Tissue- and stratum-specific expression of the human involucrin promoter in transgenic mice (epidermis/keratinocyte)

Transcription

1 Proc Natl Acad Sc USA Vol 9, pp , November 1993 Bochemstry Tssue and stratumspecfc expresson of the human nvolucrn promoter n transgenc mce (epderms/keratnocyte) JOSEPH M CARROLL, KATHRYN M ALBERSt, JONATHAN A GARLCK, ROBN HARRNGTON, AND LORNE B TACHMANS Department of Oral Bology and Pathology, School of Dental Medcne, State Unversty of New York, Stony Brook, NY mmuncated by Wllam J Lennarz, August 2, 1993 (receved for revew May 2, 1993) ABSTRACT nvolucrn s a marker of keratnocyte termnal dfferentaton and s expressed only n the suprabasal layers of stratfed squamous epthelum n a prevous study wth varous cell types n culture, we noted that expresson of the putatve human nvolucrn promoter was keratnocyte specfc To determne f ths promoter s suffcent to drect expresson to the suprabasal cells of stratfed squamous epthela n vvo, we have now generated transgenc mouse lnes harborng the nvolucrn promoter sequences lnked to a (3galactosdase reporter gene n the resultng lnes, galactosdase was expressed n the suprabasal compartment of stratfed squamous epthela and n har follcles n a tssuespecfc manner n the palate, dstnct vertcal stacks of 3galactosdaseexpressng cells were present, suggestng movement of clonally derved ceus through the epthelum The nvolucrn gene has a sngle ntron upstream of the translatonal start ste, and removal of ths ntron dd not affect tssue or stratumspecfc expresson These results show that the 37kb nvolucrn upstream sequences contan all the nformaton necessary for a hgh level of tssue and stratumspecfc expresson Keratnocytes n stratfed squamous epthela exhbt specfc patterns of gene expresson as they undergo a progressve termnal dfferentaton durng movement from the basal layer to the surface (1, 2) One gene expressed n suprabasal cells of ths tssue encodes nvolucrn (3) nvolucrn s a component of the cornfed envelope of stratfed squamous epthela (35) and s a substrate, as are other envelope precursors, for transglutamnasemedated enzymatc crosslnkng (for revews see refs 6 and 7) n humans, the nvolucrn gene has been shown to consst of a short noncodng exon, a sngle ntron, and a sngle exon contanng the entre codng regon (8) Although much s known about the functon and evoluton of nvolucrn proten (9), lttle s known about how the nvolucrn gene s regulated, other than a recent report of a phorbol 12myrstate 13acetateresponsve element n the promoter (1) The onset of nvolucrn proten expresson n vtro s related to the appearance of nvolucrn RNA n dfferentatng keratnocytes (11) Although nvolucrn proten s detected at varous levels of stratfcaton dependng on the ste of tssue orgn, t s nvarably expressed at some pont n the spnous layer (12) Unlke other markers of termnal dfferentaton, such as the K1/K1 keratns (13) or lorcrn (14), nvolucrn appears to be resstant to the effects of agents whch alter keratnocyte gene expresson For example, nvolucrn s syntheszed n submerged cultures of keratnocytes (3) even though n these cultures there s no K1/K1 (15), no lorcrn (16), few cornfed envelopes, and no stratum corneum Even when stratfcaton s nhbted by low concentratons of The publcaton costs of ths artcle were defrayed n part by page charge payment Ths artcle must therefore be hereby marked "advertsement" n accordance wth 18 USC 1734 solely to ndcate ths fact 127 calcum n the medum, nvolucrn contnues to be expressed n a small fracton of cells n the basal layer (17) n raft cultures, where tssue dfferentaton s mproved, treatment