Role of DNA Repair Genes in Leukemia Disease
|
|
- Audrey Holland
- 6 years ago
- Views:
Transcription
1 Role of DNA Repair Genes in Leukemia Disease Reda Fekry a, Noha Mohamed Said b* and Waseem Atef b a Chemistry Department, Faculty of science, Zagazig University, Zagazig, Egypt. b Biochemistry Division, Chemistry Department, Faculty of science, Zagazig University, Zagazig, Egypt. Date of revised paper submission: 03/12/2016; Date of acceptance: 14/12/2016 Date of publication: 20/12/2016; *First Author / Corresponding Author; Paper ID: BS Reviewers: Ezeamama, A. E., USA; Baqri, S. R., India. Abstract Background: The various current studies have identified different single nucleotide polymorphisms (SNPs) in population that are associated with variations in the risks of many different cancer diseases. XRCC genes group (DNA repair genes) have role in many different Cancer disease like (Lung cancer, colorectal carcinoma, prostate cancer, gastric cancer.) Objectives: The aim of this study was to assess the association between single nucleotide polymorphisms of two genes of XRCC group as a DNA repair genes and leukemia disease in Egyptian population. We evaluated the role of SNPs in two genes, XRCC1 and XRCC3. We further investigated the potential combined effect of these genes variants on Leukemia disease risk. Methods: The two genes polymorphisms were characterized in 48 Leukemic Egyptian patient and 48 healthy one by (RFLP PCR and tetra ARMS techniques) in a case-control study. Results: for XRCC1 gene: Our results revealed that there is high significant difference in genotypes and alleles distribution of XRCC1 gene between control group and patient groups (P-value = 0.000**) respectively. However, no significant difference in genotypes of XRCC3 gene distribution between control and patients group (p-value = 0.940). Conclusion: our data suggest that the XRCC1 alleles and genotypes may play a role in leukemia susceptibility as a risk factor. Keywords: DNA, Genes, Leukemia. 1. Introduction Leukemia is a group of diseases characterized by increased numbers of white cells in the blood and bone marrow. The total number of white blood cells normally exists from 4 million to 11 million cells per milliliter of blood [1]. 1 P a g e
2 Cells of the body constantly exposed to mutagenic assault from radiation, alcohol, chemical carcinogens, estrogen and diet that produce reactive oxidized bases, bulky DNA adducts, oxygen species and DNA strand breaks. Unrepaired or misrepaired DNA may lead to deletions, amplifications, and/or mutations of critical genes that contribute to breast carcinogenesis [2]. There are multiple pathways to repair the different types of DNA damage and maintain genomic integrity. Among those pathways is nucleotide excision repair (NER) pathway which repairs a wide variety of DNA damage, including cross-links, oxidative damage and bulky adducts and the base excision repair (BER) pathway which repair small lesions like as fragmented or non bulky adducts, oxidized or reduced bases and lesions caused by methylating agents [3]. There are over 100 identified DNA repair genes and most of them are known to have genetic variation in humans [4]. DNA repair genes polymorphism may alter the protein function and cause reduction in DNA repair capacity that may lead to genetic instability and carcinogenesis [5, 6].The X-ray repair cross-complementation group 1 (XRCC1) is one of the most important proteins that has important role in the BER pathway [7]. This DNA repair protein is responsible for the effective repair of DNA damage caused by active oxygen, ionization, and alkylating agents [8] The XRCC1 gene is located on chromosome 19q and has 17 exons [9]. It has more than 300 valid single nucleotide polymorphisms mentioned in the dbsnp database ( in which one of them is more frequent and lead to amino acid replacement: Arg194Trp (exon 6, C to T substitution, and rs [10]. Although the functional effects of these polymorphisms in XRCC1 have not been understood, now it is suggested that the amino acid changes at preserved regions may vary its function [11]. This change in protein biochemistry leads to the hypothesis that variant alleles may reduce kinetics repair of enzyme. Another DNA repair pathway is the homologous recombination repair (HRR) pathway which consists of at least 16 protein components, including XRCC3 [12]. A common polymorphism in XRCC3 is in the exon 7 of the XRCC3 gene results in an amino acid substitution at codon 241(Thr241Met) that may affect the enzyme s function or its interaction with other proteins involved in DNA damage and repair [13]. The XRCC3 variant allele is associated with increased risk of melanom [14] bladder cancer [15], breast cancer [16] and lung cancer [17]. Since XRCC1 and XRCC3 play important role in DNA repair, we studied the functional polymorphisms of them in association with Leukemia risk in an Egyptian population. 2 P a g e
