Tissue- and stratum-specific expression of the human involucrin promoter in transgenic mice (epidermis/keratinocyte)
|
|
- Mercy Lawson
- 5 years ago
- Views:
Transcription
1 Proc Natl Acad Sc USA Vol 9, pp , November 1993 Bochemstry Tssue and stratumspecfc expresson of the human nvolucrn promoter n transgenc mce (epderms/keratnocyte) JOSEPH M CARROLL, KATHRYN M ALBERSt, JONATHAN A GARLCK, ROBN HARRNGTON, AND LORNE B TACHMANS Department of Oral Bology and Pathology, School of Dental Medcne, State Unversty of New York, Stony Brook, NY mmuncated by Wllam J Lennarz, August 2, 1993 (receved for revew May 2, 1993) ABSTRACT nvolucrn s a marker of keratnocyte termnal dfferentaton and s expressed only n the suprabasal layers of stratfed squamous epthelum n a prevous study wth varous cell types n culture, we noted that expresson of the putatve human nvolucrn promoter was keratnocyte specfc To determne f ths promoter s suffcent to drect expresson to the suprabasal cells of stratfed squamous epthela n vvo, we have now generated transgenc mouse lnes harborng the nvolucrn promoter sequences lnked to a (3galactosdase reporter gene n the resultng lnes, galactosdase was expressed n the suprabasal compartment of stratfed squamous epthela and n har follcles n a tssuespecfc manner n the palate, dstnct vertcal stacks of 3galactosdaseexpressng cells were present, suggestng movement of clonally derved ceus through the epthelum The nvolucrn gene has a sngle ntron upstream of the translatonal start ste, and removal of ths ntron dd not affect tssue or stratumspecfc expresson These results show that the 37kb nvolucrn upstream sequences contan all the nformaton necessary for a hgh level of tssue and stratumspecfc expresson Keratnocytes n stratfed squamous epthela exhbt specfc patterns of gene expresson as they undergo a progressve termnal dfferentaton durng movement from the basal layer to the surface (1, 2) One gene expressed n suprabasal cells of ths tssue encodes nvolucrn (3) nvolucrn s a component of the cornfed envelope of stratfed squamous epthela (35) and s a substrate, as are other envelope precursors, for transglutamnasemedated enzymatc crosslnkng (for revews see refs 6 and 7) n humans, the nvolucrn gene has been shown to consst of a short noncodng exon, a sngle ntron, and a sngle exon contanng the entre codng regon (8) Although much s known about the functon and evoluton of nvolucrn proten (9), lttle s known about how the nvolucrn gene s regulated, other than a recent report of a phorbol 12myrstate 13acetateresponsve element n the promoter (1) The onset of nvolucrn proten expresson n vtro s related to the appearance of nvolucrn RNA n dfferentatng keratnocytes (11) Although nvolucrn proten s detected at varous levels of stratfcaton dependng on the ste of tssue orgn, t s nvarably expressed at some pont n the spnous layer (12) Unlke other markers of termnal dfferentaton, such as the K1/K1 keratns (13) or lorcrn (14), nvolucrn appears to be resstant to the effects of agents whch alter keratnocyte gene expresson For example, nvolucrn s syntheszed n submerged cultures of keratnocytes (3) even though n these cultures there s no K1/K1 (15), no lorcrn (16), few cornfed envelopes, and no stratum corneum Even when stratfcaton s nhbted by low concentratons of The publcaton costs of ths artcle were defrayed n part by page charge payment Ths artcle must therefore be hereby marked "advertsement" n accordance wth 18 USC 1734 solely to ndcate ths fact 127 calcum n the medum, nvolucrn contnues to be expressed n a small fracton of cells n the basal layer (17) n raft cultures, where tssue dfferentaton s mproved, treatment wth retnoc acd suppresses both lorcrn and transglutamnase expresson (14, 18), whereas n the ntact skn applcatons of retnoc acd result n an apparent ncrease n nvolucrn stanng (19) n healng epderms (2), as well as psorass (21, 22), there s gross dsrupton of keratnocyte dfferentaton, yet nvolucrn expresson appears prematurely but wthn the confnes of the spnous layer Because nvolucrn expresson n normal epderms s lkely to be regulated at the transcrptonal level (11), analyss of ts promoter s lkely to provde nsghts nto why nvolucrn s not regulated n the same way as other markers of dfferentaton n an n vtro study of the nvolucrn upstream regon we noted that a 37kb fragment conferred keratnocytespecfc expresson n transent assays (23) To determne fths 37kb fragment encoded tssue and stratum specfcty, transgenc mouse lnes were generated wth ths construct lnked to a,b3galactosdase ((3gal) reporter gene n the transgenc mce examned, reporter gene expresson was confned to suprabasal cells of stratfed squamous epthela, and nterestng patterns of expresson were noted n nternal epthela MATERALS AND METHODS Plasmd nstructon for the Transgenes The construct used n ths study s derved from pnass,b pl (23) and, as shown n Fg 1A, ncludes the 37kb nvolucrn sequences, a sman vrus 4 (SV4) ntron, the f(3gal gene, and an SV4 poly(a) sgnal sequence The Hnd ste on the 5' end represents a ste 25 kb upstream of the nvolucrn transcrptonal start ste A second construct lackng the nvolucrn ntron was used and s shown n Fg 1B Preparaton of Transgenc Mce The nvolucrn expresson cassette was solated on a 8% agarose (Boehrnger Mannhem) gel, extracted from the gel by usng Geneclean glassmlk (Bo 11) purfcaton, run through an NACS52 Prepac column (Bethesda Research Laboratores), precptated wth ethanol, resuspended n Ca and Mgfree phosphatebuffered salne (PBS) at a concentraton of 5 pg/ml, and mcronjected nto mouse embryos (stran C3HB6 Fl; HarlanSpragueDawley) njectons and mplantatons were Abbrevatons: 3gal, 3galactosdase; SV4, sman vrus 4; RT, reverse transcrptase; XGal, 5bromo4chloro3ndolyl P3Dgalactopyranosde Present address: mperal Cancer Research Fund, Keratnocyte Laboratory, PO Box 123, Lncoln's nn Felds, London WC2A 3PX, England tpresent address: Department of Pathology, Luclle P Markey Cancer Center, Unversty of Kentucky, Lexngton, KY 4536 To whom reprnt requests should be addressed at: Department of Oral Bology and Pathology, Westchester Hall, State Unversty of New York, Stony Brook, NY