wth retnoc acd suppresses both lorcrn and transglutamnase expresson (14, 18), whereas n the ntact skn applcatons of retnoc acd result n an apparent ncrease n nvolucrn stanng (19) n healng epderms (2), as well as psorass (21, 22), there s gross dsrupton of keratnocyte dfferentaton, yet nvolucrn expresson appears prematurely but wthn the confnes of the spnous layer Because nvolucrn expresson n normal epderms s lkely to be regulated at the transcrptonal level (11), analyss of ts promoter s lkely to provde nsghts nto why nvolucrn s not regulated n the same way as other markers of dfferentaton n an n vtro study of the nvolucrn upstream regon we noted that a 37kb fragment conferred keratnocytespecfc expresson n transent assays (23) To determne fths 37kb fragment encoded tssue and stratum specfcty, transgenc mouse lnes were generated wth ths construct lnked to a,b3galactosdase ((3gal) reporter gene n the transgenc mce examned, reporter gene expresson was confned to suprabasal cells of stratfed squamous epthela, and nterestng patterns of expresson were noted n nternal epthela MATERALS AND METHODS Plasmd nstructon for the Transgenes The construct used n ths study s derved from pnass,b pl (23) and, as shown n Fg 1A, ncludes the 37kb nvolucrn sequences, a sman vrus 4 (SV4) ntron, the f(3gal gene, and an SV4 poly(a) sgnal sequence The Hnd ste on the 5' end represents a ste 25 kb upstream of the nvolucrn transcrptonal start ste A second construct lackng the nvolucrn ntron was used and s shown n Fg 1B Preparaton of Transgenc Mce The nvolucrn expresson cassette was solated on a 8% agarose (Boehrnger Mannhem) gel, extracted from the gel by usng Geneclean glassmlk (Bo 11) purfcaton, run through an NACS52 Prepac column (Bethesda Research Laboratores), precptated wth ethanol, resuspended n Ca and Mgfree phosphatebuffered salne (PBS) at a concentraton of 5 pg/ml, and mcronjected nto mouse embryos (stran C3HB6 Fl; HarlanSpragueDawley) njectons and mplantatons were Abbrevatons: 3gal, 3galactosdase; SV4, sman vrus 4; RT, reverse transcrptase; XGal, 5bromo4chloro3ndolyl P3Dgalactopyranosde Present address: mperal Cancer Research Fund, Keratnocyte Laboratory, PO Box 123, Lncoln's nn Felds, London WC2A 3PX, England tpresent address: Department of Pathology, Luclle P Markey Cancer Center, Unversty of Kentucky, Lexngton, KY 4536 To whom reprnt requests should be addressed at: Department of Oral Bology and Pathology, Westchester Hall, State Unversty of New York, Stony Brook, NY

2 Bochemstry: Carroll et al A, l!2olr!promote B vluvhcrn stronm cl volver Prooter =o TAG Sol SV4O lntro ATG knsv4 ntron B gal Proc Natl Acad Sc USA 9 (1993) 1271 Depctons of transgene constructons Sal fragments of nvolucrn upstream sequences n plasmd pnassppl2 are shown The FG 1 construct n A encompasses 37 kb of the upstream sequences and contans the nvolucrn ntron, whereas the construct n B lacks the 1188bp nvolucrn ntron Both transgenes contan the SV4 16S/19S ntron and a SV4 poly(a)+ sgnal carred out by usng standard protocols (24) For mouse screenngs, genomc DNA was solated from ears of 4weekold mce and polymerase chan reacton (PCR) analyss was performed wth (3gal prmers Prmers to the (3gal (lacz) gene were chosen to yeld a fragment of 68 bp (upstream prmer, 5'TGCGTGACTACCTACGGGTAACAGT; downstream prmer, 5'GATCGACAGATTTGATCCAG CGATA) DNApostve lnes were then hstochemcally screened for 5bromo4chloro3ndolyl (Dgalactosde (X Gal) expresson n the tal epderms (see XGal Hstochemstry below) One founder (3682) wth ntense (3gal stanng was outbred to generate an F1 lne whch was used for all subsequent