioblastoma WHO Grade IV Glioma Heterogenic Undiffenrentiated phenotype 50% of all Gliomas Around 600 patients
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Supplementary Material
Supplementary Material Fig. S1. Gpa33 -/- mice do not express Gpa33 mrna or GPA33 protein. (A) The Gpa33 null allele contains a premature translational stop codon (STOP) in exon 2, and almost all of the
Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
Differential Connexin Function Enhances Self-Renewal in Glioblastoma
CSU ID: 2558414 Name: Sonal Patel Differential Connexin Function Enhances Self-Renewal in Glioblastoma Cancer is one of the most common disease in the US with more than a million people affected every
Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
IN VITRO AND IN VIVO CHARACTERIZATION OF CANCER STEM CELLS IN PRIMARY COLORECTAL CANCER MODELS
IN VITRO AND IN VIVO CHARACTERIZATION OF CANCER STEM CELLS IN PRIMARY COLORECTAL CANCER MODELS An Internship Report Presented to the Faculty of the Biology Program California State University Channel Islands
A subpopulation of CD24 + cells in colon cancer cell lines possess stem cell characteristics
282 Neoplasma 59, 3, 2012 doi:10.4149/neo_2012_036 A subpopulation of CD24 + cells in colon cancer cell lines possess stem cell characteristics J. KE, X. WU, X. WU, X. HE, L. LIAN, Y. ZOU, X. HE, H. WANG,
Material and Methods. Flow Cytometry Analyses:
Material and Methods Flow Cytometry Analyses: Immunostaining of breast cancer cells for HER2 was performed by incubating cells with anti- HER2/neu APC (Biosciences, Cat# 340554), anti-her2/neu PE (Biosciences,
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We
Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Supporting Information
Supporting Information CD200 Expressing Human Basal Cell Carcinoma Cells Initiate Tumor Growth Chantal S Colmont 1, Antisar BenKetah 1, Simon H Reed 2, Nga Voong 3, William Telford 3, Manabu Ohyama 4,
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Stem Cells and Novel Targeted Therapeutics in Cancer
Stem Cells and Novel Targeted Therapeutics in Cancer David M. Jablons, M.D. Professor and Chief Thoracic Surgery Ada Distinguished Professor of Thoracic Oncology Helen Diller Family Comprehensive Cancer
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer
Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,
September 20, Submitted electronically to: Cc: To Whom It May Concern:
History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Problem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
Therapeutic implications of cancer stem cells. Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles
Therapeutic implications of cancer stem cells Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles Stem cell properties Differentiation Self-renewal Tumor
Cancer Stem Cells & Glioblastoma
Cancer Stem Cells & Glioblastoma JP Hugnot «Brain plasticity, Neural stem cells and Glial tumors» INSERM U1051-UM2 Institut des Neurosciences de Montpellier Montpellier 1-Stem cells and Brain Stem Cells
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines Dra Martha Robles Flores Department of Biochemistry Facultad de Medicina Universidad Nacional Autónoma de México Tissue anatomy of the
Summary and Concluding Remarks
Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example
Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Dennis J Slamon, MD, PhD Professor of Medicine Chief, Division of Hematology/Oncology; Director of Clinical/Translational
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval
Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult
MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer
The Journal of Clinical Investigation Research article MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer Mick D. Edmonds, 1 Kelli L. Boyd, 1 Tamara Moyo, 2 Ramkrishna
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Supporting Information online
Supporting Information online THE RIVER BLINDNESS DRUG IVERMECTIN AND RELATED MACROCYCLIC LACTONES INHIBIT WNT-TCF PATHWAY RESPONSES IN HUMAN CANCER Alice Melotti, Christophe Mas, Monika Kuciak, Aiala
Stacey J. Butler. A Thesis presented to The University of Guelph
Characterization of human colorectal cancer stem cells and their role in chemoresistance by Stacey J. Butler A Thesis presented to The University of Guelph In partial fulfillment of requirements for the
Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop
Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Jan 7 th and 8 th, 2014 Brigitte Gomperts, MD University of California, Los Angeles Lung Structure and Function Airway Epithelial
Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness
Manuscript EMBO-2012-83706 Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness Gaëlle Lapouge, Benjamin Beck, Dany Nassar, Christine Dubois, Sophie Dekoninck
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
ANAT3231: lectures overview
ANAT3231: lectures overview Stem Cell Biology Stem Cell Technology Resources: http://php.med.unsw.edu.au/cell biology/ Essential Cell Biology 3 rd edition Alberts Dr Annemiek Beverdam School of Medical
Enterprise Interest Nothing to declare
Enterprise Interest Nothing to declare Update of mixed tumours of the GI tract, the pancreas and the liver Introduction to the concept of mixed tumours and clinical implication Jean-Yves SCOAZEC Surgical
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
EHA an overview. Christine Chomienne EHA President.