2 Bochemstry: Carroll et al A, l!2olr!promote B vluvhcrn stronm cl volver Prooter =o TAG Sol SV4O lntro ATG knsv4 ntron B gal Proc Natl Acad Sc USA 9 (1993) 1271 Depctons of transgene constructons Sal fragments of nvolucrn upstream sequences n plasmd pnassppl2 are shown The FG 1 construct n A encompasses 37 kb of the upstream sequences and contans the nvolucrn ntron, whereas the construct n B lacks the 1188bp nvolucrn ntron Both transgenes contan the SV4 16S/19S ntron and a SV4 poly(a)+ sgnal carred out by usng standard protocols (24) For mouse screenngs, genomc DNA was solated from ears of 4weekold mce and polymerase chan reacton (PCR) analyss was performed wth (3gal prmers Prmers to the (3gal (lacz) gene were chosen to yeld a fragment of 68 bp (upstream prmer, 5'TGCGTGACTACCTACGGGTAACAGT; downstream prmer, 5'GATCGACAGATTTGATCCAG CGATA) DNApostve lnes were then hstochemcally screened for 5bromo4chloro3ndolyl (Dgalactosde (X Gal) expresson n the tal epderms (see XGal Hstochemstry below) One founder (3682) wth ntense (3gal stanng was outbred to generate an F1 lne whch was used for all subsequent analyss Southern Analyss Genomc DNA solated from tals was dgested wth BamH, whch cuts twce wthn the transgene to yeld a 4kb band, and the resultant DNA was electrophoresed on a 1% agarose gel After blottng to ntrocellulose, flters were ncubated wth a 635bp 32Plabeled (gal probe, washed, and exposed to xray flm py number was estmated by comparng band ntenstes, as measured wth a laser denstometer, to known standards of the 4kb (gal fragment, and varatons n loadng were assessed by reprobng the blots for the snglecopy (3actn gene band RNA Analyss Total RNA was solated from the organs of 4 to 1weekold F1 mce by usng RNAzolB reagent (Cnna/ Botecx Laboratores, Houston), followed by dgeston wth DNase and precptaton wth ethanol A reverse transcrptase (RT)PCR kt (PerknElmer/Cetus) and random prmers were used to amplfy 5,g of total RNA to cdna Half of the reacton mxture was subjected to PCR usng 3gal prmers and half to PCR usng actn prmers to determne f comparable amounts of RNA were present n all tssues The (gal prmers yelded a 68bp band, and the actn prmers yelded a 217bp band RNA was mockpcr amplfed (no reverse transcrpton) to ensure that all traces of DNA were removed XGal Hstochemstry Tssue was harvested from mce and placed overnght n a soluton of 3o sucrose n PBS The next day tssue samples were snap frozen at 7 C n OCT embeddng compound (TssueTek, Mles) and 8,umthck sectons were cut by usng a Rechert Hstostat Cryostat (model 855) and placed on gelatncoated sldes Sectons were postfxed for 1 mn n 2% paraformaldehyde, washed, and staned en face wth XGal (25) After stanng n XGal soluton for 2 hr at 37 C, sldes were rnsed and counterstaned by means of the Feulgen reacton (usng the Schff reagent) Nontransgenc mouse tssues were also staned to assess endogenous (3gal actvty RESULTS Generaton of Transgenc Mce Transgenc mce were generated wth an expresson vector contanng the nvolucrn upstream sequence, an SV4 ntron, the (gal codng regon, and an SV4 poly(a)+ sequence (Fg 1A and ref 23) Baa Three to fve weeks after brth, 35 founder mce were screened for (3gal sequences and 4 postve mce were detected These were further screened for (gal expresson by usng XGal hstochemcal stanng on tal skn Transgene copy number n the DNApostve founders was determned by Southern analyss and was 25 copes per cell (Fg 2) The ntensty of XGal stanng n tal skn dd not correlate wth transgene copy number For example, lne 3592 wth approxmately 42 copes per cell had very lght XGal stanng, whereas lne 3536 wth approxmately 2 copes per cell had qute ntense stanng Lne 3681, whch was negatve for (3gal DNA, was also negatve for XGal stanng Mouse lne 3682 was chosen for further study as prelmnary examnaton of tal skn showed that stanng was more ntense and more unformly dstrbuted than n the other founder mce Lne 3682 had approxmately 41 copes of the transgene per cell To avod the possblty of mosac expresson sometmes seen n founder mce (26), all further analyss oflne 3682 was performed on F1 offsprng derved by matng wth outbred stran C3H Tssue and StratumSpecfc Transgene Expresson To determne the tssue dstrbuton of transgene expresson, total RNA was solated from varous tssues of mouse lne 3682 and subjected to RTPCR amplfcaton Results are shown n Fg 3 Mouse (actn RNA served as a postve control and yelded a PCR band of 217 bp of smlar ntensty n all tssues An ntense 68bp (gal band was observed n cn cd C) SV4pAO \ r T 11 M4 1 SV4O PA aa Sol Cu c) CY) Sal cb co ) C\J CU C\J py Number FG 2 Southern analyss of transgenc DNA from founder mce Samples (2,g) ofgenomc DNA solated from the ears of fve founder lnes were dgested wth BamH, electrophoresed, and blotted to ntrocelulose The blot was probed wth a 635bp 32Plabeled,Bgal probe, washed, and exposed to xray flm To calbrate for copy number, DNA derved from plasmd pnassfpl2 was electrophoresed at two concentratons (far rght) Blots were strpped and reprobed wth a mouse /actn gene probe (not shown) representng a snglecopy gene n each lane The ntensty of the bands was scanned wth a laser denstometer and the ntensty was compared to known copy number amounts of plasmd pnass,bpl2 (after adjustng for ntensty of mouse,actn sgnal) The approxmate copy number of the transgene was then noted n the bottom of the fgure One founder lne, 3681, was negatve for (3gal DNA and s ncluded here as a negatve control pl2
3 1272 Bochemstry: Caffoll et al a 'Z a e _ h 2 L O c P 1 C) gal actn FG 3 RTPCR analyss of tssuespecfc expresson patterns n transgenc mce Samples (5 pg) of total RNA solated from varous mouse tssues of lne 3682 were reverse transcrbed randomly and amplfed wth ether pgal prmers or mouse 3actn prmers by 3 cycles of PCR The products were then electrophoresed on a 2% agarose gel and staned wth ethdum bromde The postve control s RNA solated from keratnocytes transfected n vtro wth the transgene (see ref 23) tssues or organs whch have stratfed squamous epthela However, n bran, heart, and lver, organs whch have no stratfed squamous epthela, the 68bp band was not detected These results ndcate that transgene expresson was tssue specfc Hstochemcal stanng of the skn of tal, dorsum, maxlla, ear, pens, and footpad ndcated that the transgene was always expressed n the suprabasal layer, begnnng at some pont n the spnous layer Ths s llustrated for the skn of the tal and dorsum, where a unform and ntense blue stanng was seen throughout the suprabasal layers (Fg 4 A and B) Har follcles were also noted to stan ntensely, and the locaton of stanng (data not shown) was smlar to that noted for nvolucrn proten n human har follcles (27) nternal organs wth smple epthelalver, kdney, and lungswere negatve for (3gal expresson, as was muscle The stratfed squamous epthela of nternal organs (palate, buccal mucosa, tongue, esophagus, forestomach, and cervx) were postve, as was the stratfed urothelum of bladder Three of thesepalate, buccal mucosa, and cervxare shown n Fg 4 C, D, and E XGal stanng was generally present n the suprabasal layers, although the stanng pattern of these nternal epthela was somewhat less unform than n the epderms n fact, n the hard palate, stacks of staned cells appeared as a cluster of one or several cells, begnnng n the mmedate suprabasal layer and extendng upwards to the surface as an expandng vertcal column of cells (see arrows n Fg 4C) These ordered stacks are remnscent of the vertcal columns of cornfed cells seen n normal mouse epderms (28) Close examnaton of the base of these columns suggests that basal cells exhbt (3gal stanng, but t s not certan f the basal locaton of these cells s a result of the plane of tssue secton These hstochemcal results ndcate that the 37kb nvolucrn promoter sequence can