analyss Southern Analyss Genomc DNA solated from tals was dgested wth BamH, whch cuts twce wthn the transgene to yeld a 4kb band, and the resultant DNA was electrophoresed on a 1% agarose gel After blottng to ntrocellulose, flters were ncubated wth a 635bp 32Plabeled (gal probe, washed, and exposed to xray flm py number was estmated by comparng band ntenstes, as measured wth a laser denstometer, to known standards of the 4kb (gal fragment, and varatons n loadng were assessed by reprobng the blots for the snglecopy (3actn gene band RNA Analyss Total RNA was solated from the organs of 4 to 1weekold F1 mce by usng RNAzolB reagent (Cnna/ Botecx Laboratores, Houston), followed by dgeston wth DNase and precptaton wth ethanol A reverse transcrptase (RT)PCR kt (PerknElmer/Cetus) and random prmers were used to amplfy 5,g of total RNA to cdna Half of the reacton mxture was subjected to PCR usng 3gal prmers and half to PCR usng actn prmers to determne f comparable amounts of RNA were present n all tssues The (gal prmers yelded a 68bp band, and the actn prmers yelded a 217bp band RNA was mockpcr amplfed (no reverse transcrpton) to ensure that all traces of DNA were removed XGal Hstochemstry Tssue was harvested from mce and placed overnght n a soluton of 3o sucrose n PBS The next day tssue samples were snap frozen at 7 C n OCT embeddng compound (TssueTek, Mles) and 8,umthck sectons were cut by usng a Rechert Hstostat Cryostat (model 855) and placed on gelatncoated sldes Sectons were postfxed for 1 mn n 2% paraformaldehyde, washed, and staned en face wth XGal (25) After stanng n XGal soluton for 2 hr at 37 C, sldes were rnsed and counterstaned by means of the Feulgen reacton (usng the Schff reagent) Nontransgenc mouse tssues were also staned to assess endogenous (3gal actvty RESULTS Generaton of Transgenc Mce Transgenc mce were generated wth an expresson vector contanng the nvolucrn upstream sequence, an SV4 ntron, the (gal codng regon, and an SV4 poly(a)+ sequence (Fg 1A and ref 23) Baa Three to fve weeks after brth, 35 founder mce were screened for (3gal sequences and 4 postve mce were detected These were further screened for (gal expresson by usng XGal hstochemcal stanng on tal skn Transgene copy number n the DNApostve founders was determned by Southern analyss and was 25 copes per cell (Fg 2) The ntensty of XGal stanng n tal skn dd not correlate wth transgene copy number For example, lne 3592 wth approxmately 42 copes per cell had very lght XGal stanng, whereas lne 3536 wth approxmately 2 copes per cell had qute ntense stanng Lne 3681, whch was negatve for (3gal DNA, was also negatve for XGal stanng Mouse lne 3682 was chosen for further study as prelmnary examnaton of tal skn showed that stanng was more ntense and more unformly dstrbuted than n the other founder mce Lne 3682 had approxmately 41 copes of the transgene per cell To avod the possblty of mosac expresson sometmes seen n founder mce (26), all further analyss oflne 3682 was performed on F1 offsprng derved by matng wth outbred stran C3H Tssue and StratumSpecfc Transgene Expresson To determne the tssue dstrbuton of transgene expresson, total RNA was solated from varous tssues of mouse lne 3682 and subjected to RTPCR amplfcaton Results are shown n Fg 3 Mouse (actn RNA served as a postve control and yelded a PCR band of 217 bp of smlar ntensty n all tssues An ntense 68bp (gal band was observed n cn cd C) SV4pAO \ r T 11 M4 1 SV4O PA aa Sol Cu c) CY) Sal cb co ) C\J CU C\J py Number FG 2 Southern analyss of transgenc DNA from founder mce Samples (2,g) ofgenomc DNA solated from the ears of fve founder