Role of DNA Repair Genes in Leukemia Disease

Transcription

1 Role of DNA Repair Genes in Leukemia Disease Reda Fekry a, Noha Mohamed Said b* and Waseem Atef b a Chemistry Department, Faculty of science, Zagazig University, Zagazig, Egypt. b Biochemistry Division, Chemistry Department, Faculty of science, Zagazig University, Zagazig, Egypt. Date of revised paper submission: 03/12/2016; Date of acceptance: 14/12/2016 Date of publication: 20/12/2016; *First Author / Corresponding Author; Paper ID: BS Reviewers: Ezeamama, A. E., USA; Baqri, S. R., India. Abstract Background: The various current studies have identified different single nucleotide polymorphisms (SNPs) in population that are associated with variations in the risks of many different cancer diseases. XRCC genes group (DNA repair genes) have role in many different Cancer disease like (Lung cancer, colorectal carcinoma, prostate cancer, gastric cancer.) Objectives: The aim of this study was to assess the association between single nucleotide polymorphisms of two genes of XRCC group as a DNA repair genes and leukemia disease in Egyptian population. We evaluated the role of SNPs in two genes, XRCC1 and XRCC3. We further investigated the potential combined effect of these genes variants on Leukemia disease risk. Methods: The two genes polymorphisms were characterized in 48 Leukemic Egyptian patient and 48 healthy one by (RFLP PCR and tetra ARMS techniques) in a case-control study. Results: for XRCC1 gene: Our results revealed that there is high significant difference in genotypes and alleles distribution of XRCC1 gene between control group and patient groups (P-value = 0.000**) respectively. However, no significant difference in genotypes of XRCC3 gene distribution between control and patients group (p-value = 0.940). Conclusion: our data suggest that the XRCC1 alleles and genotypes may play a role in leukemia susceptibility as a risk factor. Keywords: DNA, Genes, Leukemia. 1. Introduction Leukemia is a group of diseases characterized by increased numbers of white cells in the blood and bone marrow. The total number of white blood cells normally exists from 4 million to 11 million cells per milliliter of blood [1]. 1 P a g e

2 Cells of the body constantly exposed to mutagenic assault from radiation, alcohol, chemical carcinogens, estrogen and diet that produce reactive oxidized bases, bulky DNA adducts, oxygen species and DNA strand breaks. Unrepaired or misrepaired DNA may lead to deletions, amplifications, and/or mutations of critical genes that contribute to breast carcinogenesis [2]. There are multiple pathways to repair the different types of DNA damage and maintain genomic integrity. Among those pathways is nucleotide excision repair (NER) pathway which repairs a wide variety of DNA damage, including cross-links, oxidative damage and bulky adducts and the base excision repair (BER) pathway which repair small lesions like as fragmented or non bulky adducts, oxidized or reduced bases and lesions caused by methylating agents [3]. There are over 100 identified DNA repair genes and most of them are known to have genetic variation in humans [4]. DNA repair genes polymorphism may alter the protein function and cause reduction in DNA repair capacity that may lead to genetic instability and carcinogenesis [5, 6].The X-ray repair cross-complementation group 1 (XRCC1) is one of the most important proteins that has important role in the BER pathway [7]. This DNA repair protein is responsible for the effective repair of DNA damage caused by active oxygen, ionization, and alkylating agents [8] The XRCC1 gene is located on chromosome 19q and has 17 exons [9]. It has more than 300 valid single nucleotide polymorphisms mentioned in the dbsnp database ( in which one of them is more frequent and lead to amino acid replacement: Arg194Trp (exon 6, C to T substitution, and rs [10]. Although the functional effects of these polymorphisms in XRCC1 have not been understood, now it is suggested that the amino acid changes at preserved regions may vary its function [11]. This change in protein biochemistry leads to the hypothesis that variant alleles may reduce kinetics repair of enzyme. Another DNA repair pathway is the homologous recombination repair (HRR) pathway which consists of at least 16 protein components, including XRCC3 [12]. A common polymorphism in XRCC3 is in the exon 7 of the XRCC3 gene results in an amino acid substitution at codon 241(Thr241Met) that may affect the enzyme s function or its interaction with other proteins involved in DNA damage and repair [13]. The XRCC3 variant allele is associated with increased risk of melanom [14] bladder cancer [15], breast cancer [16] and lung cancer [17]. Since XRCC1 and XRCC3 play important role in DNA repair, we studied the functional polymorphisms of them in association with Leukemia risk in an Egyptian population. 2 P a g e