drect stratumspecfc expresson n vvo and, when consdered along wth the RNA expresson pattern (Fg 3), confrm tssuespecfc expresson The nvolucrn gene has a sngle ntron located between the transcrptonal and translatonal start stes (8) n transent assays n cultured keratnocytes, removal of ths ntron results n a dramatc reducton of expresson (23) As ntrons n ths upstream locaton ste are known to have regulatory actvty (29), we quered f the nvolucrn ntron was requred for tssue and stratumspecfc expresson Several lnes of mce were constructed wth 25 kb of nvolucrn upstream Proc Natl Acad Sc USA 9 (1993) sequences wthout the nvolucrn ntron (Fg 1B) Of these lnes, lne 3672 (contanng approxmately 3 copes of the transgene) exhbted the most ntense stanng and was bred for further analyss t should be noted that an SV4 ntron was present n the upstream regon of ths construct to ensure that a splcng event dd take place RTPCR analyss ofrna extracted from an F1 dervatve of the 3672 founder ndcated that, as n lne 3682, (gal RNA was present only n organs havng stratfed squamous epthela (data not shown) Hstochemcal analyss of skn and oral mucosa of lne 3672 revealed XGal stanng confned to suprabasal cells of the epthela (stanng of buccal mucosa shown n Fg 4F) Stanng n the epderms of lne 3672 was patchy and notceably less ntense compared wth stanng n lne 3682 t s evdent that the nvolucrn ntron s not requred for stratumspecfc expresson The reduced levels of transgene expresson n mouse lne 3672 made an analyss of tssue specfcty less meanngful, but when expresson was detected, ether by hstochemstry or by RNA analyss (data not shown), t was always n stratfed squamous epthela The nvolucrn ntron s therefore not essental for tssuespecfc expresson, although ts presence n the promoter appears to ensure hgh expresson n all tssues DSCUSSON To determne f a 37kb segment of DNA upstream of the nvolucrn codng regon was suffcent for tssue and stratumspecfc expresson n vvo, ths segment was lnked to a,(3gal reporter gene and used n the constructon of transgenc mce Expresson n the resultng mce was confned to the suprabasal cells of stratfed squamous epthelum, thereby demonstratng ts promoter regulatory role n vvo The nvolucrn promoter therefore jons wth the human K5, K14, and K promoters, as well as the bovne K1 promoter, n beng correctly expressed wth both tssue and stratum specfcty n stratfed epthela of transgenc mce (26, 332) n human epderms, as well as n the epderms of transgenc mce, K14 s expressed n the basal layer, whle Kl and K1 are expressed n the suprabasal cells (33) The K14 promoter has been partcularly useful n explorng the pathologcal consequences of expresson of a mutant of K14 keratn and n dentfyng human dsease correlates of ths keratn (34) Although a 12kb fragment of the Kl promoter gves correct tssue and stratumspecfc expresson n transgenc mce, t fals to respond as the endogenous mouse Kl promoter to modulators of keratnocyte dfferentaton, suggestng that addtonal sequences are needed to medate the correct responses (31) As dscussed n the ntroducton, nvolucrn s consttutvely expressed durng dfferentaton and s not subject to modulaton n the same way as are other markers of dfferentaton Analyss of the nvolucrn transgene promoter s therefore lkely to lead to clues as to how these dfferent forms of regulaton are acheved nvolucrn (35) and several other precursors of the cornfled envelope that are expressed specfcally n dfferentatng keratnocytes map to chromosome locaton 1q21 These protens nclude lorcrn [a precursor of the cornfed envelope (36)], trchohyaln [an ntermedate flamentassocated proten of hard keratn (37)], and proflaggrn [a flament aggregatng proten (38)] The clusterng of these genes at chromosomal locaton 1q21 s remnscent of the globn gene cluster on human chromosome 11 (39) The codng regons of each of these keratnocyte genes contan a multple repeat subunt structure and have no ntrons n all cases there s an ntron located upstream of the translatonal start ste, and n the case of proflaggrn, a second ntron les further upstream n the noncodng regon The smlar ntron organzaton and the genetc lnkage of these genes suggest that these ntrons have provded some essental functon n that locaton to be
4 W3q4;,Jz~M)'_: ~t'6vf 1273 Proc Natl Acad Sc USA 9 (1993) Bochemstry: Carroll et al B A ~~AN A; %s, :, W, 4W V lk, bl t 4 'P, w e l 4 F 1 4a ` '1 t % 6 :: p #' va d ~ ~ ~~~1 A :s D_ C,¼4'%; j > t C 4w,e N t ; A aa, 3 tal ~ p S a 4 ~~~~~~~~~~~~~~~~9 _s 4 F E r,t 4 ; ;' > s _ / t v ' 4tA A~ ~ ~ ~ ~s\t FG 4 XGal stanng (blue) of varous tssues of transgenc mce Stanng was confned to suprabasal cells of all stratfed squamous epthela Har follcles n skn also staned postvely Tssues from transgenc mouse lne 3682 are shown n AE (A) Orthokeratnzng epthelum of the tal cut n cross secton (B) Dorsum of skn (C) Palate (D) Buccal mucosa (E) Cervx Buccal mucosa from transgenc mouse lne 3672 s shown n F Lne 3672 was constructed wth a transgene lackng the nvolucrn ntron Tssues between the ages of 12 and 4 weeks (The bars represent 1 gm) so preserved durng evoluton The results of ths study ndcate that the nvolucrn ntron s not essental for tssueor stratumspecfc expresson and may serve some other functon, possbly related to facltatng a hgh level of expresson n certan tssues The ntal ntron n the human keratn 18 gene s known to possess transcrptonal regulatory actvty through an AP1 bndng ste (4) The nvolucrn ntron contans an AP2lke ste, and such stes are requred for epdermalspecfc expresson of keratn 14 (41) The fact that nvolucrn ntron s requred for the hgh level of expresson n vtro (23) lends some support to the hypothess that ths ntron s needed n vvo for hgh expresson were removed from adult mce Stratfed squamous epthelum s a tssue that undergoes contnual loss by desquamaton at the surface and renewal by replcaton of stem cells n the basal layer (42) The progeny of stem cell dvson, ncludng amplfyng cells and termnally dfferentated cells, are organzed nto a spatally conserved unt known as the "epdermal prolferaton unt" or EPU n some regons of the epderms, where keratnzaton s complete and turnover s slow, vertcal columns of cornfed and granular cells are seen and thought to be the progeny of sngle stem cells (28) The vertcal stacks of labeled cells seen n the oral mucosa begnnng n the basal layer and spannng upwards to the surface provde drect vsualzaton of the
