Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire

Transcription

1 Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire Geoffrey M. Lowman, PhD Senior Staff Scientist EACR - 02 July 2018 For Research Use Only. Not for use in diagnostic procedures. The world leader in serving science

2 Conflicts The authors are full-time employees of ThermoFisher Scientific 2 For Research Use Only. Not for use in diagnostic procedures.

3 Need for Biomarkers in Immuno-Oncology Dendritic Cell Tumor Combination Immunotherapy T cell PD-1 or CTLA-4 Checkpoint blockade may target PD-1 and CTLA-4 pathways to upregulate T cell cytotoxic response Macrophage Combination immune checkpoint therapy Adapted from Sharma et al. Cell, 2015;161(2):205 with permission from Elsevier Adapted from Ott, et al. Clin Cancer Res. 2013;19(19):5300 with permission from AACR. Biomarkers for prediction of adverse events during immunotherapy Biomarkers for prediction of response/non-response 3 For Research Use Only. Not for use in diagnostic procedures.

4 Need for Biomarkers in Immuno-Oncology Dendritic Cell Tumor Combination Immunotherapy T cell PD-1 or CTLA-4 Checkpoint blockade may target PD-1 and CTLA-4 pathways to upregulate T cell cytotoxic response Macrophage Combination immune checkpoint therapy Adapted from Sharma et al. Cell, 2015;161(2):205 with permission from Elsevier Adapted from Ott, et al. Clin Cancer Res. 2013;19(19):5300 with permission from AACR. Biomarkers for prediction of adverse events during immunotherapy Biomarkers for prediction of response/non-response 4 For Research Use Only. Not for use in diagnostic procedures.

5 Ion Torrent Oncomine TCR Beta LR Assay Sequencing Beta Chain of T Cell Receptors to Characterize Immune Status Long Read NGS assay capturing all 3 CDRs (1,2 &3). Uniquely captures germline TRBV polymorphism from blood/tissue to investigate predisposition to adverse events. V-gene polymorphism Clonality / TCR convergence 10ng- 1mg Flexible input/sequencing depth requirements covering samples with low, medium, and high clonal diversity. Leader FR1 FR2 FR3 CDR1 CDR2 CDR3 Variable (V) Diversity (D) AmpliSeq Primers ~ bp Joining (J) Constant Superior informatics for accurate clonality and β chain sequence assessment without interference from primer bias. Allelic variants may alter interaction of CDR1 and 2 with HLA TCRComplex.png used under creative commons license 5 For Research Use Only. Not for use in diagnostic procedures.

6 Detecting Tumor Antigen Driven T Cell Expansion Tumor neoantigens may stimulate the proliferation of T cells possessing a stereotyped TCRβ amino acid sequence. Due to the degeneracy of the amino acid code, T cell clones having the same amino acid sequence may have different nucleotide sequences. Tumor antigen stimulates T cells with stereotyped TCRβ amino acid features Extraneous TCRs in gray Measuring the features of convergent TCRs, rather than all detected TCRs, allows one to eliminate noise from TCRs that are not involved in tumor antigen specific responses. Proliferation of convergent T cells (small fraction of total T cells) Venturi, et al. PNAS For Research Use Only. Not for use in diagnostic procedures.

7 TCR Convergence May Be a Hallmark of Chronic Antigen Stimulation Tumor Ag Priming and proliferation of tumor antigen specific T cells. T cells do not destroy tumor. Tumor antigen continues to prime naive T cells with shared antigen specificity. Over time, convergent TCR groups become detectable in peripheral blood. 7 For Research Use Only. Not for use in diagnostic procedures.

8 Example of a Convergent TCR Group in an Individual With Melanoma Variable Joining CDR3 AA CDR3 NT Frequency TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTAGGTCAGGCATACGAGCAGTAC 1.8E-3 TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTGGGACAGGCCTACGAGCAGTAC 4.8E-4 TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTAGGGCAGGCCTACGAGCAGTAC 9.9E-05 This sample contains three TCR sequences that are identical in amino acid space but have distinct CDR3 NT junctions owing to differences in non-templated bases at the V-D-J junction. 8 For Research Use Only. Not for use in diagnostic procedures.