3 2. Subjects and Methods The current study included 98 age matched volunteers divided into two groups (48 control and 48 of different leukemia patients). The samples were taken between January 2012 and September 2012 from oncology clinics of Tanta cancer institute Tanta University. The detailed history of the volunteers was known with the consent of them. For each case, history, full clinical examination, routine laboratory investigations and specific laboratory investigations (detection of XRCC1 gene polymorphism (rs ) and XRCC3 (rs ) were done. (Table 1): Age, sex, type of their disease, and the clinic-pathological features of the patients Group Mean ± SD Age SE Range Sex Percent Type of patient percent Control ± Patient ± male 54.2% ALL 27.1% 22 female 45.8% AML 4.2% 24 male 50% CLL 20.8% 24 female 50% CML 47.9% The patients were evaluated according to the type of their disease, their sex and age. The clinic-pathological features of the patients were summarized in Table 1. The healthy people were chosen with no signs or symptoms of leukemia. They were randomly selected from ALBORG laboratory in Tanta. The study protocol was approved by the ethical committee of Zagazig University, and informed consent for the experimental use of specimens was obtained from all participants. 2.1 Data Collection The clinical archive files of different leukemic patients were available as a source for their data. Also, the participants completed a questionnaire related to their familial and medical histories particularly. Leukemic cases filled in the questionnaire at the time of clinic appointment whereas controls were interviewed at the laboratory at the time of enrollment. 2.2 Blood Collection and Biochemical Assay Three ml of blood sample was taken from every participant under complete aseptic condition and was collected in sterile EDTA containing tubes for DNA extraction. Extracted DNA was stored IN -20 C till use. 2.3 DNA Isolation Genomic DNA was extracted from EDTA whole blood using a spin column method according to the protocol TIAN amp Genomic DNA Kit; TIANGEN BIOTECH (BEIJING) CO.LTD. The quality of the genomic DNA was tested using agarose gel electrophoresis. DNA was stored at -20 C till the time of use. 3 P a g e

4 2.4 Genotyping for XRCC1 (Arg194Trp) (rs ) (C>T) Part of extracted DNA was used for the detection of XRCC1 Arg194Trp polymorphism using tetra-primer amplification refractory mutation system (t-arms-pcr). This method is rapid, simple, and economical for SNP analysis based on the allele-specific primers. So in this method four primers are necessary to amplify a larger fragment from template DNA comprising the SNP and two smaller fragments showing each of two allele-specific products. The genomic sequences of the genes were obtained from the National Center for Biotechnology Information (NCBI) ( For this polymorphism, we used two external primers (Forward outer and Reverse outer) and two allele-specific internal primers that were designed in opposite orientation (Forward inner and Reverse inner) for the detection of every allele. The allele-specific amplicons have the different lengths and can be separated easily by standard gel electrophoresis. PCR reaction was performed in a final volume of 20 micro containing 10 micro (2x PCR Master mix solution i-taq TM) containing (i-taq TM DNA Polymrase (5u/µl) 2.5 U,dNTPs 2.5 mm each, PCR reaction buffer 1x,( gel loading buffer 1x) + 5µ of working primer soln (1 of the outer primers: 10 internal primers)+ 5µ of DNA sample. The tetra primer ARMS-PCR primer sequences, the annealing temperature, and the amplicon sizes [44] are listed in the table below: Table (2): Designed primers for tetraprimer T- ARMS-PCR reactions, annealing temperature, and fragments sizes. SNP Primer sequence Annealing temperature ( o C) Fragments length FO: 5'-CGTCCCAGGTAAGCTGTAC-3' RO: XRCC1 Arg194Trp 5'-CACTCCTATCTATGGGACACAG-3' FI: 63 o C for 30 sec Outer: 471 Arg: 297 5'-CGGGGGCTCTCTTCTTCATCC-3 Trp: 219 RI: 5'- CACCTGGGGATGTCTTGTTGATACA- 3' 4 P a g e