3 2. Subjects and Methods The current study included 98 age matched volunteers divided into two groups (48 control and 48 of different leukemia patients). The samples were taken between January 2012 and September 2012 from oncology clinics of Tanta cancer institute Tanta University. The detailed history of the volunteers was known with the consent of them. For each case, history, full clinical examination, routine laboratory investigations and specific laboratory investigations (detection of XRCC1 gene polymorphism (rs ) and XRCC3 (rs ) were done. (Table 1): Age, sex, type of their disease, and the clinic-pathological features of the patients Group Mean ± SD Age SE Range Sex Percent Type of patient percent Control ± Patient ± male 54.2% ALL 27.1% 22 female 45.8% AML 4.2% 24 male 50% CLL 20.8% 24 female 50% CML 47.9% The patients were evaluated according to the type of their disease, their sex and age. The clinic-pathological features of the patients were summarized in Table 1. The healthy people were chosen with no signs or symptoms of leukemia. They were randomly selected from ALBORG laboratory in Tanta. The study protocol was approved by the ethical committee of Zagazig University, and informed consent for the experimental use of specimens was obtained from all participants. 2.1 Data Collection The clinical archive files of different leukemic patients were available as a source for their data. Also, the participants completed a questionnaire related to their familial and medical histories particularly. Leukemic cases filled in the questionnaire at the time of clinic appointment whereas controls were interviewed at the laboratory at the time of enrollment. 2.2 Blood Collection and Biochemical Assay Three ml of blood sample was taken from every participant under complete aseptic condition and was collected in sterile EDTA containing tubes for DNA extraction. Extracted DNA was stored IN -20 C till use. 2.3 DNA Isolation Genomic DNA was extracted from EDTA whole blood using a spin column method according to the protocol TIAN amp Genomic DNA Kit; TIANGEN BIOTECH (BEIJING) CO.LTD. The quality of the genomic DNA was tested using agarose gel electrophoresis. DNA was stored at -20 C till the time of use. 3 P a g e
4 2.4 Genotyping for XRCC1 (Arg194Trp) (rs ) (C>T) Part of extracted DNA was used for the detection of XRCC1 Arg194Trp polymorphism using tetra-primer amplification refractory mutation system (t-arms-pcr). This method is rapid, simple, and economical for SNP analysis based on the allele-specific primers. So in this method four primers are necessary to amplify a larger fragment from template DNA comprising the SNP and two smaller fragments showing each of two allele-specific products. The genomic sequences of the genes were obtained from the National Center for Biotechnology Information (NCBI) ( For this polymorphism, we used two external primers (Forward outer and Reverse outer) and two allele-specific internal primers that were designed in opposite orientation (Forward inner and Reverse inner) for the detection of every allele. The allele-specific amplicons have the different lengths and can be separated easily by standard gel electrophoresis. PCR reaction was performed in a final volume of 20 micro containing 10 micro (2x PCR Master mix solution i-taq TM) containing (i-taq TM DNA Polymrase (5u/µl) 2.5 U,dNTPs 2.5 mm each, PCR reaction buffer 1x,( gel loading buffer 1x) + 5µ of working primer soln (1 of the outer primers: 10 internal primers)+ 5µ of DNA sample. The tetra primer ARMS-PCR primer sequences, the annealing temperature, and the amplicon sizes [44] are listed in the table below: Table (2): Designed primers for tetraprimer T- ARMS-PCR reactions, annealing temperature, and fragments sizes. SNP Primer sequence Annealing temperature ( o C) Fragments length FO: 5'-CGTCCCAGGTAAGCTGTAC-3' RO: XRCC1 Arg194Trp 5'-CACTCCTATCTATGGGACACAG-3' FI: 63 o C for 30 sec Outer: 471 Arg: 297 5'-CGGGGGCTCTCTTCTTCATCC-3 Trp: 219 RI: 5'- CACCTGGGGATGTCTTGTTGATACA- 3' 4 P a g e
5 The cycling conditions for PCR program were 6 min at 95 o C for 5 for activation followed by 35 cycles of 95 o C for 30 s for denaturation, 63 o C for 30 s for annealing, 72 o C for 30s for elongation and a final cycle 72 o C for 10min for final elongation. PCR products were separated by standard electrophoresis on 2% agarose gel containing ethidium bromide. 2.5 Genotyping for XRCC3 (Thr241Met) (C>T) (rs861539) Another part of extracted DNA was used for the detection of XRCC3 Thr241Met polymorphism using restriction fragment length polymorphism (RFLP-PCR). This method is the most common for SNP analysis based on using restriction enzyme for cutting one of the two alleles of the polymorphism. In this method two primers are necessary to amplify a specific fragment of template DNA containing polymorphism position) followed by another step of digestion to PCR product using the suitable restriction enzyme. PCR reaction was performed in a final volume of 20 micro containing 10 micro (2x PCR Master mix solution i-taq TM) containing (i-taq TM DNA Polymrase (5u/µl) 2.5 U,dNTPs 2.5 mm each, PCR reaction buffer 1x,( gel loading buffer 1x) + 5µ of working primer soln.