lnes were dgested wth BamH, electrophoresed, and blotted to ntrocelulose The blot was probed wth a 635bp 32Plabeled,Bgal probe, washed, and exposed to xray flm To calbrate for copy number, DNA derved from plasmd pnassfpl2 was electrophoresed at two concentratons (far rght) Blots were strpped and reprobed wth a mouse /actn gene probe (not shown) representng a snglecopy gene n each lane The ntensty of the bands was scanned wth a laser denstometer and the ntensty was compared to known copy number amounts of plasmd pnass,bpl2 (after adjustng for ntensty of mouse,actn sgnal) The approxmate copy number of the transgene was then noted n the bottom of the fgure One founder lne, 3681, was negatve for (3gal DNA and s ncluded here as a negatve control pl2

3 1272 Bochemstry: Caffoll et al a 'Z a e _ h 2 L O c P 1 C) gal actn FG 3 RTPCR analyss of tssuespecfc expresson patterns n transgenc mce Samples (5 pg) of total RNA solated from varous mouse tssues of lne 3682 were reverse transcrbed randomly and amplfed wth ether pgal prmers or mouse 3actn prmers by 3 cycles of PCR The products were then electrophoresed on a 2% agarose gel and staned wth ethdum bromde The postve control s RNA solated from keratnocytes transfected n vtro wth the transgene (see ref 23) tssues or organs whch have stratfed squamous epthela However, n bran, heart, and lver, organs whch have no stratfed squamous epthela, the 68bp band was not detected These results ndcate that transgene expresson was tssue specfc Hstochemcal stanng of the skn of tal, dorsum, maxlla, ear, pens, and footpad ndcated that the transgene was always expressed n the suprabasal layer, begnnng at some pont n the spnous layer Ths s llustrated for the skn of the tal and dorsum, where a unform and ntense blue stanng was seen throughout the suprabasal layers (Fg 4 A and B) Har follcles were also noted to stan ntensely, and the locaton of stanng (data not shown) was smlar to that noted for nvolucrn proten n human har follcles (27) nternal organs wth smple epthelalver, kdney, and lungswere negatve for (3gal expresson, as was muscle The stratfed squamous epthela of nternal organs (palate, buccal mucosa, tongue, esophagus, forestomach, and cervx) were postve, as was the stratfed urothelum of bladder Three of thesepalate, buccal mucosa, and cervxare shown n Fg 4 C, D, and E XGal stanng was generally present n the suprabasal layers, although the stanng pattern of these nternal epthela was somewhat less unform than n the epderms n fact, n the hard palate, stacks of staned cells appeared as a cluster of one or several cells, begnnng n the mmedate suprabasal layer and extendng upwards to the surface as an expandng vertcal column of cells (see arrows n Fg 4C) These ordered stacks are remnscent of the vertcal columns of cornfed cells seen n normal mouse epderms (28) Close examnaton of the base of these columns suggests that basal cells exhbt (3gal stanng, but t s not certan f the basal locaton of these cells s a result of the plane of tssue secton These hstochemcal results ndcate that the 37kb nvolucrn promoter sequence can drect stratumspecfc expresson n vvo and, when consdered along wth the RNA expresson pattern (Fg 3), confrm tssuespecfc expresson The nvolucrn gene has a sngle ntron located between the transcrptonal and translatonal start stes (8) n transent assays n cultured keratnocytes, removal of ths ntron results n a dramatc reducton of expresson (23) As ntrons n ths upstream locaton ste are known to have regulatory actvty (29), we quered f the nvolucrn ntron was requred for tssue and stratumspecfc expresson Several lnes