Current practice, needs and future directions in immuno-oncology research testing

Transcription

1 Current practice, needs and future directions in immuno-oncology research testing Jose Carlos Machado IPATIMUP - Porto, Portugal ESMO THERMO FISHER SCIENTIFIC SYMPOSIUM

2 Immune Therapies are Revolutionizing Oncology erapy Chemokines and homing receptor modulators Cancer vaccines and adjuvants Adoptive T cell therapies Traditional pathway for chemotherapies and targeted therapies For Research Use Only. Not for use in diagnostic procedures. Adapted from Chen and Mellman, Immunity 39:1 (2013) Thermo Fisher All Rights Reserved Checkpoint inhibitors on market Ipilimumab (CTLA4) Nivolumab (PD-1) Pembrolizumab (PD-1) Atezolizumab (PD-L1)

3 Kaplan Meier Curves for Overall Survival and Progression-free Survival in the Intention-to-Treat Population. Hodi FS et al. N Engl J Med 2010;363:

4 Anti-PD-L1 in patients with NSCLC Brahmer JR, et al. N Eng J Med 366, , 2012

5 PD-L1 expression in NSCLC <1% 1-49% >=50% Garon EB, et al. N Eng J Med 372, , 2015

6 Progression-free survival of NSCLC patients treated with anti-pd-l1 Garon EB, et al. N Eng J Med 372, , 2015

7 Programmed death-ligand 1 (PD-L1) prevalence and expression. RS Herbst et al. Nature 515, (2014) doi: /nature14011

8 Antitumour activity of MPDL3280A by immunohistochemistry (IHC) tumour-infiltrating immune cell (IC) and biomarker status. RS Herbst et al. Nature 515, (2014) doi: /nature14011

9 Cancer somatic mutations On average > mutations per case On average > 50 non-synonymous mutations per case Non-synonymous mutations > neo-antigens

10 Mutation load and immunemodulation therapy benefit in patients with melanoma Snyder A, et al. NEJM 371: , 2014

11 Mutation load and survival in melanoma patients treated with immunemodulators Snyder A, et al. NEJM 371: , 2014

12 Association of a Neoepitope Signature with a Clinical Benefit from CTLA-4 Blockade Snyder A, et al. NEJM 371: , 2014

13 Clinical benefit of Pembrolizumab treatment according to MMR status Le DT, et al. NEJM 371: , 2015

14 Current needs Better predictors to currently available immunotherapies. Predictors to future immunotherapies targeting mechanisms other than immune checkpoints. Predictors that work in immunoedited tumours and in immunosubversive tumours. Assays targeting the tumour genome and the tumour immune profile.

15 Ion NGS Platform Offers Integrated Solution for Multidimensional Approach Can characterizing the tumor micro- environment (TME) predict immune response? Can we improve a selection strategy for immune therapy clinical research trials? Can we identify population subsets that are predisposed to immune- mediated adverse events? Characterizing gene expression in TME for immune response pathways Sample prep Sequencing Sequencing of T cell receptors to characterize immune repertoire of the sample Analysis + + Characterizing somatic mutations to assess tumor mutation burden RNA-Seq TCR-Seq DNA-Seq Thermo Fisher All Rights Reserved For Research Use Only. Not for use in diagnostic procedures.

16 Characterizing Tumor Mutation Burden to Stratify Samples Tumor mutation burden analysis* (in development) DNA-Seq Accurate quantification of somatic mutations to assess tumor mutation burden in research samples Single-sample workflow (tumor only) with low input requirement Targeted NGS panel with high multiplexing ability Thermo Fisher All Rights Reserved For Research Use Only. Not for use in diagnostic procedures. *The content provided herein may relate to products that have not been officially released and is subject to change without notice.

17 Oncomine Immune Response Research Assay Panel Content Function Number of genes Function Number of genes Antigen presentation 3 B cell marker 11 Antigen processing 19 Dendritic cell 7 Innate immune response 11 Dendritic cell, macrophage 6 Leukocyte inhibition 2 Helper T cells 8 Leukocyte migration 5 Macrophage 5 Lymphocyte activation 2 Myeloid marker 7 Lymphocyte development 3 Neutrophil 5 Lymphocyte infiltrate 46 NK activation 8 B cell receptor signaling 3 NK cell marker 4 T cell receptor signaling 6 T cell differentiation 2 T cell regulation 9 TCR coexpression 19 Checkpoint pathway 30 PD-1 signaling 9 Chemokine signaling 10 Drug target 21 Cytokine signaling 15 Interferon signaling 8 Adhesion, migration 14 Type I interferon signaling 8 Apoptosis 4 Type II interferon signaling 23 Proliferation 10 Tumor antigen 17 Housekeeping 11 Tumor marker genes 394 primer sets 36 functional annotation groups Lymphocyte regulation Cytokine signaling Lymphocyte markers Checkpoint pathway Tumor characterization Housekeeping Thermo Fisher All Rights Reserved For Research Use Only. Not for use in diagnostic procedures.