5 The cycling conditions for PCR program were 6 min at 95 o C for 5 for activation followed by 35 cycles of 95 o C for 30 s for denaturation, 63 o C for 30 s for annealing, 72 o C for 30s for elongation and a final cycle 72 o C for 10min for final elongation. PCR products were separated by standard electrophoresis on 2% agarose gel containing ethidium bromide. 2.5 Genotyping for XRCC3 (Thr241Met) (C>T) (rs861539) Another part of extracted DNA was used for the detection of XRCC3 Thr241Met polymorphism using restriction fragment length polymorphism (RFLP-PCR). This method is the most common for SNP analysis based on using restriction enzyme for cutting one of the two alleles of the polymorphism. In this method two primers are necessary to amplify a specific fragment of template DNA containing polymorphism position) followed by another step of digestion to PCR product using the suitable restriction enzyme. PCR reaction was performed in a final volume of 20 micro containing 10 micro (2x PCR Master mix solution i-taq TM) containing (i-taq TM DNA Polymrase (5u/µl) 2.5 U,dNTPs 2.5 mm each, PCR reaction buffer 1x,( gel loading buffer 1x) + 5µ of working primer soln.+ 5µ of DNA sample. Table (3): Designed primers for RFLP-PCR reactions, annealing temperature, and fragments sizes. SNP Primer sequence Annealing temperature ( o C) Fragments length XRCC3 Thr241Met Forward: GCCTGGTGGTCATCGACTC Reverse: GCTTCCGCATCCTGGCTAAA Pcr product :211 bp 60 o C for 30 sec Thr: 211 Met: The cycling conditions for PCR program were 5 min at 95 o C for 5 for activation followed by 35 cycles of 94 o C for 30 s for denaturation, 60 o C for 30 s for annealing, 72 o C for 30s for elongation and a final cycle 72 o C for 10min for final elongation. PCR products of 136 bp were digested overnight with the restriction enzyme NcoI (R0193S, NEW ENGLAND BioLabs). The choosing of the restriction enzyme was done by using one of the web programs for restriction enzyme choosing for taking an example ( that help to choose the better restriction enzyme by inputting the sequence around the variant to the program for choosing the suitable restriction enzyme. 5 P a g e

6 Restriction products were subjected to electrophoresis in 2 % agarose gel with ethidium bromide (1 mg/ml) for visualization under ultraviolet light and three genotypes were detected: wild homozygous (211 bp), mutant homozygous ( bp) and heterozygous( bp) (Fig.1). 2.6 Statistical Analysis All data were analyzed using Statistical analyses were performed using Statistical Package for Social Sciences (SPSS version 23). Continuous variables were expressed as the mean ± SD & median (range), and the categorical variables were expressed as a number (percentage). Categorical variables are expressed as frequencies and percentages. The independent t test and one way ANOVA were used to compare quantitative data. Correlation& regression analysis were used to study the relation between numerical variables, Chi-square was used to examine the relationship between categorical variables. Odds ratio test was studied under 5 models (allelic- homozygoteheterozygote-dominant-recessive) with confidence interval 95%, also HardyWeinberg equilibrium test used for categorical variables. P-value <0.05 was considered significant difference and P-value <0.001was considered highly significant difference. Statistical analyses were performed using Statistical Package for Social Sciences (SPSS version 23). 3. Result 3.1 XRCC1 (Arg194Trp) Polymorphism and Leukemia Disease Risk The genotype frequencies of homozygous (AA), heterozygous (AT), and homozygous mutated (TT) were 4.2, 58.3, and 37.5% in patients with Leukemia respectively; and 64.6, 18.8, and 16.7% in controls, respectively. In general, there was a suitable difference in genotypes frequencies of the XRCC1 polymorphism between control and leukemic patient (P = 0.000**) Table 4. The frequency of A allele in (Table 5) was % in leukemic patients and % in controls. Regarding the risk of development of LEUKEMIA the AA wild type genotype and A wild type allele were taken as references. These data suggested that the A allele was high significantly associated with a decreased risk of LEUKEMIA in all the genetic models (p< 0.05) except the heterozygote model (OR: % CI: ( ) (P = 0.570) which was associated with increased risk for leukemia (Table 6). 6 P a g e