EHA an overview Christine Chomienne EHA President www.ehaweb.org EHA activities Career development Calls are open now EHA Learning Center Annual congress EHA promotes excellence in research, education
From crypt stem cell to colorectal cancer
19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0321-05 ( 510405) Wnt Notch BMP R735.35; R730.21 A From crypt stem cell to colorectal cancer WEN Bin*, CHEN Weiwen
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
The Beauty of the Skin
The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion
ANAT3231: lectures overview
ANAT3231: lectures overview Stem Cell Biology Stem Cell Technology Resources: http://php.med.unsw.edu.au/cell biology/ Essential Cell Biology 3 rd edition Alberts Dr Annemiek Beverdam School of Medical
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML)
Campbell Drohan BIOL 463 December 2016 The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Introduction Epigenetic modifications of DNA and histones are key to gene regulation
OMP-305B83: A Novel, Potent DLL4 & VEGF Targeting Bispecific Antibody for the Treatment Of Solid Tumors
OMP-305B83: A Novel, Potent DLL4 & VEGF Targeting Bispecific Antibody for the Treatment Of Solid Tumors Jakob Dupont MD MA CMO, SVP: OncoMed Pharmaceuticals Adjunct Clinical Faculty: Stanford University
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Regulation of Ovarian Cancer Stem Cells or Tumor-Initiating Cells
Int. J. Mol. Sci. 2013, 14, 6624-6648; doi:10.3390/ijms14046624 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Regulation of Ovarian Cancer Stem
Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples
Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this study the authors analysed 18 deep penetrating nevi for oncogenic genomic changes (single nucleotide variations, insertions/deletions,
World Congress on Breast Cancer
World Congress on Breast Cancer 05.08.2015 How pregnancy at early age protects against breast cancer Fabienne Meier-Abt, MD PhD Background: Early age pregnancy protects against breast cancer. MacMahon,
Cell Polarity and Cancer
Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways
The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer
The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department
A NOVEL CANCER STEM CELL (CSC) DRUG DISCOVERY PLATFORM. Collaborative Opportunity
A NOVEL CANCER STEM CELL (CSC) DRUG DISCOVERY PLATFORM Collaborative Opportunity March 2014 PURPOSE Cancer Research UK funded Investigators have established in vitro and in vivo models of CSCs for use
LGR5, a novel functional glioma stem cell marker, promotes EMT by activating the Wnt/β-catenin pathway and predicts poor survival of glioma patients
Zhang et al. Journal of Experimental & Clinical Cancer Research (2018) 37:225 https://doi.org/10.1186/s13046-018-0864-6 RESEARCH Open Access LGR5, a novel functional glioma stem cell marker, promotes EMT
Chapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Module 3: Multiple Myeloma Induction and Transplant Strategies Treatment Planning
Module 3: Multiple Myeloma Induction and Transplant Strategies Treatment Planning Challenge Question: Role of Autologous Stem Cell Transplant Which of the following is true about eligibility for high-dose
NEW IHC A n t i b o d i e s
NEW IHC Antibodies TABLE OF CONTENTS NEW IHC ANTIBODIES from Cell Marque CITED1 (5H6).... 1 Claudin 7 (5D10F3).... 1 GATA1 (4F5).... 1 Transgelin (2A10C2).... 1 NEW IHC ANTIBODIES using RabMAb Technology
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway
Int J Clin Exp Pathol 2015;8(2):1419-1426 www.ijcep.com /ISSN:1936-2625/IJCEP0004445 Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Ke Yang 1*,
TUMOR INITIATING CELLS: THE STEM CELL THEORY OF CANCER
Pr John DE VOS Département d Ingénierie Cellulaire et Tissulaire INSERM 1183 - IRMB Hôpital St Eloi - CHU de Montpellier john.devos@inserm.fr @_jdevos_ TUMOR INITIATING CELLS: THE STEM CELL THEORY OF CANCER
Basement membrane in lobule.
Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.
Radiation Oncology. Initial Certification Qualifying (Computer-based) Examination: Study Guide for Radiation and Cancer Biology
Radiation Oncology Initial Certification Qualifying (Computer-based) Examination: Study Guide for Radiation and Cancer Biology This exam tests your knowledge of the principles of cancer and radiation biology
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
TITLE: A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization
AWARD NUMBER: W81XWH-16-1-0174 TITLE: A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING
Treating patients affordably: personalized medicine in India
economic Treating patients affordably: personalized medicine in India biologic B Moni Abraham Kuriakose MB ChB, MD, FDSRCS, FFDRCS, FRCS Ed., FRCS, Dip AB Professor and Director, Department of Surgical
Neoplasia 18 lecture 6. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 6 Dr Heyam Awad MD, FRCPath ILOS 1. understand the role of TGF beta, contact inhibition and APC in tumorigenesis. 2. implement the above knowledge in understanding histopathology reports.
Increased risk of cancer with anti-diabetes drugs? : pros
24 th Spring Congress of Korean Diabetes Association Increased risk of cancer with anti-diabetes drugs? : pros Nan Hee Kim, MD, Ph.D. Professor Korea University Medical School Contents Diabetes and cancer
Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer
AD Award Number: W81XWH-12-1-0322 TITLE: Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer PRINCIPAL INVESTIGATOR: Kufe, Donald W., M.D. CONTRACTING ORGANIZATION: Boston, MA 02215-5450
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-04-1-0618 TITLE: Are Breast Tumor Stem Cells Responsible for Metastasis and Angiogenesis PRINCIPAL INVESTIGATOR: Quintin Pan, Ph.D. CONTRACTING ORGANIZATION: University of Michigan
Cancer stem cells old concepts, new insights
Review (2008) 15, 947 958 & 2008 Nature Publishing Group All rights reserved 1350-9047/08 $30.00 www.nature.com/cdd Cancer stem cells old concepts, new insights L Vermeulen 1, MR Sprick 1, K Kemper 1,