5 1274 Bochemstry: CaffoU et al ordered movement of progeny through the tssue Ths also marks the frst tme of whch we are aware that an EPUtype organzaton has been seen n oral mucosa The lack of a stratum corneum n ths noncornfyng tssue has prevented vsualzaton of ordered columns of cornfed cells, as s found n the epderms A smlar columnar pattern has been seen n transgenc mce n whch a K14drected transgene was expressed n a mosac fashon n the basal layer of the epderms and the resultng transgene product was carred along n the progeny cells n the overlyng spnous layer (26) Because the nvolucrn promoter s fathfully expressed n all stratfed squamous epthela and s nsenstve to envronmental nfluences, t mght be partcularly well suted as a vehcle for keratnocytemedated gene therapy (43) Ths mght be valuable for potental medcal applcatons, ncludng drug delvery and correcton of epdermal dsease states The fact that expresson from the nvolucrn promoter s confned to suprabasal spnous and granular cells may also allow targetng of the new gene product to specfc strata whle sparng the basal populaton of cells Note Added n Proof Smlar tssue and dfferentatonspecfc results have been obtaned wth the human nvolucrn promoter n transgenc mce See Crsh et al (44) We thank Franke Davs (Unversty of Kentucky) for expert assstance n constructng transgenc mce and Marca Smon (State Unversty of New York at Stony Brook) for many helpful dscussons We also thank Peter Brnk and Beth Grne (State Unversty ofnew York at Stony Brook) for assstance n preparng hstologcal materal Ths research was supported by Grants DE4511 and DC23 from the Natonal nsttutes of Health JAG s the recpent ofphyscan Scentst Award for Dentsts DE263 from the Natonal nsttute of Dental Research 1 Watt, F M (1989) Curr Opn Cell Bol 1, Fuchs, E (199) Curr Opn Cell Bol 2, Rce, R H & Green, H (1979) Cell 18, Haftek, M, Serre, G, Mls, V & Thvolet, J (1991) J Hstochem Cytochem 399, Yaffe, M B, Murthy, S & Eckert, R L (1993) J nvest Dermatol 1, 39 6 Hohl, D (199) Dermatologca 18, Smon, M (1993) n The Keratnocyte Handbook, eds Legh, M, Watt, F M & Lane, E B (Cambrdge Unv Press, Cambrdge, UK), n press 8 Eckert, R L & Green, H (1986) Cell 46, Green, H & Djan, P (1992) Mol Bol Evol 9, Takahash, H & lzuka, H (1993) J nvest Dermatol 1, Watt, F M & Green, H (1981) J Cell Bol 9, BanksSchlegel, S & Green, H (1981)J CellBol 9, Kopan, R, Traska, G & Fuchs, E (1987) J Cell Bol 15, Magnaldo, T, Bernerd, F, Asselneau, D & Darmon, M (1992) Dfferentaton 49, Fuchs, E & Green, H (1981) Cell 25, Mehrel, T, Hohl, D, Rothnagel, J A, Longley, M A, Bundman, D, Cheng, C, Lcht, U, Bsher, M E, Steven, A C, Proc Natl Acad Sc USA 9 (1993) Stenert, P M, Yuspa, S H & Roop, D R (199) Cell 61, Watt, F M & Green, H (1982) Nature (London) 295, Asselneau, D, Bernard, B A, Bally, C & Darmon, M (1989) Dev Bol 133, Rosenthal, D S, Grffths, C E M, Yuspa, S H, Roop, D R & Voorhees, J J (1992) J nvest Dermatol 98, Mansbrdge, J N & Knapp, A M (1987) J nvest Dermatol 89, Bernard, B A, Reano, A, Darmon, Y M & Thvolet, J (1986) Br J Dermatol 114, Bernerd, F, Magnaldo, T & Darmon, M (1992) J nvest Dermatol 98, Carroll, J M & Tachman, L B (1992) J Cell Sc 13, Hogan, B, nstantn, F & Lucy, E (1986) Manpulatng the Mouse Embryo: A Laboratory Manual (ld Sprng Harbor Lab Press, Planvew, NY) 25 Cepko, C (1989) Neuromethods 16, Vassar, R, Rosenberg, M, Ross, S, Tyner, A & Fuchs, E (1989) Proc Natl Acad Sc USA 86, Hashmoto, T, namoto, N, Nakamura, K & Harada, R (1987) Br J Dermatol 117, Mackenze, C (1969) Nature (London) 222, Kozak, M (1991) J Cell Bol 115, Byrne, C & Fuchs, E (1993) Mol Cell Bol 13, Rosenthal, D S, Stenert, P M, Chung, S, Huff, C A, Johnson, J, Yuspa, S H & Roop, D R (1991) Cell Growth Dffer 2, Balleul, B, Suran, M A, Whte, S, Barton, S C, Brown, K, Blessng, M, Jorcano, J & Balman, A (199) Cell 62, Moll, R, Frnke, W W, Schller, D L, Geger, B & Krepler, R (1982) Cell 31, ulombe, P A, Hutton, M E, Vassar, R & Fuchs, E (1991) J Cell Bol 115, Smon, M, Phllps, M, Green, H, Stroh, H, Glatt, K, Bruns, G & Latt, S A (1989) Am J Hum Genet 45, Yoneda, K, Hold, D, McBrde, W, Wang, M, Cehrs, K U, dler, W W & Stenert, P M (1992) J Bol Chem 267, Lee, SC, Wang, M, McBrde, W, O'Keefe, E J, Km, G & Stenert, P M (1993) J nvest Dermatol 11, McKnleyGrant, L J, dler, W W, Bernsten, A, Parry, D A D, Cannzzaro, L, Croce, C M, Huebner, K, Lessn, S R & Stenert, P M (1989) Proc Natl Acad Sc USA 86, Manats, T, Frtsch, E F, Lauer, J & Lawn, R M (1981) Annu Rev Genet 14, Oshma, R G, Abrams, L & Kulesh, D (199) Genes Dev 4, Leask, A, Byrne, C & Fuchs, E (1991) Proc Natl Acad Sc USA 88, Potten, C S (1981) nt Rev Cytol 69, Carroll, J M, Fenjves, E S, Garlck, J A & Tachman, L B (1993) n Molecular Bology of the Skn: The Keratnocytes, eds Darmon, M & Blumenberg, M (Academc, New York), pp Crsh, J F, Howard, J M, Zam, T M, Murthy, S & Eckert, R L (1993) Dfferentaton 53, 1912
THIS IS AN OFFICIAL NH DHHS HEALTH ALERT
THIS IS AN OFFICIAL NH DHHS HEALTH ALERT Dstrbuted by the NH Health Alert Network Health.Alert@dhhs.nh.gov August 26, 2016 1430 EDT (2:30 PM EDT) NH-HAN 20160826 Recommendatons for Accurate Dagnoss of
More informationEngineered commensal microbes for dietmediated colorectal-cancer chemoprevention
SUPPLEMENTARY NFORMATON Artcles https://do.org/10.1038/s41551-017-0181-y n the format provded by the authors and unedted. Engneered commensal mcrobes for detmedated colorectal-cancer chemopreventon Chun
More informationCopy Number Variation Methods and Data
Copy Number Varaton Methods and Data Copy number varaton (CNV) Reference Sequence ACCTGCAATGAT TAAGCCCGGG TTGCAACGTTAGGCA Populaton ACCTGCAATGAT TAAGCCCGGG TTGCAACGTTAGGCA ACCTGCAATGAT TTGCAACGTTAGGCA
More informationFigure S1. 1g tumors (weeks) ikras. Lean Obese. Lean Obese 25 KPC
Fgure S 5 Tme to develop g tumors (weeks) 5 5 Tme to develop g tumors (weeks) 5 5 KRS KPC Fgure S. Effect of obesty on tumor ntaton. Tme to develop tumors of about g n KPC and KRS mce fed low or hgh-fat
More informationParameter Estimates of a Random Regression Test Day Model for First Three Lactation Somatic Cell Scores
Parameter Estmates of a Random Regresson Test Day Model for Frst Three actaton Somatc Cell Scores Z. u, F. Renhardt and R. Reents Unted Datasystems for Anmal Producton (VIT), Hedeweg 1, D-27280 Verden,
More information(From the Gastroenterology Division, Cornell University Medical College, New York 10021)
ROLE OF HEPATIC ANION-BINDING PROTEIN IN BROMSULPHTHALEIN CONJUGATION* BY N. KAPLOWITZ, I. W. PERC -ROBB,~ ANn N. B. JAVITT (From the Gastroenterology Dvson, Cornell Unversty Medcal College, New York 10021)
More informationStudies In Blood Preservation
Howard Unversty Dgtal Howard @ Howard Unversty Faculty Reprnts 12-1-1939 Studes In Blood Preservaton Charles R. Drew Follow ths and addtonal works at: http://dh.howard.edu/reprnts Part of the Medcne and
More informationTIME RESPONSE OF JEJUNAL SUCRASE AND MALTASE ACTIVITY TO A HIGH SUCROSE DIET IN NORMAL MAN
GASTROEKTEROLOGY Copyrght 1969 by The Wllams & Wlkns Co. Vol. 56, No.3 Prnted n U.S.A. TIME RESPONSE OF JEJUNAL SUCRASE AND MALTASE ACTIVITY TO A HIGH SUCROSE DIET IN NORMAL MAN NORTON S. RoSENSWEIG, M.D.,
More informationPhysical Model for the Evolution of the Genetic Code
Physcal Model for the Evoluton of the Genetc Code Tatsuro Yamashta Osamu Narkyo Department of Physcs, Kyushu Unversty, Fukuoka 8-856, Japan Abstract We propose a physcal model to descrbe the mechansms
More informationHYPEIIGLTCAEMIA AS A MENDELIAN P~ECESSIVE CHAI~ACTEP~ IN MICE.