+ 5µ of DNA sample. Table (3): Designed primers for RFLP-PCR reactions, annealing temperature, and fragments sizes. SNP Primer sequence Annealing temperature ( o C) Fragments length XRCC3 Thr241Met Forward: GCCTGGTGGTCATCGACTC Reverse: GCTTCCGCATCCTGGCTAAA Pcr product :211 bp 60 o C for 30 sec Thr: 211 Met: The cycling conditions for PCR program were 5 min at 95 o C for 5 for activation followed by 35 cycles of 94 o C for 30 s for denaturation, 60 o C for 30 s for annealing, 72 o C for 30s for elongation and a final cycle 72 o C for 10min for final elongation. PCR products of 136 bp were digested overnight with the restriction enzyme NcoI (R0193S, NEW ENGLAND BioLabs). The choosing of the restriction enzyme was done by using one of the web programs for restriction enzyme choosing for taking an example ( that help to choose the better restriction enzyme by inputting the sequence around the variant to the program for choosing the suitable restriction enzyme. 5 P a g e
6 Restriction products were subjected to electrophoresis in 2 % agarose gel with ethidium bromide (1 mg/ml) for visualization under ultraviolet light and three genotypes were detected: wild homozygous (211 bp), mutant homozygous ( bp) and heterozygous( bp) (Fig.1). 2.6 Statistical Analysis All data were analyzed using Statistical analyses were performed using Statistical Package for Social Sciences (SPSS version 23). Continuous variables were expressed as the mean ± SD & median (range), and the categorical variables were expressed as a number (percentage). Categorical variables are expressed as frequencies and percentages. The independent t test and one way ANOVA were used to compare quantitative data. Correlation& regression analysis were used to study the relation between numerical variables, Chi-square was used to examine the relationship between categorical variables. Odds ratio test was studied under 5 models (allelic- homozygoteheterozygote-dominant-recessive) with confidence interval 95%, also HardyWeinberg equilibrium test used for categorical variables. P-value <0.05 was considered significant difference and P-value <0.001was considered highly significant difference. Statistical analyses were performed using Statistical Package for Social Sciences (SPSS version 23). 3. Result 3.1 XRCC1 (Arg194Trp) Polymorphism and Leukemia Disease Risk The genotype frequencies of homozygous (AA), heterozygous (AT), and homozygous mutated (TT) were 4.2, 58.3, and 37.5% in patients with Leukemia respectively; and 64.6, 18.8, and 16.7% in controls, respectively. In general, there was a suitable difference in genotypes frequencies of the XRCC1 polymorphism between control and leukemic patient (P = 0.000**) Table 4. The frequency of A allele in (Table 5) was % in leukemic patients and % in controls. Regarding the risk of development of LEUKEMIA the AA wild type genotype and A wild type allele were taken as references. These data suggested that the A allele was high significantly associated with a decreased risk of LEUKEMIA in all the genetic models (p< 0.05) except the heterozygote model (OR: % CI: ( ) (P = 0.570) which was associated with increased risk for leukemia (Table 6). 6 P a g e
7 (Table 4): Distribution of XRCC1 genotype frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Genotype frequencies XRCC1 CC CT TT Pearson Chi square p-value N % N % N % Control group ** Diseased group (Table 5): Distribution of XRCC1 allele frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Allele frequencies XRCC1 A T Pearson Chi square p-value N % N % Control group ** Diseased group (Table 6): Association between XRCC1 (Arg194Trp) polymorphism and Leukemia disease risk XRCC1 Test of association Comparison Odds Ratio C.I (95%) Pearson Chi square p-value Homozygote comparisons (AA vs. TT) ** 7 P a g e
8 Heterozygote comparison (AT vs. TT) Dominant model (AA/AT vs. TT) Recessive model (AA vs. TT/AT) Allele contrast (A vs. T) * ** ** 3.2 XRCC3 (Thr241Met) polymorphism and Leukemia disease risk (Table 7) The genotype frequencies of homozygous (CC), heterozygous (CT), and homozygous mutated (TT) were 87.5, 8.3, and 4.2 % in patients with LEUKEMIA, respectively; and 85.4, 10.4, and 4.2 % in controls, respectively. Generally, there was not a significant difference in the genotypes frequencies of the XRCC3 (Thr241Met) polymorphism between control and LEUKEMIA (P = 0.940). (Table 7): Distribution of XRCC3 genotype frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Genotype frequencies XRCC3 CC CT TT Pearson Chi square p-value N % N % N % Control group Diseased group The frequency of C allele was % in leukemic patients and % in controls in (Table 8). Regarding the risk of development of LEUKEMIA the CC wild type genotype and C wild type allele were taken as references. These data suggested that the neither TT geneotype nor T allele were associated with an increased risk of LEUKEMIA under any genetic model (p 0.05) 8 P a g e