of mce were constructed wth 25 kb of nvolucrn upstream Proc Natl Acad Sc USA 9 (1993) sequences wthout the nvolucrn ntron (Fg 1B) Of these lnes, lne 3672 (contanng approxmately 3 copes of the transgene) exhbted the most ntense stanng and was bred for further analyss t should be noted that an SV4 ntron was present n the upstream regon of ths construct to ensure that a splcng event dd take place RTPCR analyss ofrna extracted from an F1 dervatve of the 3672 founder ndcated that, as n lne 3682, (gal RNA was present only n organs havng stratfed squamous epthela (data not shown) Hstochemcal analyss of skn and oral mucosa of lne 3672 revealed XGal stanng confned to suprabasal cells of the epthela (stanng of buccal mucosa shown n Fg 4F) Stanng n the epderms of lne 3672 was patchy and notceably less ntense compared wth stanng n lne 3682 t s evdent that the nvolucrn ntron s not requred for stratumspecfc expresson The reduced levels of transgene expresson n mouse lne 3672 made an analyss of tssue specfcty less meanngful, but when expresson was detected, ether by hstochemstry or by RNA analyss (data not shown), t was always n stratfed squamous epthela The nvolucrn ntron s therefore not essental for tssuespecfc expresson, although ts presence n the promoter appears to ensure hgh expresson n all tssues DSCUSSON To determne f a 37kb segment of DNA upstream of the nvolucrn codng regon was suffcent for tssue and stratumspecfc expresson n vvo, ths segment was lnked to a,(3gal reporter gene and used n the constructon of transgenc mce Expresson n the resultng mce was confned to the suprabasal cells of stratfed squamous epthelum, thereby demonstratng ts promoter regulatory role n vvo The nvolucrn promoter therefore jons wth the human K5, K14, and K promoters, as well as the bovne K1 promoter, n beng correctly expressed wth both tssue and stratum specfcty n stratfed epthela of transgenc mce (26, 332) n human epderms, as well as n the epderms of transgenc mce, K14 s expressed n the basal layer, whle Kl and K1 are expressed n the suprabasal cells (33) The K14 promoter has been partcularly useful n explorng the pathologcal consequences of expresson of a mutant of K14 keratn and n dentfyng human dsease correlates of ths keratn (34) Although a 12kb fragment of the Kl promoter gves correct tssue and stratumspecfc expresson n transgenc mce, t fals to respond as the endogenous mouse Kl promoter to modulators of keratnocyte dfferentaton, suggestng that addtonal sequences are needed to medate the correct responses (31) As dscussed n the ntroducton, nvolucrn s consttutvely expressed durng dfferentaton and s not subject to modulaton n the same way as are other markers of dfferentaton Analyss of the nvolucrn transgene promoter s therefore lkely to lead to clues as to how these dfferent forms of regulaton are acheved nvolucrn (35) and several other precursors of the cornfled envelope that are expressed specfcally n dfferentatng keratnocytes map to chromosome locaton 1q21 These protens nclude lorcrn [a precursor of the cornfed envelope (36)], trchohyaln [an ntermedate flamentassocated proten of hard keratn (37)], and proflaggrn [a flament aggregatng proten (38)] The clusterng of these genes at chromosomal locaton 1q21 s remnscent of the globn gene cluster on human chromosome 11 (39) The codng regons of each of these keratnocyte genes contan a multple repeat subunt structure and have no ntrons n all cases there s an ntron located upstream of the translatonal start ste, and n the case of proflaggrn, a second ntron les further upstream n the noncodng regon The smlar ntron organzaton and the genetc lnkage of these genes suggest that these ntrons have provded some essental functon n that locaton to be