HYPEGLTCAEMA AS A MENDELAN P~ECESSVE CHA~ACTEP~ N MCE. BY P. J. CAM~CDGE, M.D. (LEND.), 32 Nottngham Place, Ma~'y~ebone, London, W, 1, AND H. A. H. {OWAZD, B.So. (Lol, m.). h'~ the course of an nvestgaton
More informationGene expression during mammalian oogenesis and early embryogenesis: quantification of three messenger RNAs abundant in fully grown mouse oocytes
Development 106, 25L-261 (1989) Prnted n Great Brtan The Company of Bologsts Lmted 1989 251 Gene expresson durng mammalan oogeness and early embryogeness: quantfcaton of three messenger RNAs abundant n
More informationOptimal Planning of Charging Station for Phased Electric Vehicle *
Energy and Power Engneerng, 2013, 5, 1393-1397 do:10.4236/epe.2013.54b264 Publshed Onlne July 2013 (http://www.scrp.org/ournal/epe) Optmal Plannng of Chargng Staton for Phased Electrc Vehcle * Yang Gao,
More informationLeberco*Celsis Testing
n km Leberco*Celss Testng 23 Hawthorne Street Roselle Park, NJ 724-26 98.245.933 / 8.523.LABS Fax 98.245.6253 Nov. 5, 996 SUBMTTED TO: ACTS Testng Labs Buffalo, NY Patty Dck ASSAY NUMBER: 96234 DATE RECEVED:
More informationStudy and Comparison of Various Techniques of Image Edge Detection
Gureet Sngh et al Int. Journal of Engneerng Research Applcatons RESEARCH ARTICLE OPEN ACCESS Study Comparson of Varous Technques of Image Edge Detecton Gureet Sngh*, Er. Harnder sngh** *(Department of
More informationEpendymal cells Cilia on one surface Movement of material or fluid over surface of the cell
2004 Bology GA 1: Wrtten examnaton 1 SPECIFIC INFMATION Secton A Multple-choce Ths table ndcates the approxmate percentage of students choosng each dstractor. The correct answer s the shaded alternatve.
More information1 0 1 Neither A nor B I Both Anti-A and Anti-B 1 0, A, B, AB I 0 1. Simulated ABO 6; Rh Bood vping Lab Activity Student Study Guide BACKGROUND
Smulated ABO 6; Rh Bood vpng Lab Actvty Student Study Gude BACKGROUND nces Around 900, Karl Landstener dscovered that there are at least four dfferent knds of human blood, determned by the presence or
More informationRegulation of the Expression of the Hematopoietic Stem Cell Antigen CD34: Role of c-myb By Paola Melotti, De-Hui Ku, and Bruno Calabretta
Bref Det~ntve Report Regulaton of the Expresson of the Hematopoetc Stem Cell Antgen CD34: Role of c-myb By Paola Melott, De-Hu Ku, and Bruno Calabretta From the Department of Mcrobolagy and Immunology,
More informationQuantitative Analysis of Smooth Endoplasmic Reticulum Proliferation in Hepatocytes of Early Postnatal and Adult Mice Treated With Phenobarbital
GASTROENTEROLOGY 1984;87;1131-7 Quanttatve Analyss of Smooth Endoplasmc Retculum Prolferaton n Hepatocytes of Early Postnatal and Adult Mce Treated Wth Phenobarbtal KAZUO KANAI, SHINSUKE KANAMURA, MARl
More informationBIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL ABSORPTION AND FLUORESCENCE SPECTRA OF POLYENE ANTIBIOTICS IN THE PRESENCE OF HUMAN SERUM ALBUMIN
Vol. 44, No. 3, March 1998 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL Pages 595-63 ABSORPTON AND FLUORESCENCE SPECTRA OF POLYENE ANTBOTCS N THE PRESENCE OF HUMAN SERUM ALBUMN Dana Romann, Beatrz Farrugga
More informationTAKESHI UTSUNOMIYA and JAY S. ROTH
STUDIES ON THE FUNCTION OF INTRACELLULAR RIBONUCLEASES V. Rbonuclease Actvty n Rbosomes and Polysomes Prepared from Rat Lver and Hepatomas TAKESHI UTSUNOMIYA and JAY S. ROTH From the Insttute of Cellular
More informationEffect of Tumor Necrosis Factor on Acetyl-Coenzyme A Carboxylase Gene Expression and Preadipocyte Differentiation
Effect of Tumor Necross Factor on AcetylCoenzyme A Carboxylase Gene Expresson and Preadpocyte Dfferentaton Mchael E. Pape and KHan Km Department of Bochemstry Purdue Unversty West Lafayette, Indana 47907
More informationGlutamate acting on NMDA receptors stimulates neurite outgrowth from'cerebellar granule cells
Volume 223, number 1, 143-147 FEB 05216 October 1987 Glutamate actng on NMDA receptors stmulates neurte outgrowth from'cerebellar granule cells Ian A. Pearce, Martn A. Cambray-Deakn and Robert D. Burgoyne
More informationInternational Journal of Emerging Technologies in Computational and Applied Sciences (IJETCAS)
Internatonal Assocaton of Scentfc Innovaton and Research (IASIR (An Assocaton Unfyng the Scences, Engneerng, and Appled Research Internatonal Journal of Emergng Technologes n Computatonal and Appled Scences
More informationSMALL AREA CLUSTERING OF CASES OF PNEUMOCOCCAL BACTEREMIA.
SMALL AREA CLUSTERING OF CASES OF PNEUMOCOCCAL BACTEREMIA. JP Metlay, MD, PhD T Smth, PhD N Kozum, PhD C Branas, PhD E Lautenbach, MD NO Fshman, MD PH Edelsten, MD Center for Health Equty Research and
More informationECM, these same cell types proliferated actively and no longer. that the ECM, which is the natural substrate upon which cells
Proc. Natl. Acad. Sd. USA Vol. 77, No. 7, pp. 4094-4098, July 1980 Cell Bology Permssve effect of the extracellular matrx on cell prolferaton n vtro (fbroblast growth factor/granulosa cells/adrenal cortex
More informationUsing the Perpendicular Distance to the Nearest Fracture as a Proxy for Conventional Fracture Spacing Measures
Usng the Perpendcular Dstance to the Nearest Fracture as a Proxy for Conventonal Fracture Spacng Measures Erc B. Nven and Clayton V. Deutsch Dscrete fracture network smulaton ams to reproduce dstrbutons
More informationIn the present study, we have isolated native EGF receptor monomers and dimers from A431 cell membranes, and we
Proc. Natl. Acad. Sc. USA Vol. 84, pp. 7832-7836, November 1987 Bochemstry Mechansm of epdermal growth factor receptor autophosphorylaton and hgh-affnty bndng (receptor-tyrosne knases/lgand-nduced receptor
More informationCD45 up-regulation during lymphocyte maturation
Internatonal Immunology, Vol., No. 11, pp. 1743-1749 1996 Oxford Unversty Press CD45 up-regulaton durng lymphocyte maturaton Jorg Krberg and Thomas Brocker Basel Insttute for Immunology, Grenzacherstrasse
More informationInsights in Genetics and Genomics
Insghts n Genetcs and Genomcs Research Artcle Open Access New Score Tests for Equalty of Varances n the Applcaton of DNA Methylaton Data Analyss [Verson ] Welang Qu Xuan L Jarrett Morrow Dawn L DeMeo Scott
More informationObservations on the use of the Coulter model D electronic cell counter in clinical haematology
J. cln. Path. (1963), 16, 1 Observatons on the use of the Coulter model D electronc cell counter n clncal haematology A. N. BLADES AND H. C. G. FLAVELL From the Dorset County Laboratory, Dorchester, Dorset
More informationThe High way code. the guide to safer, more enjoyable drug use. (alcohol)
The Hgh way code the gude to safer, more enjoyable drug use (alcohol) ntroducng the GDS Hgh Way Code GDS knows pleasure drves drug use, not the avodance of harm. As far as we know no gude has ever outlned
More informationNHS Outcomes Framework
NHS Outcomes Framework Doman 1 Preventng people from dyng prematurely Indcator Specfcatons Verson: 1.21 Date: May 2018 Author: Clncal Indcators Team NHS Outcomes Framework: Doman 1 Preventng people from
More informationProject title: Mathematical Models of Fish Populations in Marine Reserves
Applcaton for Fundng (Malaspna Research Fund) Date: November 0, 2005 Project ttle: Mathematcal Models of Fsh Populatons n Marne Reserves Dr. Lev V. Idels Unversty College Professor Mathematcs Department
More informationEffects of Micro-Electrical Stimulation on Regulation of Behavior of Electro-Active Stem Cells
Orgnal Artcle J. of Bosystems Eng. 38():113-10. (013. 6) http://dx.do.org/10.5307/jbe.013.38..113 Journal of Bosystems Engneerng eissn : 34-186 pissn : 1738-166 Effects of Mcro-Electrcal Stmulaton on Regulaton
More informationRENAL FUNCTION AND ACE INHIBITORS IN RENAL ARTERY STENOSISA/adbon et al. 651
Downloaded from http://ahajournals.org by on January, 209 RENAL FUNCTION AND INHIBITORS IN RENAL ARTERY STENOSISA/adbon et al. 65 Downloaded from http://ahajournals.org by on January, 209 Patents and Methods
More informationMAURICE M. BLACK and HUDSON R. ANSLEY. From the Department of Pathology, New York Medical College, New York City
ANTGEN-NDUCED CHANGES N LYMPHOD CELL HSTONES. Regonal Lymph Nodes MAURCE M. BLACK and HUDSON R. ANSLEY From the Department of Pathology, New York Medcal College, New York Cty ABSTRACT The nuclcar hstones
More informationJames A. Talbot$ and Robert S. Hodges
THE JOURNAL OF BOLOGCAL CHEMSTRY Val. 256, No. 23. ssue of December O, pp. 12374-12378. 1981 Prnted n U S.A (Receved for publcaton, May 13, 1981) James A. Talbot$ and Robert S. Hodges From the Department
More informationH~l~ne Mabit, 1 Sylvie Dubanchet, 1 Francis Capel, 1 Charlie Dauguet 2 and Marie-Anne Petit 1.