9 (Table 8): Distribution of XRCC3 allele frequencies in Leukemia disease patients (n = 48) and the control subjects (n = 48) Allele frequencies XRCC3 C T Pearson Chi square p-value N % N % Control group Diseased group (Table 9): Association between XRCC3 (Thr241Met) polymorphism and Leukemia disease risk XRCC3 Test of association Comparison Odds Ratio C.I (95%) Pearson Chi square p-value Homozygote comparisons (CC vs. TT) Heterozygote comparison (CT vs. TT) Dominant model (CC/CT vs. TT) Recessive model (CC vs. CT/TT) Allele contrast (C vs. T) P a g e
10 (Fig. 1 Representative Agarose gel electrophoresis results for XRCC3 (C18067T) Polymorphism in Leukemic patients by the RFLP PCR method. Lane M marker (100 bp), lanes 1 6,8,9,11,12,16,25,27,28,30,31,34 38 are (CC) genotype, and lane 10,32,33 are (CT) genotype.) 4. Discussion and Conclusion Leukemia starts in the tissue forming blood. Most blood cells develop from cells in the bone marrow called stem cells. The bone marrow is a soft material in the center of the bones. The stem cells mature into the different kinds of the blood cells. As the blood cells grow old or get damaged, they die, and then new cells take their place. But in the case of the person with leukemia, bone marrow makes the abnormal white blood cells. These abnormal cells are the leukemia cells. Unlike the normal blood cells, leukemia cells do not die as compared to normal cells. So they may crowd out generally red blood cells, white blood cells and platelets. This makes it hard for normal blood cells for doing their work. The types of leukemia also can be based on the group type of the white blood cell which is affected. The leukemia can start in lymphoid cells or myeloid cells. Leukemia that affects lymphoid cells is called lymphoid, lymphocytic, or lymphoblastic leukemia. The leukemia that affects the myeloid cells is known as myeloid, myelogenous, or myeloblastic leukemia. There are four common types of leukemia: we divided leukemic patient according to these four common types. 10 P a g e
11 4.1 Chronic lymphocytic leukemia (CLL): CLL affects the lymphoid cells and grows slowly in general. Most often, people diagnosed with this disease are the age of 55 and above. It generally never affects children. 4.2 Chronic myeloid leukemia (CML): the CML affects myeloid cells and usually grows slowly at first. It mainly affects adult person. 4.3 Acute lymphocytic (lymphoblastic) leukemia (ALL): The ALL affects lymphoid cells and grows fast. ALL is the most common type of the leukemia in the young children. It also affects the adults. 4.4 Acute myeloid leukemia (AML): AML affects myeloid cells and grows quickly. It occurs in both adults and children. Different DNA repair systems maintain the integrity of the human genome, so deficiency in the repair capacity due to mutations or polymorphisms in genes involved in DNA repair can lead to genomic instability that, in turn, is related to chromosomal instability syndromes and increased risk of developing various types of cancer [18]. DNA repair systems have a critical role in maintaining the genome integrity and stability. DNA repair gene polymorphisms may influence the capacity to repair DNA damage, and thus lead to increased cancer susceptibility. Recently, genetic polymorphism of the DNA repair genes in the etiology of several cancers has drawn increasing attention. Because of genetic variation, the decreased capacity of the DNA repair gene is associated with increased risk and susceptibility to human tumors [19]. The X-rays repair the cross-complementing groups 1, 3 (XRCC1) and (XRCC3), a DNA repair genes, may be involved in leukemia susceptibility. The objective of the current study was to investigate the association of (Arg194Trp) polymorphism of XRCC1 gene and (Thr241Met) polymorphism of XRCC3 gene with the risk of leukemia in Egyptian population. Our results revealed that there is a higher significant difference in genotypes and alleles frequencies of XRCC1 (Arg194Trp) gene between Leukemic patients and control groups. However, There is no significant difference in the genotype and allele frequencies of the XRCC3 (Thr241Met) polymorphism between control and Leukemic patient. Several studies discussed the relation between these two polymorphisms and different types of leukemia. However, this is the first study to discuss this relation in Egyptian population. The relationship between these XRCC1 polymorphisms and the leukemia risk has been observed in various case control studies and the results of these studies were inconclusive and 11 P a g e