9 Example of a Convergent TCR Group in an Individual With Melanoma Variable Joining CDR3 AA CDR3 NT Frequency TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTAGGTCAGGCATACGAGCAGTAC 1.8E-3 TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTGGGACAGGCCTACGAGCAGTAC 4.8E-4 TRBV7-8 TRBJ2-7 ASSLGQAYEQY GCCAGCAGCTTAGGGCAGGCCTACGAGCAGTAC 9.9E-05 This sample contains three TCR sequences that are identical in amino acid space but have distinct CDR3 NT junctions owing to differences in non-templated bases at the V-D-J junction. Note: Base substitution PCR and sequencing errors can create artifacts that resemble convergent TCRs. The Ion Torrent sequencing platform has very low rates of base substitution errors. 9 For Research Use Only. Not for use in diagnostic procedures.

10 TCR Convergence Defines the Melanoma Infiltrating T Cell Repertoire TCRB sequencing of melanoma tumor biopsies (N=63) revealed the presence of expanded T cell clones having convergent TCRB chains. Convergent TCR Frequency in PBL and Melanoma Biopsy p<1e-4 TCR convergence appears elevated within melanoma biopsies compared to healthy PBL (N=4). Adapted from Looney et al, AACR For Research Use Only. Not for use in diagnostic procedures.

11 TCR Convergence Defines the Melanoma Infiltrating T Cell Repertoire TCRB sequencing of melanoma tumor biopsies (N=63) revealed the presence of expanded T cell clones having convergent TCRB chains. Convergent TCR Frequency in PBL and Melanoma Biopsy p<1e-4 TCR convergence appears elevated within melanoma biopsies compared to healthy PBL (N=4). Is TCR convergence also elevated in PBL from individuals with cancer? Adapted from Looney et al, AACR For Research Use Only. Not for use in diagnostic procedures.

12 Tumor Antigen Specific T Cells May Be Detected in Peripheral Blood Cancer Immunity Cycle T cells are primed with tumor antigen Tumor antigen specific T cells enter peripheral blood T cell infiltration of tumor Source: License: Labels were removed. 12 For Research Use Only. Not for use in diagnostic procedures.

13 Convergent TCR Frequency Convergent TCR Frequency TCRB Convergence to Predict Response to Immunotherapy from Pre-Treatment Peripheral Blood Convergent TCR frequency Convergent TCR Frequency vs Response for Adenocarcinoma Convergent TCR Frequency in PBL and Response Research for Adenocarcinoma Subjects Patients (p=.027) p=.027 No Objective Clinical Response No Objective Clinical Response N=3 Objective Clinical Response Objective Clinical Response N=8 Convergent TCR Frequency vs Response for Melanoma Research Subjects p=.177 No Objective Clinical Response N=8 Objective Clinical Response N=9 Sensitivity ROC for Prediction of Response ROC for individuals having melanoma or adenocarcinoma Adenocarcinoma, AUC=.92 Melanoma, AUC= Specificity Note: Research sample set includes cancers of varying stages treated with three checkpoint blockade agents. Furthermore, checkpoint blockade agents were utilized at low dose (1 mg/kg). Increasing dose may convert some non-responding individuals having higher TCR convergence into responders. 13 For Research Use Only. Not for use in diagnostic procedures.

14 TCR Profiling May Provide the Most Direct Measurement of Tumor Immunogenicity Convergent TCRs are the result of T cell responses to antigen, and thus may serve as a metric for quantifying tumor immunogenicity. We propose that TCR convergence is a T cell repertoire feature which preferentially arises following chronic antigen stimulation rather than the acute but transient antigen challenges elicited by infectious disease. Sequence of Events to Elicit Anti-Tumor T Cell Response Tumor acquires nonsynonymous mutation Non-synonymous mutation is translated Translated protein is broken into peptides Tumor mutation burden profiling (TMB) Given that tumor antigens may prime T cells over months or years time, measurements of TCR convergence may provide an accurate pre-treatment estimate of tumor immunogenicity. Peptide is presented by HLA T cells recognize peptide and proliferate HLA typing TCRβ sequencing of peripheral blood Anti-tumor T cell responses 14 For Research Use Only. Not for use in diagnostic procedures.

15 Acknowledgements Tim Looney Elizabeth Linch Lauren Miller Alex Pankov Denise Topacio-Hall Alice Zheng Gauri Ganpule Jim Godsey Mark Andersen Fiona Hyland Simon Cawley Rob Bennett 2018 Thermo Fisher Scientific Inc. All rights reserved. All (other) trademarks are the property of Thermo Fisher Scientific and its subsidiaries. 15 For Research Use Only. Not for use in diagnostic procedures.