Journal of General Vrology (1994), 75, 26815689. Prnted n Great Brtan 2681 n vtro nfecton of human hepatoma cells (HepG2) wth hepatts B vrus (HBV): spontaneous selecton of a stable HBV surface antgen-producng
More informationPrediction of Total Pressure Drop in Stenotic Coronary Arteries with Their Geometric Parameters
Tenth Internatonal Conference on Computatonal Flud Dynamcs (ICCFD10), Barcelona, Span, July 9-13, 2018 ICCFD10-227 Predcton of Total Pressure Drop n Stenotc Coronary Arteres wth Ther Geometrc Parameters
More informationConcentration of teicoplanin in the serum of adults with end stage chronic renal failure undergoing treatment for infection
Journal of Antmcrobal Chemotherapy (1996) 37, 117-121 Concentraton of tecoplann n the serum of adults wth end stage chronc renal falure undergong treatment for nfecton A. MercateUo'*, K. Jaber*, D. Hfflare-Buys*,
More informationMetabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-coa effects
Metabolc control of mtochondral propertes by adenne nucleotde translocator determnes palmtoyl-coa effects Implcatons for a mechansm lnkng obesty and type 2 dabetes Jolta Capate 1,5, Stephan J. L. Bakker
More informationMicroRNA-31 Promotes Skin Wound Healing by Enhancing Keratinocyte Proliferation and Migration
ORIGINL RTICLE McroRN- romotes Skn Wound Healng by Enhancng Keratnocyte rolferaton and Mgraton Dongqng L,XL, oxue Wang,, Floran Mesgen, ndor varcs, Enkö Sonkoly, Mona Ståhle and Nng Xu Landén Wound healng
More informationThe Case for Selection at CCR5-D32
Open access, freely avalable onlne The Case for Selecton at CCR5-D32 PLoS BIOLOGY Pards C. Sabet 1,2*, Emly Walsh 1, Steve F. Schaffner 1, Patrck Varlly 1, Ben Fry 1, Holl B. Hutcheson 3, Mke Cullen 3,
More informationTHE PHYSIOLOGY OF EXCITABLE CELLS
THE PHYSIOLOGY OF EXCITABLE CELLS Evelyn Morn Department of Electrcal & Computer Engneerng Queen s Unversty, Kngston, Ont. In all cells a potental exsts across the cell membrane due to dfferences n the
More informationKinetics of Corneal Epithelium Turnover In Vivo
Investgatve Ophthalmology & Vsual Scence, Vol. 3, No. 0, October 990 Copyrght Assocaton for Research n Vson and Ophthalmology Knetcs of Corneal Epthelum Turnover In Vvo Studes of Lovasrarn Rchard J. Cenedella
More informationHuman Tissue and Their Production by Muscle Cells and Fibroblasts
Amercan Journal ofpathology, Vol. 147, No. 5, November 1995 Copyrght Amercan Socetyfor Investgatve Pathology Dstrbuton of Type XV Collagen Transcrpts n Human Tssue and Ther Producton by Muscle Cells and
More informationA GEOGRAPHICAL AND STATISTICAL ANALYSIS OF LEUKEMIA DEATHS RELATING TO NUCLEAR POWER PLANTS. Whitney Thompson, Sarah McGinnis, Darius McDaniel,
A GEOGRAPHICAL AD STATISTICAL AALYSIS OF LEUKEMIA DEATHS RELATIG TO UCLEAR POWER PLATS Whtney Thompson, Sarah McGnns, Darus McDanel, Jean Sexton, Rebecca Pettt, Sarah Anderson, Monca Jackson ABSTRACT:
More informationThe spatial and temporal distribution of polarizing activity in the flank of the pre-limb-bud stages in the chick embryo
Development, - () Prnted n Great Brtan The Company of Bologsts Lmted The spatal and temporal dstrbuton of polarzng actvty n the flank of the pre-lmb-bud stages n the chck embryo AMATA HORNBRUCH and LEWIS
More informationRNA Secondary Structure Prediction
RNA Seondary Struture Predton BMI/CS 776 www.bostat.ws.edu/bm776/ Sprng 208 Anthony Gtter gtter@bostat.ws.edu These sldes exludng thrd-party materal are lensed under CC BY-NC 4.0 by Mar Craven Coln Dewey
More informationLymphoma Cancer Classification Using Genetic Programming with SNR Features
Lymphoma Cancer Classfcaton Usng Genetc Programmng wth SNR Features Jn-Hyuk Hong and Sung-Bae Cho Dept. of Computer Scence, Yonse Unversty, 134 Shnchon-dong, Sudaemoon-ku, Seoul 120-749, Korea hjnh@candy.yonse.ac.kr,
More informationEncoding processes, in memory scanning tasks
vlemory & Cognton 1976,4 (5), 501 506 Encodng processes, n memory scannng tasks JEFFREY O. MILLER and ROBERT G. PACHELLA Unversty of Mchgan, Ann Arbor, Mchgan 48101, Three experments are presented that
More informationBiology 30 Take Home Quiz
Bology 30 Take Home Quz 1) Glucose levels n the blood are rased by the hormone and lowered by the hormone. a) nsuln glucagon b) glucagon nsuln c) nsuln calctonn d) calctonn nsuln 2) A fat soluble hormone
More informationN-back Training Task Performance: Analysis and Model
N-back Tranng Task Performance: Analyss and Model J. Isaah Harbson (jharb@umd.edu) Center for Advanced Study of Language and Department of Psychology, Unversty of Maryland 7005 52 nd Avenue, College Park,
More informationArithmetic Average: Sum of all precipitation values divided by the number of stations 1 n
Char of ssgnment Suggested soluton PRCIPITTION Task (Charactersaton of the study area) rea: 43.3 km 2 Rver length: 0.296 km Hghest pont: 346 m a.s.l. Lowest pont (staton elevaton): 668 m a.s.l. Domnant
More informationAppendix for. Institutions and Behavior: Experimental Evidence on the Effects of Democracy
Appendx for Insttutons and Behavor: Expermental Evdence on the Effects of Democrac 1. Instructons 1.1 Orgnal sessons Welcome You are about to partcpate n a stud on decson-makng, and ou wll be pad for our
More informationThe High way code. the guide to safer, more enjoyable drug use. [cannabis] Who developed it?