12 12 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp contradictory. So that the association between XRCC1 polymorphisms and risk of some types of leukemia was observed by the number of studies [20-32], other reports did not take the XRCC1 genetic variants as the risk or protective factors for the leukemia [33-38], Zhang and his team (2013) [39] reported in their meta analysis that XRCC1 (Arg194Trp) may influence some susceptibilities of leukemia type and the race populations. Most of the studies have been performed to investigate the association between XRCC3 Thr241Met polymorphism and cancers risk. A study for the analysis about the polymorphism in the Turkish population revealed that there is no statistical association between CML and XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms in patients of Turkish. This result agrees with our result [40]. However, another study in Romanian population revealed that the XRCC3 Thr241Met polymorphism may be a genetic risk factor for AML [41]. Yan and his team (2014) [42] suggests no association between XRCC3 Thr241Met (rs861539) polymorphism and the leukemia risk in the overall populations in their Meta analysis but a suitable association between XRCC3 Thr241Met (rs861539) polymorphism and leukemia risk in some Asian population. This result is the same as our result which suggests no association between leukemic patients and this polymorphism. Qin and his group (2014) [43] showed in their Meta analysis that The XRCC3 Thr241Met polymorphism might be associated with risk of leukemia in AML. This result disagrees with our results. Our study is the first study to give results about these polymorphisms in Egyptian population. Further studies with large sample are recommended for precise conclusion. References 1. Hoffbrand AV, Moss PAH, Pettit JE (ed)., 2006, "Essential Haematology" 5th Edition. Blackwell Publishing, Oxford: Pg Hu JJ, Smith TR, Miller MS, Lohman K, Case LD, 2002, Genetic regulation of ionizing radiation sensitivity and breast cancer risk. Environ Mol Mutagen 39: Parshad R, Price FM, Bohr VA, Cowans KH, Zujewski JA, Sanford KK, 1996, Deficient DNA repair capacity, a predisposing factor in breast cancer. Br J Cancer 74(1): Debniak T, Scott RJ, Huzarski T, Byrski T, Masojc B, van de Wetering T, Serrano-Fernandez P, Gorski B, Cybulski C, Gronwald J, Debniak B, Maleszka R, Kladny J, Bieniek A, Nagay L, Haus O, Grzybowska E, Wandzel P, Niepsuj S, Narod SA, Lubinski J, 2006, XPD common variants and their association with melanoma and breast cancer risk. Breast Cancer Res Treat 98: De Boer JG, 2002, Polymorphisms in DNA repair and environmental interactions. Mutat Res 509:
13 13 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp Berwick M, Vineis P, 2000, Markers of DNA repair and susceptibility to cancer in humans: an epidemiologic review. J Natl Cancer Inst 92: R. J. Hung, J. Hall, P. Brennan, and P. Boffetta, 2005, Genetic polymorphisms in the base excision repair pathway and cancer risk: a huge review, American Journal of Epidemiology, vol. 162, no. 10, pp K. W. Caldecott, 2003, XRCC1 and DNA strand break repair, DNA Repair, vol. 2, no. 9, pp L. H. Thompson and M. G. West, XRCC1 keeps DNA from getting stranded, Mutation Research, vol. 459, no. 1, pp. 1 18, M. R. Shen, I. M. Jones, and H. Mohrenweiser, 1998, Nonconservative amino acid substitution variants exist at polymorphic frequency in DNA repair genes in healthy humans, Cancer Research, vol. 58, no. 4, pp S. Trabulus, G. S. Guven, M. R. Altiparmak et al., 2012, DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease, Molecular Biology Reports, vol. 39, no. 6, pp Dianov GL, Sleeth KM, Dianova II and Allinson SL, 2003, Repair of abasic sites in DNA. Mut Res 531: Kuschel B, Auranen A, McBride S, Novik KL, Antoniou A et al., 2002, Variants in doublestrand break repair genes and breast cancer susceptibility. Hum Mol Genet 11: Winsey SL, Haldar NA, Marsh HP, Bunce M, Marshall SE, Harris AL, Wojnarowska F and Welsh KI, 2000, A variant within the DNA repair gene XRCC3 is associated with the development of melanoma skin cancer. Cancer Res 60: Matullo G, Guarrera S, Carturan S, Peluso M, Malaveille C, Davico L, Piazza A and Vineis P, 2001, DNA repair gene polymorphisms, bulky DNA adducts in white blood cells and bladder cancer in a case-control study. Int J Cancer 92: Smith TR, Millera MS, Lohmanc K, Langec EM, Casec LD, Mohrenweiser HW and Hu JJ, 2003, Polymorphisms of XRCC1 and XRCC3 genes and susceptibility to breast cancer. Cancer Lett 190: Jacobsen NR, Raaschou-Nielsen O, Nex_ B, Wallin H, Overvad K, Tj_nneland A and Vogel U, 2004, XRCC3 polymorphisms and risk of lung cancer. Cancer Lett 213: Trabulus, S., G. S. Guven, M. R. Altiparmak et al., 2012, DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end-stage renal disease, Molecular Biology Reports, vol. 39, no. 6, pp Garcia-Closas M, Malats N, Real FX, et al., 2006, Genetic variation in the nucleotide excision repair pathway and bladder cancer risk. Cancer Epidemiol Biomarkers Prev., 15: Annamaneni S, Gorre M, Kagita S, Addepalli K, Digumarti RR, et al., 2012, Association of XRCC1 gene polymorphisms with chronic myeloid leukemia in the population of Andhra Pradesh, India. Hematology. 21. Batar B, Güven M, Bariş S, Celkan T, Yildiz I, 2009, DNA repair gene XPD and XRCC1 polymorphisms and the risk of childhood acute lymphoblastic leukemia. Leuk Res 33:
14 14 P a g e International Journal of Pure and Applied Biomedical Sciences; Vol ; pp Duman N, Aktan M, Ozturk S, Palanduz S, Cakiris A, et al., 2012, Investigation of Arg399Gln and Arg194Trp Polymorphisms of the XRCC1 (X-Ray Cross-Complementing Group 1) Gene and Its Correlation to Sister Chromatid Exchange Frequency in Patients with Chronic Lymphocytic Leukemia. Genetic Testing and Molecular Biomarkers 16: El-Din M, Raslan H, Abdel-Hamid S, Makhlouf M, 2012, Detection of XRCC1 gene polymorphisms in Egyptian patients with acute myeloid leukemia. Comparative Clinical Pathology 21: Ganster C, Neesen J, Zehetmayer S, Jäger U, Esterbauer H, et al., 2009, DNA repair polymorphisms associated with cytogenetic subgroups in B-cell chronic lymphocytic leukemia. Genes Chromosomes Cancer 48: doi: /gcc Joseph T, Kusumakumary P, Chacko P, Abraham A, Pillai MR, 2005, DNA repair gene XRCC1 polymorphisms in childhood acute lymphoblastic leukemia. Cancer Lett 217: Kim HN, Kim NY, Yu L, Huong Thi Thanh T, Kim YK, et al., 2012, Association of GSTT1 polymorphism with acute myeloid leukemia risk is dependent on smoking status. Leukemia & Lymphoma 53: Matullo G, Dunning AM, Guarrera S, Baynes C, Polidoro S, et al., 2006, DNA repair polymorphisms and cancer risk in non-smokers in a cohort study. Carcinogenesis 27: Özcan A, Pehlivan M, Tomatir AG, Karaca E, Özkinay C, et al., 2011, Polymorphisms of the DNA repair gene XPD (751) and XRCC1 (399) correlates with risk of hematological malignancies in Turkish population. African Journal of Biotechnology 10: Pakakasama S, Sirirat T, Kanchanachumpol S, Udomsubpayakul U, Mahasirimongkol S, et al., 2007, Genetic polymorphisms and haplotypes of DNA repair genes in childhood acute lymphoblastic leukemia. Pediatr Blood Cancer 48: Seedhouse C, Bainton R, Lewis M, Harding A, Russell N, et al., 2002, The genotype distribution of the XRCC1 gene indicates a role for base excision repair in the development of therapy-related acute myeloblastic leukemia. Blood 100: Tumer TB, Yilmaz D, Tanrikut C, Sahin G, Ulusoy G, et al., 2010, DNA repair XRCC1 Arg399Gln polymorphism alone, and in combination with CYP2E1 polymorphisms significantly contribute to the risk of development of childhood acute lymphoblastic leukemia. Leuk Res 34: Sorour A, Ayad MW, Kassem H, 2013, The genotype distribution of the XRCC1, XRCC3, and XPD DNA repair genes and their role for the development of acute myeloblastic leukemia. Genet Test Mol Biomarkers 17: Abramenko I, Bilous N, Chumak A, Kostin A, Martina Z, et al., 2012, DNA repair polymorphisms in B-cell chronic lymphocytic leukemia in sufferers of Chernobyl Nuclear Power Plant accident. J Radiat Res 53: Canalle R, Silveira VS, Alberto Scrideli C, Queiroz RGP, Fernando Lopes L, et al., 2011, Impact of thymidylate synthase promoter and DNA repair gene polymorphisms on susceptibility to childhood acute lymphoblastic leukemia. Leukemia & Lymphoma 52: doi: /
15 35. Deligezer U, Akisik EE, Dalay N, 2007, Lack of association of XRCC1 codon 399Gln polymorphism with chronic myelogenous leukemia. Anticancer Res 27: Meza-Espinoza JP, Peralta-Leal V, Gutierrez-Angulo M, Macias-Gomez N, Ayala-Madrigal ML, et al., 2009, XRCC1 polymorphisms and haplotypes in Mexican patients with acute lymphoblastic leukemia. Genet Mol Res 8: Shi JY, Ren ZH, Jiao B, Xiao R, Yun HY, et al., 2011, Genetic variations of DNA repair genes and their prognostic significance in patients with acute myeloid leukemia. International Journal of Cancer 128: Stanczyk M, Sliwinski T, Cuchra M, Zubowska M, Bielecka-Kowalska A, et al., 2011, The association of polymorphisms in DNA base excision repair genes XRCC1, OGG1 and MUTYH with the risk of childhood acute lymphoblastic leukemia. Mol Biol Rep 38: Zhang H, Liu H, Jiang G, 2013, Genetic Polymorphisms of XRCC1 and Leukemia Risk: A Meta-Analysis of 19 Case-Control Studies. PLoS ONE 8(11):e doi: /journal.pone Yalcin S, Sarper M, Ozgur G, Nevruz O,Cetin AT, Avcu F, 2014, DNA repair gene XRCC1 and XRCC3polymorphisms and their association with chronic myelogenous leukemia J Exp Integr Med; 4 (4): Bănescu C, Tilinca M, Benedek EL, Demian S, Macarie I, Duicu C, Dobreanu M, 2013, XRCC3 Thr241Met polymorphism and risk of acute myeloid leukemia in a Romanian population. Gene. 10; 526(2): Yan Y, Liang H, Li T, Guo S, Li M, Qin X & Li S, 2014, Association of XRCC3 Thr241Met polymorphism and leukemia risk: evidence from a meta-analysis. Leukemia & Lymphoma; 55(9): Qin L, Chen X, Li P, Yang Z& Mo W, 2014, Comprehensive assessment of the association between DNA repair gene XRCC3 Thr241Met polymorphism and leukemia risk. Tumor Biol. (2014) 35: P a g e
Original Article Association of the XRCC1 Arg280His polymorphism with leukemia risk: a meta-analysis
Int J Clin Exp Med 2016;9(11):21288-21295 www.ijcem.com /ISSN:1940-5901/IJCEM0031565 Original Article Association of the XRCC1 Arg280His polymorphism with leukemia risk: a meta-analysis Zhaodong Li 1,
More informationAssociation between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
More informationAssociation between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
More informationXRCC3 T241M polymorphism and melanoma skin cancer risk: A meta-analysis
ONCOLOGY LETTERS 9: 2425-2429, 2015 XRCC3 T241M polymorphism and melanoma skin cancer risk: A meta-analysis JINGHUA FAN 1, YUHUA FAN 2, XIAOXIAO KANG 1 and LIMIN ZHAO 1 1 Department of Dermatology, Xi'an
More informationOriginal Article Association between XRCC1 and ERCC2 gene. polymorphisms and development of osteosarcoma.