4 W3q4;,Jz~M)'_: ~t'6vf 1273 Proc Natl Acad Sc USA 9 (1993) Bochemstry: Carroll et al B A ~~AN A; %s, :, W, 4W V lk, bl t 4 'P, w e l 4 F 1 4a ` '1 t % 6 :: p #' va d ~ ~ ~~~1 A :s D_ C,¼4'%; j > t C 4w,e N t ; A aa, 3 tal ~ p S a 4 ~~~~~~~~~~~~~~~~9 _s 4 F E r,t 4 ; ;' > s _ / t v ' 4tA A~ ~ ~ ~ ~s\t FG 4 XGal stanng (blue) of varous tssues of transgenc mce Stanng was confned to suprabasal cells of all stratfed squamous epthela Har follcles n skn also staned postvely Tssues from transgenc mouse lne 3682 are shown n AE (A) Orthokeratnzng epthelum of the tal cut n cross secton (B) Dorsum of skn (C) Palate (D) Buccal mucosa (E) Cervx Buccal mucosa from transgenc mouse lne 3672 s shown n F Lne 3672 was constructed wth a transgene lackng the nvolucrn ntron Tssues between the ages of 12 and 4 weeks (The bars represent 1 gm) so preserved durng evoluton The results of ths study ndcate that the nvolucrn ntron s not essental for tssueor stratumspecfc expresson and may serve some other functon, possbly related to facltatng a hgh level of expresson n certan tssues The ntal ntron n the human keratn 18 gene s known to possess transcrptonal regulatory actvty through an AP1 bndng ste (4) The nvolucrn ntron contans an AP2lke ste, and such stes are requred for epdermalspecfc expresson of keratn 14 (41) The fact that nvolucrn ntron s requred for the hgh level of expresson n vtro (23) lends some support to the hypothess that ths ntron s needed n vvo for hgh expresson were removed from adult mce Stratfed squamous epthelum s a tssue that undergoes contnual loss by desquamaton at the surface and renewal by replcaton of stem cells n the basal layer (42) The progeny of stem cell dvson, ncludng amplfyng cells and termnally dfferentated cells, are organzed nto a spatally conserved unt known as the "epdermal prolferaton unt" or EPU n some regons of the epderms, where keratnzaton s complete and turnover s slow, vertcal columns of cornfed and granular cells are seen and thought to be the progeny of sngle stem cells (28) The vertcal stacks of labeled cells seen n the oral mucosa begnnng n the basal layer and spannng upwards to the surface provde drect vsualzaton of the

5 1274 Bochemstry: CaffoU et al ordered movement of progeny through the tssue Ths also marks the frst tme of whch we are aware that an EPUtype organzaton has been seen n oral mucosa The lack of a stratum corneum n ths noncornfyng tssue has prevented vsualzaton of ordered columns of cornfed cells, as s found n the epderms A smlar columnar pattern has been seen n transgenc mce n whch a K14drected transgene was expressed n a mosac fashon n the basal layer of the epderms and the resultng transgene product was carred along n the progeny cells n the overlyng spnous layer (26) Because the nvolucrn promoter s fathfully expressed n all stratfed squamous epthela and s nsenstve to envronmental nfluences, t mght be partcularly well suted as a vehcle for keratnocytemedated gene therapy (43) Ths mght be valuable for potental medcal applcatons, ncludng drug delvery and correcton of epdermal dsease states The fact that expresson from the nvolucrn promoter s confned to suprabasal spnous and granular cells may also allow targetng of the new gene product to specfc strata whle sparng the basal populaton of cells Note Added n Proof Smlar tssue and dfferentatonspecfc results have been obtaned wth the human nvolucrn promoter n transgenc mce See Crsh et al (44) We thank Franke Davs (Unversty of Kentucky) for