7 (Table 4): Distribution of XRCC1 genotype frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Genotype frequencies XRCC1 CC CT TT Pearson Chi square p-value N % N % N % Control group ** Diseased group (Table 5): Distribution of XRCC1 allele frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Allele frequencies XRCC1 A T Pearson Chi square p-value N % N % Control group ** Diseased group (Table 6): Association between XRCC1 (Arg194Trp) polymorphism and Leukemia disease risk XRCC1 Test of association Comparison Odds Ratio C.I (95%) Pearson Chi square p-value Homozygote comparisons (AA vs. TT) ** 7 P a g e

8 Heterozygote comparison (AT vs. TT) Dominant model (AA/AT vs. TT) Recessive model (AA vs. TT/AT) Allele contrast (A vs. T) * ** ** 3.2 XRCC3 (Thr241Met) polymorphism and Leukemia disease risk (Table 7) The genotype frequencies of homozygous (CC), heterozygous (CT), and homozygous mutated (TT) were 87.5, 8.3, and 4.2 % in patients with LEUKEMIA, respectively; and 85.4, 10.4, and 4.2 % in controls, respectively. Generally, there was not a significant difference in the genotypes frequencies of the XRCC3 (Thr241Met) polymorphism between control and LEUKEMIA (P = 0.940). (Table 7): Distribution of XRCC3 genotype frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Genotype frequencies XRCC3 CC CT TT Pearson Chi square p-value N % N % N % Control group Diseased group The frequency of C allele was % in leukemic patients and % in controls in (Table 8). Regarding the risk of development of LEUKEMIA the CC wild type genotype and C wild type allele were taken as references. These data suggested that the neither TT geneotype nor T allele were associated with an increased risk of LEUKEMIA under any genetic model (p 0.05) 8 P a g e

9 (Table 8): Distribution of XRCC3 allele frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Allele frequencies XRCC3 C T Pearson Chi square p-value N % N % Control group Diseased group (Table 9): Association between XRCC3 (Thr241Met) polymorphism and Leukemia disease risk XRCC3 Test of association Comparison Odds Ratio C.I (95%) Pearson Chi square p-value Homozygote comparisons (CC vs. TT) Heterozygote comparison (CT vs. TT) Dominant model (CC/CT vs. TT) Recessive model (CC vs. CT/TT) Allele contrast (C vs. T) P a g e

10 (Fig. 1 Representative Agarose gel electrophoresis results for XRCC3 (C18067T) Polymorphism in Leukemic patients by the RFLP PCR method. Lane M marker (100 bp), lanes 1 6,8,9,11,12,16,25,27,28,30,31,34 38 are (CC) genotype, and lane 10,32,33 are (CT) genotype.) 4. Discussion and Conclusion Leukemia starts in the tissue forming blood. Most blood cells develop from cells in the bone marrow called stem cells. The bone marrow is a soft material in the center of the bones. The stem cells mature into the different kinds of the blood cells. As the blood cells grow old or get damaged, they die, and then new cells take their place. But in the case of the person with leukemia, bone marrow makes the abnormal white blood cells. These abnormal cells are the leukemia cells. Unlike the normal blood cells, leukemia cells do not die as compared to normal cells. So they may crowd out generally red blood cells, white blood cells and platelets. This makes it hard for normal blood cells for doing their work. The types of leukemia also can be based on the group type of the white blood cell which is affected. The leukemia can start in lymphoid cells or myeloid cells. Leukemia that affects lymphoid cells is called lymphoid, lymphocytic, or lymphoblastic leukemia. The leukemia that affects the myeloid cells is known as myeloid, myelogenous, or myeloblastic leukemia. There are four common types of leukemia: we divided leukemic patient according to these four common types. 10 P a g e