The Hgh way code the gude to safer, more enjoyable drug use [cannabs] Who developed t? What s t? The frst gude to safer drug use voted for by people who take drugs. How was t was developed? GDS asked loads
More informationTracing the molecular basis of transcriptional dynamics in noisy data by using an experiment-based mathematical model
Publshed onlne 3 December 204 Nuclec Acds Research, 205, Vol. 43, No. 53 6 do: 0.093/nar/gku272 Tracng the molecular bass of transcrptonal dynamcs n nosy data by usng an experment-based mathematcal model
More informationInvestigation of zinc oxide thin film by spectroscopic ellipsometry
VNU Journal of Scence, Mathematcs - Physcs 24 (2008) 16-23 Investgaton of znc oxde thn flm by spectroscopc ellpsometry Nguyen Nang Dnh 1, Tran Quang Trung 2, Le Khac Bnh 2, Nguyen Dang Khoa 2, Vo Th Ma
More information4.2 Scheduling to Minimize Maximum Lateness
4. Schedulng to Mnmze Maxmum Lateness Schedulng to Mnmzng Maxmum Lateness Mnmzng lateness problem. Sngle resource processes one ob at a tme. Job requres t unts of processng tme and s due at tme d. If starts
More informationMyocardial Mural Thickness During the Cardiac Cycle
Myocardal Mural Thckness Durng the Cardac Cycle By Erc O. Fegl, M.D., and Donald L. Fry, M.D. An understandng of the relatonshp between forces and veloctes of contracton n muscle fbers to the pressures
More informationWere the babies switched? The Genetics of Blood Types i
Were the babes swtched? The Genetcs of Blood Types Two couples had babes on the same day n the same hosptal. Dense and Earnest had a grl, Tonja. Danelle and Mchael had twns, a boy, Mchael, Jr., and a grl,
More informationMuscle Activating Force Detection Using Surface Electromyography
Muscle force, F v (v m ) (Fracton of maxmum sometrc force) Muscle force, F l (l m ) (Fracton of maxmum sometrc force) Muscle Actvatng Force Detecton Usng Surface Electromyography Saran KEERATIHATTAYAKORN
More informationDiabetologia 9 Springer-Verlag1996
Dabetologa (1996) 39:758-765 Dabetologa 9 Sprnger-Verlag1996 Orgnals Long-term and rapd regulaton of ob mrna levels n adpose tssue from normal (Sprague Dawley rats) and obese (db/db mce, fa/fa rats) rodents
More information310 Int'l Conf. Par. and Dist. Proc. Tech. and Appl. PDPTA'16
310 Int'l Conf. Par. and Dst. Proc. Tech. and Appl. PDPTA'16 Akra Sasatan and Hrosh Ish Graduate School of Informaton and Telecommuncaton Engneerng, Toka Unversty, Mnato, Tokyo, Japan Abstract The end-to-end
More informationThis article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
Ths artcle appeared n a journal publshed by Elsever. The attached copy s furnshed to the author for nternal non-commercal research and educaton use, ncludng for nstructon at the authors nsttuton and sharng
More informationAlereTM. i Influenza A & B. Enter. Molecular results in less than 15 minutes
Molecular results n less than 15 mnutes Enter Transformng patent management sothermal amplfcaton technology gvng you molecular results, faster than ever before Improvng patent care Gvng you the confdence
More informationIMPROVING THE EFFICIENCY OF BIOMARKER IDENTIFICATION USING BIOLOGICAL KNOWLEDGE
IMPROVING THE EFFICIENCY OF BIOMARKER IDENTIFICATION USING BIOLOGICAL KNOWLEDGE JOHN H. PHAN The Wallace H. Coulter Department of Bomedcal Engneerng, Georga Insttute of Technology, 313 Ferst Drve Atlanta,
More informationSparse Representation of HCP Grayordinate Data Reveals. Novel Functional Architecture of Cerebral Cortex
1 Sparse Representaton of HCP Grayordnate Data Reveals Novel Functonal Archtecture of Cerebral Cortex X Jang 1, Xang L 1, Jngle Lv 2,1, Tuo Zhang 2,1, Shu Zhang 1, Le Guo 2, Tanmng Lu 1* 1 Cortcal Archtecture
More informationBinding of Basic Fibroblost Growth Factor to Normal and Neovascularized Rabbit Cornea
Investgatve Ophthalmology & Vsual Scence, Vol. 31, No. 2, February 1990 Copyrght Assocaton for Research n Vson and Ophthalmology Bndng of Basc Fbroblost Growth Factor to Normal and Neovascularzed Rabbt
More informationLateral Transfer Data Report. Principal Investigator: Andrea Baptiste, MA, OT, CIE Co-Investigator: Kay Steadman, MA, OTR, CHSP. Executive Summary:
Samar tmed c ali ndus t r esi nc 55Fl em ngdr ve, Un t#9 Cambr dge, ON. N1T2A9 T el. 18886582206 Ema l. nf o@s amar t r ol l boar d. c om www. s amar t r ol l boar d. c om Lateral Transfer Data Report
More informationDS May 31,2012 Commissioner, Development. Services Department SPA June 7,2012
. h,oshawa o Report To: From: Subject: Development Servces Commttee Item: Date of Report: DS-12-189 May 31,2012 Commssoner, Development Fle: Date of Meetng: Servces Department SPA-2010-09 June 7,2012 Applcaton
More informationA Computer-aided System for Discriminating Normal from Cancerous Regions in IHC Liver Cancer Tissue Images Using K-means Clustering*
A Computer-aded System for Dscrmnatng Normal from Cancerous Regons n IHC Lver Cancer Tssue Images Usng K-means Clusterng* R. M. CHEN 1, Y. J. WU, S. R. JHUANG, M. H. HSIEH, C. L. KUO, Y. L. MA Department
More informationEFFECTS OF FEEDBACK CONTROL ON SLOW CORTICAL POTENTIALS AND RANDOM EVENTS
Hnterberger, Houtkooper, & Kotchoubey EFFECTS OF FEEDBACK CONTROL ON SLOW CORTICAL POTENTIALS AND RANDOM EVENTS Thlo Hnterberger 1, Joop M. Houtkooper 2, & Bors Kotchoubey 1 1 Insttute of Medcal Psychology
More informationARTICLE IN PRESS Neuropsychologia xxx (2010) xxx xxx
Neuropsychologa xxx (200) xxx xxx Contents lsts avalable at ScenceDrect Neuropsychologa journal homepage: www.elsever.com/locate/neuropsychologa Storage and bndng of object features n vsual workng memory
More informationEconomic crisis and follow-up of the conditions that define metabolic syndrome in a cohort of Catalonia,
Economc crss and follow-up of the condtons that defne metabolc syndrome n a cohort of Catalona, 2005-2012 Laa Maynou 1,2,3, Joan Gl 4, Gabrel Coll-de-Tuero 5,2, Ton Mora 6, Carme Saurna 1,2, Anton Scras
More informationARTICLES. Epidemiologic Evidence Showing That Human Papillomavirus Infection Causes Most Cervical Intraepithelial Neoplasia
ARTICLES Epdemologc Evdence Showng That Human Papllomavrus Infecton Causes Most Cervcal Intraepthelal Neoplasa Mark H. Schffman, Hed M. Bauer, Robert N. Hoover, Andrew G. Glass, Dane M. Cadell, Brenda
More informationThe High way code. the guide to safer, more enjoyable drug use. (lsd / magic mushrooms)
The Hgh way code the gude to safer, more enjoyable drug use (lsd / magc mushrooms) ntroducng the GDS Hgh Way Code GDS knows pleasure drves drug use, not the avodance of harm. As far as we know no gude
More informationFAST DETECTION OF MASSES IN MAMMOGRAMS WITH DIFFICULT CASE EXCLUSION
computng@tanet.edu.te.ua www.tanet.edu.te.ua/computng ISSN 727-6209 Internatonal Scentfc Journal of Computng FAST DETECTION OF MASSES IN MAMMOGRAMS WITH DIFFICULT CASE EXCLUSION Gábor Takács ), Béla Patak
More informationA polycystin-2-like large conductance cation channel in rat left ventricular myocytes
Cardovascular Research 58 (2003) 76 88 www.elsever.com/ locate/ cardores A polycystn-2-lke large conductance caton channel n rat left ventrcular myocytes * Tlmann Volk, Alexander Peter Schwoerer, Susanne
More informationACCU-CHEK. Compact Plus. User s Manual BLOOD GLUCOSE MONITORING SYSTEM. Downloaded from manuals search engine
ACCU-CHEK Compact Plus BLOOD GLUCOSE MONITORING SYSTEM User s Manual On the packagng, on the type plate of the meter and on the lancng devce you may encounter the followng symbols shown below. They have
More informationRecent Trends in U.S. Breast Cancer Incidence, Survival, and Mortality Rates
Recent Trends n U.S. Breast Cancer Incdence, Survval, and Mortalty Rates Kenneth C. Chu, Robert E. Tarone, Larry G. Kessler, Lynn A. G. Res, Benjamn F. Hankey, Banj A. Mller, Brenda K. Edwards* Background:
More informationResampling Methods for the Area Under the ROC Curve
Resamplng ethods for the Area Under the ROC Curve Andry I. Bandos AB6@PITT.EDU Howard E. Rockette HERBST@PITT.EDU Department of Bostatstcs, Graduate School of Publc Health, Unversty of Pttsburgh, Pttsburgh,
More information~~~~~~~~~~~~~~~~2- ~~~~~~~~~~~~~~~~~10. go 3 NAFM
2528 orrectons Proc. Natl. Acad. Sc. USA 73 (1976) orrecton. In the artcle "A 15-hydroxyprostaglandn dehydrogenase specfc for prostaglandn A n rabbt kdney" by H. G. Oen, E. A. Ham, M. E. Zanett, E. H.