18 Gene expression correlation of gastric cancer samples according to EBV status Red arrows are EBV negative cases

19 V(D)J Recombination Creates Tremendous CDR3 Diversity Tandemly arranged variable, diversity and joining genes Chewback of the ends of the V-D-J genes at the CDR3 junction Addition of non-templated bases (Nadditions) by TdT CDR1&2 CDR3 Immune Repertoire: The collection of B and T cell VDJ rearrangements present in an individual Thermo Fisher All Rights Reserved

20 AmpliSeq TCR Beta Long Read Assay - CDR1, 2 and 3 RNA/cDNA CDR1 Leader FR1 FR2 CDR2 FR3 Diversity(D) Joining (J) Constant Variable gene (V) CDR3 AmpliSeq Primers ~ bp Immune Response Characterization For research use only. Not for use in diagnostic procedures Cell Characterization for T cell Therapies Thermo Fisher All Rights Reserved Autoimmunity Biomarker Research

21 Advantages Simple and Flexible Workflow: Prepare libraries using from 10ng to 1ug of RNA starting material. Sequence up to 16 samples per chip with <48hrs turnaround. Unbiased output: V-gene primers are optimized to reproduce results from 5 RACE (no primer bias) CDR1 CDR2 CDR3 Comprehensive: 400bp read length offers complete characterization of CDR1,2,3 Highly accurate: Correction of sequencing and PCR errors leverages unique insights about TCR mrna Clonotype assignment confidence score Thermo Fisher All Rights Reserved

22 Rich Repertoire Analyses on Ion Reporter QC metrics V-gene and allele identification Not full length Quality trimmed Perfect read Representation of different alleles Read count Clonotype identification Clone sizes per variable gene Variable Joining CDR3 AA CDR3 NT Counts Frequency Rank TRBV3-1 TRBJ2-3 ASSQDGGQNTDTQY GCCAGCAGCCAAGATGGGGGACAGA ACACAGATACGCAGTAT Expanded clones In color TRBV3-1 TRBJ2-1 ASSQQLGEQF GCCAGCAGCCAACAATTAGGTGAGCA GTTC TRBV11-2 TRBJ2-3 ASSLTALGRSPDTQY GCCAGCAGCTTAACCGCCCTAGGCAG GAGTCCAGATACGCAGTAT TRBV28 TRBJ1-2 ASSLHHKSNYGYT GCCAGCAGTTTACATCACAAATCTAAC TATGGCTACACC TRBV29-1 TRBJ2-2 SIIIQNTGELF AGCATCATAATTCAGAACACCGGGGA GCTGTTT Thermo Fisher All Rights Reserved

23 Evaluation of AmpliSeq TCR Beta Long Read Assay Objectives 1. Characterize the tumor infiltrating T cell repertoire for a set of diverse CRC samples 2. Evaluate evidence for tumor antigen driven T cell expansion within TME

24 TCRbeta sequencing of fresh frozen CRC samples Sample Reads Clones Shannon diversity Evenness TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR TCR

25 Definitions: CRC

26 Description of inflammation grading methodology Mild Moderate Severe Still waiting for the Pathologist to provide me the proper description.

27 Definitions: T cell clone richness and evenness T cell clone refers to the set of T cells having the same VDJ rearrangement. They are related to each other by descent. V D J Evenness is a measurement of the similarity of clone sizes. It is derived from the Shannon Diversity of the clone population. Evenness of 1 indicates that all clones are found at the same frequency. Evenness approaches 0 if there are a small number of dominating clones. High Evenness Low Evenness Thermo Fisher All Rights Reserved

28 Inflammation classification correlates with T cell clone richness Clones detected vs inflammation status for 20 CRC biopsies * p=.038

29 T cell clone richness is elevated in distal CRC Clones detected vs tumor localization for 20 CRC biopsies biopsies Sample 13 is outlier

30 No correlation of clone richness with tumor grade Clones detected vs tumor grade for 20 CRC biopsies

31 Minimal T cell infiltration detected in metastatic CRC Clones detected vs metastatic status for 20 CRC biopsies *** p=.0001

32 TCR11 same patient as TCR18 but different block

33 Objective 2: Detecting tumor antigen driven T cell expansion Tumor neoantigens within the TME may stimulate the proliferation or recruitment of T cells possessing a specific CDR3 amino acid binding motif. Due to the degeneracy of the amino acid code, T cell clones having the same CDR3 amino acid sequence may have different CDR3 nucleotide sequences. This phenomenon is often described as a convergent T cell response to antigen. We can identify such events using TCR repertoire profiling.

34 Spectratyping plot highlighting clonal proliferation in a severely inflamed distal CRC biopsy The following slide will look at this expansion in detail

35 CDR3 amino acid convergence within TME: Evidence for tumor antigen-driven T cell responses This tumor repertoire is enriched for T cells containing the ASSPSQNQPQH CDR3 amino acid sequence. Two clones having this sequence were detected in this sample. Variable Gene TRBV6-5 *01 TRBV6-5 *01B Joining Gene TRBJ1-5 *01 TRBJ1-5 *01 CDR3AA CDR3NT Freq ASSPSQNQP QH ASSPSQNQP QH GCCAGCAGTCCGTCACAAAATCAGCCCC AGCAT GCCAGCAGTCCTTCCCAGAATCAGCCCC AGCAT Variable and Joining gene contribution to CDR3 highlighted in yellow and blue. Clones differ at positions deriving from addition of non-templated bases by TdT. This individual also possesses a synonymous allele variant of TRBV6-5 that is absent from the IMGT database (denoted *01B).

36 Preliminary (very) conclusions The TCR repertoire in CRC recapitulates differences in tumor inflammation. There is evidence of convergence of T cell selection towards specific antigens.

37 Immuno Oncology Consortium For research use only. Not for use in diagnostic procedures

38 Thermo Fisher Scientific and its affiliates are not endorsing, recommending, or promoting any use or application of Thermo Fisher Scientific products presented by third parties during this seminar. Information and materials presented or provided by third parties are provided as-is and without warranty of any kind, including regarding intellectual property rights and reported results. Parties presenting images, text and material represent they have the rights to do so.