Int J Clin Exp Pathol 2016;9(1):223-229 www.ijcep.com /ISSN:1936-2625/IJCEP0017837 Original Article Association between XRCC1 and ERCC2 gene polymorphisms and development of osteosarcoma Zimin Wang 1,
More informationXRCC1 polymorphisms and haplotypes in Mexican patients with acute lymphoblastic leukemia
XRCC1 polymorphisms and haplotypes in Mexican patients with acute lymphoblastic leukemia J.P. Meza-Espinoza 1, V. Peralta-Leal 1, M. Gutierrez-Angulo 2, N. Macias-Gomez 3, M.L. Ayala-Madrigal 4, P. Barros-Nuñez
More informationPolymorphisms of DNA repair-related genes with susceptibility and prognosis of prostate cancer
Polymorphisms of DNA repair-related genes with susceptibility and prognosis of prostate cancer X.J. Zhang, P. Liu and F. Zhu Urology Department, The First Affiliated Hospital of Xinxiang Medical University,
More informationH.F. Liu, J.S. Liu, J.H. Deng and R.R. Wu. Corresponding author: J.S. Liu
Role of XRCC1 gene polymorphisms in non-small cell lung cancer cisplatin-based chemotherapy, and their effect on clinical and pathological characteristics H.F. Liu, J.S. Liu, J.H. Deng and R.R. Wu Department
More informationInvestigation of the role of XRCC1 genetic polymorphisms in the development of gliomas in a Chinese population
Investigation of the role of XRCC1 genetic polymorphisms in the development of gliomas in a Chinese population S.C. Fan 1, J.G. Zhou 2 and J.Z. Yin 1 1 Department of Neurosurgery, The People s Hospital
More informationLack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang
More informationInvestigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population
Investigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population L.Q. Yang 1, Y. Zhang 2 and H.F. Sun 3 1 Department of Gastroenterology, The Second Affiliated
More informationInvestigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer
Investigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong
More informationMLH1 and XRCC1 polymorphisms in Mexican patients with colorectal cancer
MLH1 and XRCC1 polymorphisms in Mexican patients with colorectal cancer R. Muñiz-Mendoza 1, M.L. Ayala-Madrigal 1, M. Partida-Pérez 1, J. Peregrina-Sandoval 2, E. Leal-Ugarte 3, N. Macías-Gómez 4, V. Peralta-Leal
More informationGenetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,
More informationAssociation between ERCC1 and XPF polymorphisms and risk of colorectal cancer
Association between ERCC1 and XPF polymorphisms and risk of colorectal cancer H. Yang, G. Li and W.F. Li Departments of Radiation Oncology and Chemotherapy, The First Affiliated Hospital of Wenzhou Medical
More informationXRCC3 Thr241Met Gene Polymorphism and Risk of Colorectal Cancer in Kashmir: a Case Control Study
RESEARCH ARTICLE XRCC3 Thr241Met Gene Polymorphism and Risk of Colorectal Cancer in Kashmir: a Case Control Study Saniya Nissar 1,4, Aga Syed Sameer 3, Tufail A Lone 2, Nissar A Chowdri 2, Roohi Rasool
More informationInfluence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population
Influence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population Z.M. Zhao*, C.G. Li*, M.G. Hu, Y.X. Gao and R. Liu Department of Surgical Oncology,
More informationAssociation of polymorphisms of the xeroderma pigmentosum complementation group F gene with increased glioma risk
Association of polymorphisms of the xeroderma pigmentosum complementation group F gene with increased glioma risk W.K. Zhou 1, L.Y. Huang 1, L. Hui 1, Z.W. Wang 1, B.Z. Jin 1, X.L. Zhao 1, X.Z. Zhang 1,
More informationXRCC1 Polymorphisms and Pancreatic Cancer: A Meta-Analysis
www.springerlink.com Chin J Cancer Res 23(3):165-170, 2011 165 Review Article XRCC1 Polymorphisms and Pancreatic Cancer: A Meta-Analysis Wei-dong Shen 1, Hong-lin Chen 2*, Peng-fei Liu 1 1 Department of
More informationAssociation between the -77T>C polymorphism in the DNA repair gene XRCC1 and lung cancer risk
Association between the -77T>C polymorphism in the DNA repair gene XRCC1 and lung cancer risk B.B. Sun, J.Z. Wu, Y.G. Li and L.J. Ma Department of Respiratory Medicine, People s Hospital Affiliated to
More informationAssociation between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population
Association between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population W.M. Zhao 1, P. Shayimu 1, L. Liu 1, F. Fang 1 and X.L. Huang 2 1 Department of Gastrointestinal
More informationVariants in DNA Repair Genes and Glioblastoma. Roberta McKean-Cowdin, PhD
Variants in DNA Repair Genes and Glioblastoma Advances in Bioinformatics and Genomics Symposium February 19, 2010 Roberta McKean-Cowdin, PhD Department of Preventive Medicine, University of Southern California
More informationDNA repair gene XRCC1 polymorphisms and susceptibility to childhood acute lymphoblastic leukemia: a meta-analysis
Original Article DNA repair gene XRCC1 polymorphisms and susceptibility to childhood acute lymphoblastic leukemia: a meta-analysis Juan Du*, Cong Lu*, Guohui Cui, Yan Chen, Jing He Department of Hematology,
More informationGenetic Polymorphism of DNA Repair Gene (OGG1) In Iraqi Acute Myeloid Leukemia Patients
Genetic Polymorphism of DNA Repair Gene (OGG1) In Iraqi Acute Myeloid Leukemia Patients Rasha A.Tuama College of Science For Women, Baghdad University. Nagham E. Al-Essa College of Science For Women, Baghdad
More informationDNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population: a meta-analysis
DNA repair gene XRCC3 T241M polymorphism and susceptibility to hepatocellular carcinoma in a Chinese population: a meta-analysis R.B. Ji, Y.S. Qian, A.R. Hu and Y.R. Hu Liver Disease Research Center, Ningbo
More informationInfluence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis
Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis G.-C. Shi and L.-G. Zhang Department of Tuberculosis, The First Affiliated Hospital of Xinxiang Medical University,