expert assstance n constructng transgenc mce and Marca Smon (State Unversty of New York at Stony Brook) for many helpful dscussons We also thank Peter Brnk and Beth Grne (State Unversty ofnew York at Stony Brook) for assstance n preparng hstologcal materal Ths research was supported by Grants DE4511 and DC23 from the Natonal nsttutes of Health JAG s the recpent ofphyscan Scentst Award for Dentsts DE263 from the Natonal nsttute of Dental Research 1 Watt, F M (1989) Curr Opn Cell Bol 1, Fuchs, E (199) Curr Opn Cell Bol 2, Rce, R H & Green, H (1979) Cell 18, Haftek, M, Serre, G, Mls, V & Thvolet, J (1991) J Hstochem Cytochem 399, Yaffe, M B, Murthy, S & Eckert, R L (1993) J nvest Dermatol 1, 39 6 Hohl, D (199) Dermatologca 18, Smon, M (1993) n The Keratnocyte Handbook, eds Legh, M, Watt, F M & Lane, E B (Cambrdge Unv Press, Cambrdge, UK), n press 8 Eckert, R L & Green, H (1986) Cell 46, Green, H & Djan, P (1992) Mol Bol Evol 9, Takahash, H & lzuka, H (1993) J nvest Dermatol 1, Watt, F M & Green, H (1981) J Cell Bol 9, BanksSchlegel, S & Green, H (1981)J CellBol 9, Kopan, R, Traska, G & Fuchs, E (1987) J Cell Bol 15, Magnaldo, T, Bernerd, F, Asselneau, D & Darmon, M (1992) Dfferentaton 49, Fuchs, E & Green, H (1981) Cell 25, Mehrel, T, Hohl, D, Rothnagel, J A, Longley, M A, Bundman, D, Cheng, C, Lcht, U, Bsher, M E, Steven, A C, Proc Natl Acad Sc USA 9 (1993) Stenert, P M, Yuspa, S H & Roop, D R (199) Cell 61, Watt, F M & Green, H (1982) Nature (London) 295, Asselneau, D, Bernard, B A, Bally, C & Darmon, M (1989) Dev Bol 133, Rosenthal, D S, Grffths, C E M, Yuspa, S H, Roop, D R & Voorhees, J J (1992) J nvest Dermatol 98, Mansbrdge, J N & Knapp, A M (1987) J nvest Dermatol 89, Bernard, B A, Reano, A, Darmon, Y M & Thvolet, J (1986) Br J Dermatol 114, Bernerd, F, Magnaldo, T & Darmon, M (1992) J nvest Dermatol 98, Carroll, J M & Tachman, L B (1992) J Cell Sc 13, Hogan, B, nstantn, F & Lucy, E (1986) Manpulatng the Mouse Embryo: A Laboratory Manual (ld Sprng Harbor Lab Press, Planvew, NY) 25 Cepko, C (1989) Neuromethods 16, Vassar, R, Rosenberg, M, Ross, S, Tyner, A & Fuchs, E (1989) Proc Natl Acad Sc USA 86, Hashmoto, T, namoto, N, Nakamura, K & Harada, R (1987) Br J Dermatol 117, Mackenze, C (1969) Nature (London) 222, Kozak, M (1991) J Cell Bol 115, Byrne, C & Fuchs, E (1993) Mol Cell Bol 13, Rosenthal, D S, Stenert, P M, Chung, S, Huff, C A, Johnson, J, Yuspa, S H & Roop, D R (1991) Cell Growth Dffer 2, Balleul, B, Suran, M A, Whte, S, Barton, S C, Brown, K, Blessng, M, Jorcano, J & Balman, A (199) Cell 62, Moll, R, Frnke, W W, Schller, D L, Geger, B & Krepler, R (1982) Cell 31, ulombe, P A, Hutton, M E, Vassar, R & Fuchs, E (1991) J Cell Bol 115, Smon, M, Phllps, M, Green, H, Stroh, H, Glatt, K, Bruns, G & Latt, S A (1989) Am J Hum Genet 45, Yoneda, K, Hold, D, McBrde, W, Wang, M, Cehrs, K U, dler, W W & Stenert, P M (1992) J Bol Chem 267, Lee, SC, Wang, M, McBrde, W, O'Keefe, E J, Km, G & Stenert, P M (1993) J nvest Dermatol 11, McKnleyGrant, L J, dler, W W, Bernsten, A, Parry, D A D, Cannzzaro, L, Croce, C M, Huebner, K, Lessn, S R & Stenert, P M (1989) Proc Natl Acad Sc USA 86, Manats, T, Frtsch, E F, Lauer, J & Lawn, R M (1981) Annu Rev Genet 14, Oshma, R G, Abrams, L & Kulesh, D (199) Genes Dev 4, Leask, A, Byrne, C & Fuchs, E (1991) Proc Natl Acad Sc USA 88, Potten, C S (1981) nt Rev Cytol 69, Carroll, J M, Fenjves, E S, Garlck, J A & Tachman, L B (1993) n Molecular Bology of the Skn: The Keratnocytes, eds Darmon, M & Blumenberg, M (Academc, New York), pp Crsh, J F, Howard, J M, Zam, T M, Murthy, S & Eckert, R L (1993) Dfferentaton 53, 1912