More informationMultiscale modelling of tumour growth induced by circadian rhythm disruption in epithelial tissue 1
Multscale modellng of tumour growth nduced by crcadan rhythm dsrupton n epthelal tssue 1 D. A. Bratsun D. V. Merkurev A. P. Zakharov L. M. Psmen Abstract We propose a multscale chemo-mechancal model of
More informationA role for eukaryotic initiation factor 4B overexpression in the pathogenesis of diffuse large B-cell lymphoma
Leukema (), & Macmllan Publshers Lmted All rghts reserved -/ www.nature.com/leu OPEN ORIGINAL ARTICLE A role for eukaryotc ntaton factor B overexpresson n the pathogeness of dffuse large B-cell lymphoma
More informationDigital Fluorescence Imaging of Trafficking of Endosomes Containing Low-Density Lipoprotein in Brain Astroglial Cells 1
Bochemcal and Bophyscal Research Communcatons 269, 25 30 (2000) do:10.1006/bbrc.2000.2261, avalable onlne at http://www.dealbrary.com on Dgtal Fluorescence Imagng of Traffckng of Endosomes Contanng Low-Densty
More informationSurvival Rate of Patients of Ovarian Cancer: Rough Set Approach
Internatonal OEN ACCESS Journal Of Modern Engneerng esearch (IJME) Survval ate of atents of Ovaran Cancer: ough Set Approach Kamn Agrawal 1, ragat Jan 1 Department of Appled Mathematcs, IET, Indore, Inda
More informationEffects of Estrogen Contamination on Human Cells: Modeling and Prediction Based on Michaelis-Menten Kinetics 1
J. Water Resource and Protecton, 009,, 6- do:0.6/warp.009.500 Publshed Onlne ovember 009 (http://www.scrp.org/ournal/warp) Effects of Estrogen Contamnaton on Human Cells: Modelng and Predcton Based on
More informationDetermination of the activation spectrum of aluminium phthalocyanine chloride against cultured meningioma cells using a tunable laser
Determnaton of the actvaton spectrum of alumnum phthalocyanne chlorde aganst cultured menngoma cells usng a tunable laser Andrew C. Wlson MSc* Gregory M. Malham MB ChB t Raewyn J. Thomsen NZCS* John D.
More informationNational Polyp Study data: evidence for regression of adenomas
5 Natonal Polyp Study data: evdence for regresson of adenomas 78 Chapter 5 Abstract Objectves The data of the Natonal Polyp Study, a large longtudnal study on survellance of adenoma patents, s used for
More informationCONSTRUCTION OF STOCHASTIC MODEL FOR TIME TO DENGUE VIRUS TRANSMISSION WITH EXPONENTIAL DISTRIBUTION
Internatonal Journal of Pure and Appled Mathematcal Scences. ISSN 97-988 Volume, Number (7), pp. 3- Research Inda Publcatons http://www.rpublcaton.com ONSTRUTION OF STOHASTI MODEL FOR TIME TO DENGUE VIRUS
More informationBalanced Query Methods for Improving OCR-Based Retrieval
Balanced Query Methods for Improvng OCR-Based Retreval Kareem Darwsh Electrcal and Computer Engneerng Dept. Unversty of Maryland, College Park College Park, MD 20742 kareem@glue.umd.edu Douglas W. Oard
More informationSubmitted for Presentation 94th Annual Meeting of the Transportation Research Board January 11-15, 2015, Washington, D.C.
Wegh-In-Moton Staton Montorng and Calbraton usng Inductve Loop Sgnature Technology Shn-Tng (Cndy) Jeng (Correspondng Author) CLR Analytcs Inc 8885 Research Drve Sute 15 Irvne, CA 92618 Tel: 949-864-6696,
More informationCharacterization of the Day-Night Variation of Retinal Melatonin Content in the Chick
Characterzaton of the Day-Nght Varaton of Retnal Melatonn Content n the Chck Steven M. Repperr and Stephen M. Sagar By montorng two tme ponts (one at md-lght and the other at md-dark), the day-nght varaton
More informationDiabetologia 9 Springcr-Verlag 1988
Dabetologa (1988) 31 : 435-442 Dabetologa 9 Sprngcr-Verlag 1988 Tme-dependent potentaton of nsuln release nduced by alpha-ketosocaproate and leucne n rats: possble nvolvement of phosphonostde hydrolyss
More informationPrice linkages in value chains: methodology
Prce lnkages n value chans: methodology Prof. Trond Bjorndal, CEMARE. Unversty of Portsmouth, UK. and Prof. José Fernández-Polanco Unversty of Cantabra, Span. FAO INFOSAMAK Tangers, Morocco 14 March 2012
More informationEvaluation of the generalized gamma as a tool for treatment planning optimization
Internatonal Journal of Cancer Therapy and Oncology www.jcto.org Evaluaton of the generalzed gamma as a tool for treatment plannng optmzaton Emmanoul I Petrou 1,, Ganesh Narayanasamy 3, Eleftheros Lavdas
More informationIncorrect Beliefs. Overconfidence. Types of Overconfidence. Outline. Overprecision 4/22/2015. Econ 1820: Behavioral Economics Mark Dean Spring 2015
Incorrect Belefs Overconfdence Econ 1820: Behavoral Economcs Mark Dean Sprng 2015 In objectve EU we assumed that everyone agreed on what the probabltes of dfferent events were In subjectve expected utlty
More informationEffect of Exposure to Trace Elements in the Soil on the Prevalence of Neural Tube Defects in a High-Risk Area of China*
94 Bomed Envron Sc, 011; 4(): 94 101 Orgnal Artcle Effect of Exposure to Trace Elements n the Sol on the Prevalence of Neural Tube Defects n a Hgh-Rsk Area of Chna* HUANG Jng 1,, WU JLe,, LI TeJun 1, SONG
More informationA-UNIFAC Modeling of Binary and Multicomponent Phase Equilibria of Fatty Esters+Water+Methanol+Glycerol
-UNIFC Modelng of Bnary and Multcomponent Phase Equlbra of Fatty Esters+Water+Methanol+Glycerol N. Garrdo a, O. Ferrera b, R. Lugo c, J.-C. de Hemptnne c, M. E. Macedo a, S.B. Bottn d,* a Department of
More information