11 4.1 Chronic lymphocytic leukemia (CLL): CLL affects the lymphoid cells and grows slowly in general. Most often, people diagnosed with this disease are the age of 55 and above. It generally never affects children. 4.2 Chronic myeloid leukemia (CML): the CML affects myeloid cells and usually grows slowly at first. It mainly affects adult person. 4.3 Acute lymphocytic (lymphoblastic) leukemia (ALL): The ALL affects lymphoid cells and grows fast. ALL is the most common type of the leukemia in the young children. It also affects the adults. 4.4 Acute myeloid leukemia (AML): AML affects myeloid cells and grows quickly. It occurs in both adults and children. Different DNA repair systems maintain the integrity of the human genome, so deficiency in the repair capacity due to mutations or polymorphisms in genes involved in DNA repair can lead to genomic instability that, in turn, is related to chromosomal instability syndromes and increased risk of developing various types of cancer [18]. DNA repair systems have a critical role in maintaining the genome integrity and stability. DNA repair gene polymorphisms may influence the capacity to repair DNA damage, and thus lead to increased cancer susceptibility. Recently, genetic polymorphism of the DNA repair genes in the etiology of several cancers has drawn increasing attention. Because of genetic variation, the decreased capacity of the DNA repair gene is associated with increased risk and susceptibility to human tumors [19]. The X-rays repair the cross-complementing groups 1, 3 (XRCC1) and (XRCC3), a DNA repair genes, may be involved in leukemia susceptibility. The objective of the current study was to investigate the association of (Arg194Trp) polymorphism of XRCC1 gene and (Thr241Met) polymorphism of XRCC3 gene with the risk of leukemia in Egyptian population. Our results revealed that there is a higher significant difference in genotypes and alleles frequencies of XRCC1 (Arg194Trp) gene between Leukemic patients and control groups. However, There is no significant difference in the genotype and allele frequencies of the XRCC3 (Thr241Met) polymorphism between control and Leukemic patient. Several studies discussed the relation between these two polymorphisms and different types of leukemia. However, this is the first study to discuss this relation in Egyptian population. The relationship between these XRCC1 polymorphisms and the leukemia risk has been observed in various case control studies and the results of these studies were inconclusive and 11 P a g e

12 12 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp contradictory. So that the association between XRCC1 polymorphisms and risk of some types of leukemia was observed by the number of studies [20-32], other reports did not take the XRCC1 genetic variants as the risk or protective factors for the leukemia [33-38], Zhang and his team (2013) [39] reported in their meta analysis that XRCC1 (Arg194Trp) may influence some susceptibilities of leukemia type and the race populations. Most of the studies have been performed to investigate the association between XRCC3 Thr241Met polymorphism and cancers risk. A study for the analysis about the polymorphism in the Turkish population revealed that there is no statistical association between CML and XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms in patients of Turkish. This result agrees with our result [40]. However, another study in Romanian population revealed that the XRCC3 Thr241Met polymorphism may be a genetic risk factor for AML [41]. Yan and his team (2014) [42] suggests no association between XRCC3 Thr241Met (rs861539) polymorphism and the leukemia risk in the overall populations in their Meta analysis but a suitable association between XRCC3 Thr241Met (rs861539) polymorphism and leukemia risk in some Asian population. This result is the same as our result which suggests no association between leukemic patients and this polymorphism. Qin and his group (2014) [43] showed in their Meta analysis that The XRCC3 Thr241Met polymorphism might be associated with risk of leukemia in AML. This result disagrees with our results. Our study is the first study to give results about these polymorphisms in Egyptian population. Further studies with large sample are recommended for precise conclusion. References 1. Hoffbrand AV, Moss PAH, Pettit JE (ed)., 2006, "Essential Haematology" 5th Edition. Blackwell Publishing, Oxford: Pg Hu JJ, Smith TR, Miller MS, Lohman K, Case LD, 2002, Genetic regulation of ionizing radiation sensitivity and breast cancer risk. Environ Mol Mutagen 39: Parshad R, Price FM, Bohr VA, Cowans KH, Zujewski JA, Sanford KK, 1996, Deficient DNA repair capacity, a predisposing factor in breast cancer. Br J Cancer 74(1): Debniak T, Scott RJ, Huzarski T, Byrski T, Masojc B, van de Wetering T, Serrano-Fernandez P, Gorski B, Cybulski C, Gronwald J, Debniak B, Maleszka R, Kladny J, Bieniek A, Nagay L, Haus O, Grzybowska E, Wandzel P, Niepsuj S, Narod SA, Lubinski J, 2006, XPD common variants and their association with melanoma and breast cancer risk. Breast Cancer Res Treat 98: De Boer JG, 2002, Polymorphisms in DNA repair and environmental interactions. Mutat Res 509:

13 13 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp Berwick M, Vineis P, 2000, Markers of DNA repair and susceptibility to cancer in humans: an epidemiologic review. J Natl Cancer Inst 92: R. J. Hung, J. Hall, P. Brennan, and P. Boffetta, 2005, Genetic polymorphisms in the base excision repair pathway and cancer risk: a huge review, American Journal of Epidemiology, vol. 162, no. 10, pp K. W. Caldecott, 2003, XRCC1 and DNA strand break repair, DNA Repair, vol. 2, no. 9, pp L. H. Thompson and M. G. West, XRCC1 keeps DNA from getting stranded, Mutation Research, vol. 459, no. 1, pp. 1 18, M. R. Shen, I. M. Jones, and H. Mohrenweiser, 1998, Nonconservative amino acid substitution variants exist at polymorphic frequency in DNA repair genes in healthy humans, Cancer Research, vol. 58, no. 4, pp S. Trabulus, G. S. Guven, M. R. Altiparmak et al., 2012, DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease, Molecular Biology Reports, vol. 39, no. 6, pp Dianov GL, Sleeth KM, Dianova II and Allinson SL, 2003, Repair of abasic sites in DNA. Mut Res 531: Kuschel B, Auranen A, McBride S, Novik KL, Antoniou A et al., 2002, Variants in doublestrand break repair genes and breast cancer susceptibility. Hum Mol Genet 11: Winsey SL, Haldar NA, Marsh HP, Bunce M, Marshall SE, Harris AL, Wojnarowska F and Welsh KI, 2000, A variant within the DNA repair gene XRCC3 is associated with the development of melanoma skin cancer. Cancer Res 60: Matullo G, Guarrera S, Carturan S, Peluso M, Malaveille C, Davico L, Piazza A and Vineis P, 2001, DNA repair gene polymorphisms, bulky DNA adducts in white blood cells and bladder cancer in a case-control study. Int J Cancer 92: Smith TR, Millera MS, Lohmanc K, Langec EM, Casec LD, Mohrenweiser HW and Hu JJ, 2003, Polymorphisms of XRCC1 and XRCC3 genes and susceptibility to breast cancer. Cancer Lett 190: Jacobsen NR, Raaschou-Nielsen O, Nex_ B, Wallin H, Overvad K, Tj_nneland A and Vogel U, 2004, XRCC3 polymorphisms and risk of lung cancer. Cancer Lett 213: Trabulus, S., G. S. Guven, M. R. Altiparmak et al., 2012, DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease, Molecular Biology Reports, vol. 39, no. 6, pp Garcia-Closas M, Malats N, Real FX, et al., 2006, Genetic variation in the nucleotide excision repair pathway and bladder cancer risk. Cancer Epidemiol Biomarkers Prev., 15: Annamaneni S, Gorre M, Kagita S, Addepalli K, Digumarti RR, et al., 2012, Association of XRCC1 gene polymorphisms with chronic myeloid leukemia in the population of Andhra Pradesh, India. Hematology. 21. Batar B, Güven M, Bariş S, Celkan T, Yildiz I, 2009, DNA repair gene XPD and XRCC1 polymorphisms and the risk of childhood acute lymphoblastic leukemia. Leuk Res 33:

14 14 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp Duman N, Aktan M, Ozturk S, Palanduz S, Cakiris A, et al., 2012, Investigation of Arg399Gln and Arg194Trp Polymorphisms of the XRCC1 (X-Ray Cross-Complementing Group 1) Gene and Its Correlation to Sister Chromatid Exchange Frequency in Patients with Chronic Lymphocytic Leukemia. Genetic Testing and Molecular Biomarkers 16: El-Din M, Raslan H, Abdel-Hamid S, Makhlouf M, 2012, Detection of XRCC1 gene polymorphisms in Egyptian patients with acute myeloid leukemia. Comparative Clinical Pathology 21: Ganster C, Neesen J, Zehetmayer S, Jäger U, Esterbauer H, et al., 2009, DNA repair polymorphisms associated with cytogenetic subgroups in B-cell chronic lymphocytic leukemia. Genes Chromosomes Cancer 48: doi: /gcc Joseph T, Kusumakumary P, Chacko P, Abraham A, Pillai MR, 2005, DNA repair gene XRCC1 polymorphisms in childhood acute lymphoblastic leukemia. Cancer Lett 217: Kim HN, Kim NY, Yu L, Huong Thi Thanh T, Kim YK, et al., 2012, Association of GSTT1 polymorphism with acute myeloid leukemia risk is dependent on smoking status. Leukemia & Lymphoma 53: Matullo G, Dunning AM, Guarrera S, Baynes C, Polidoro S, et al., 2006, DNA repair polymorphisms and cancer risk in non-smokers in a cohort study. Carcinogenesis 27: Özcan A, Pehlivan M, Tomatir AG, Karaca E, Özkinay C, et al., 2011, Polymorphisms of the DNA repair gene XPD (751) and XRCC1 (399) correlates with risk of hematological malignancies in Turkish population. African Journal of Biotechnology 10: Pakakasama S, Sirirat T, Kanchanachumpol S, Udomsubpayakul U, Mahasirimongkol S, et al., 2007, Genetic polymorphisms and haplotypes of DNA repair genes in childhood acute lymphoblastic leukemia. Pediatr Blood Cancer 48: Seedhouse C, Bainton R, Lewis M, Harding A, Russell N, et al., 2002, The genotype distribution of the XRCC1 gene indicates a role for base excision repair in the development of therapy-related acute myeloblastic leukemia. Blood 100: Tumer TB, Yilmaz D, Tanrikut C, Sahin G, Ulusoy G, et al., 2010, DNA repair XRCC1 Arg399Gln polymorphism alone, and in combination with CYP2E1 polymorphisms significantly contribute to the risk of development of childhood acute lymphoblastic leukemia. Leuk Res 34: Sorour A, Ayad MW, Kassem H, 2013, The genotype distribution of the XRCC1, XRCC3, and XPD DNA repair genes and their role for the development of acute myeloblastic leukemia. Genet Test Mol Biomarkers 17: Abramenko I, Bilous N, Chumak A, Kostin A, Martina Z, et al., 2012, DNA repair polymorphisms in B-cell chronic lymphocytic leukemia in sufferers of Chernobyl Nuclear Power Plant accident. J Radiat Res 53: Canalle R, Silveira VS, Alberto Scrideli C, Queiroz RGP, Fernando Lopes L, et al., 2011, Impact of thymidylate synthase promoter and DNA repair gene polymorphisms on susceptibility to childhood acute lymphoblastic leukemia. Leukemia & Lymphoma 52: doi: /

15 35. Deligezer U, Akisik EE, Dalay N, 2007, Lack of association of XRCC1 codon 399Gln polymorphism with chronic myelogenous leukemia. Anticancer Res 27: Meza-Espinoza JP, Peralta-Leal V, Gutierrez-Angulo M, Macias-Gomez N, Ayala-Madrigal ML, et al., 2009, XRCC1 polymorphisms and haplotypes in Mexican patients with acute lymphoblastic leukemia. Genet Mol Res 8: Shi JY, Ren ZH, Jiao B, Xiao R, Yun HY, et al., 2011, Genetic variations of DNA repair genes and their prognostic significance in patients with acute myeloid leukemia. International Journal of Cancer 128: Stanczyk M, Sliwinski T, Cuchra M, Zubowska M, Bielecka-Kowalska A, et al., 2011, The association of polymorphisms in DNA base excision repair genes XRCC1, OGG1 and MUTYH with the risk of childhood acute lymphoblastic leukemia. Mol Biol Rep 38: Zhang H, Liu H, Jiang G, 2013, Genetic Polymorphisms of XRCC1 and Leukemia Risk: A Meta-Analysis of 19 Case-Control Studies. PLoS ONE 8(11):e doi: /journal.pone Yalcin S, Sarper M, Ozgur G, Nevruz O,Cetin AT, Avcu F, 2014, DNA repair gene XRCC1 and XRCC3polymorphisms and their association with chronic myelogenous leukemia J Exp Integr Med; 4 (4): Bănescu C, Tilinca M, Benedek EL, Demian S, Macarie I, Duicu C, Dobreanu M, 2013, XRCC3 Thr241Met polymorphism and risk of acute myeloid leukemia in a Romanian population. Gene. 10; 526(2): Yan Y, Liang H, Li T, Guo S, Li M, Qin X & Li S, 2014, Association of XRCC3 Thr241Met polymorphism and leukemia risk: evidence from a meta-analysis. Leukemia & Lymphoma; 55(9): Qin L, Chen X, Li P, Yang Z& Mo W, 2014, Comprehensive assessment of the association between DNA repair gene XRCC3 Thr241Met polymorphism and leukemia risk. Tumor Biol. (2014) 35: P a g e