More informationClaire Seedhouse, Rowena Bainton, Michael Lewis, Alexander Harding, Nigel Russell, and Emma Das-Gupta
NEOPLASIA The genotype distribution of the XRCC1 gene indicates a role for base excision repair in the development of therapy-related acute myeloblastic leukemia Claire Seedhouse, Rowena Bainton, Michael
More informationAssociation of XRCC1 gene polymorphisms and pancreatic cancer risk in a Chinese population
Association of XRCC1 gene polymorphisms and pancreatic cancer risk in a Chinese population L.J. Wang 1, H.T. Wang 1 and X.X. Wang 2 1 Department of Hepatobiliary Surgery, Yantai Affiliated Hospital of
More informationAssociation between rs G<C gene polymorphism and susceptibility to pancreatic cancer in a Chinese population
Association between rs9904341 G
More informationPolymorphisms of XPC Gene And Susceptibility of Esophageal Cancer
www.springerlink.co Chin J Cancer Res 22(1):49-54, 2010 49 Original Article Polymorphisms of XPC Gene And Susceptibility of Esophageal Cancer Xiang-xian Feng 1, 2, Pei-fen Duan 2, Li-bing Wang 2, Zu-xun
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationPolymorphisms in DNA Repair Gene XRCC1 and Skin Cancer Risk: A Meta-analysis
Polymorphisms in DNA Repair Gene XRCC1 and Skin Cancer Risk: A Meta-analysis HAIJUN ZHANG 1, WENJUAN LI 2, MICHAEL J. FRANKLIN 3 and ARKADIUSZ Z. DUDEK 3 1 Department of Cell and Developmental Biology,
More informationInvestigation on the role of XPG gene polymorphisms in breast cancer risk in a Chinese population
Investigation on the role of XPG gene polymorphisms in breast cancer risk in a Chinese population S.H. Ma 1,2, F.H. Ling 2, Y.X. Sun 3, S.F. Chen 2 and Z. Li 1 1 Department of General Surgery, Zhujiang
More informationAssociation between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk
Association between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk X.F. Zhang 1, T. Liu 2, Y. Li 1 and S. Li 2 1 Department of Breast, Liao Ning Cancer Hospital and Institute, Shenyang,
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationCYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women
CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women L. Yang, X.Y. Wang, Y.T. Li, H.L. Wang, T. Wu, B. Wang, Q. Zhao, D. Jinsihan and L.P. Zhu The Department of Mammary
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationProspective study of MTHFR genetic polymorphisms as a possible etiology of male infertility
Prospective study of MTHFR genetic polymorphisms as a possible etiology of male infertility S.-S. Li 1, J. Li 1, Z. Xiao 2, A.-G. Ren 3 and L. Jin 3 1 Beijing Obstetrics and Gynecology Hospital, Capital
More informationAssociation of DNA Double strand Break Gene XRCC6 Genotypes and Lung Cancer in Taiwan
Association of DNA Double strand Break Gene XRCC6 Genotypes and Lung Cancer in Taiwan TE-CHUN HSIA 1,2,4, CHIN-JUNG LIU 1,3, CHIA-CHEN CHU 1,3, LIANG-WEN HANG 1,3, WEN-SHIN CHANG 1,5, CHIA-WEN TSAI 1,5,
More informationPolymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women
www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha
More informationAssociation between matrix metalloproteinase-9 rs polymorphism and development of coronary artery disease in a Chinese population
Association between matrix metalloproteinase-9 rs3918242 polymorphism and development of coronary artery disease in a Chinese population L.M. Qin 1, G.M. Qin 2, X.H. Shi 1, A.L. Wang 1 and H. Zuo 1 1 The
More informationMassoud Houshmand National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
QUID 2017, pp. 669-673, Special Issue N 1- ISSN: 1692-343X, Medellín-Colombia NON-GENE REGION AND INFLUENCES TUMOR CHARACTERISTICS BY LOW-RISK ALLELES IN BREAST CANCER (Recibido el 21-06-2017. Aprobado
More informationTitle: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study
Author's response to reviews Title: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study Authors: Bernd Frank (b.frank@dkfz.de) Heiko Müller (h.mueller@dkfz.de) Melanie
More informationNIH Public Access Author Manuscript Am J Gastroenterol. Author manuscript; available in PMC 2008 March 17.
NIH Public Access Author Manuscript Published in final edited form as: Am J Gastroenterol. 2008 February ; 103(2): 360 367. XRCC2 and XRCC3 Gene Polymorphism and Risk of Pancreatic Cancer Li Jiao, Ph.D.
More informationmir-146a and mir-196a2 polymorphisms in ovarian cancer risk
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk X.C. Sun, A.C. Zhang, L.L. Tong, K. Wang, X. Wang, Z.Q. Sun and H.Y. Zhang Department of Obstetrics and Gynecology, China-Japan Union Hospital
More informationApplication of chromosomal radiosensitivity assays to temporary nuclear power plant workers
Application of chromosomal radiosensitivity assays to temporary nuclear power plant workers Research group University Ghent in collaboration with Dr. M. Barbé and the Occupational Medicine Service Nuclear
More informationBlood Cancer: Chronic Myelogenous Leukaemia
Published on: 30 May 2017 Blood Cancer: Chronic Myelogenous Leukaemia What Is Cancer? The body is made up of cells that grow and die in a controlled way. Sometimes, cells keep dividing and growing without
More informationHaplotype Analyses of DNA Repair Gene Polymorphisms and Their Role in Ulcerative Colitis
Haplotype Analyses of DNA Repair Gene Polymorphisms and Their Role in Ulcerative Colitis Avinash Bardia 1, Santosh K. Tiwari 1, Sandeep K. Vishwakarma 1, Md. Aejaz Habeeb 1, Pratibha Nallari 2, Shaik A.
More informationXRCC1 Polymorphisms and Cancer Risk: A Meta-analysis of 38 Case-Control Studies
1810 Cancer Epidemiology, Biomarkers & Prevention XRCC1 Polymorphisms and Cancer Risk: A Meta-analysis of 38 Case-Control Studies Zhibin Hu, 1 Hongxia Ma, 1 Feng Chen, 1 Qingyi Wei, 2 and Hongbing Shen
More informationLack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis
Lack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis Y. Liu, X.L. Song, G.L. Zhang, A.M. Peng, P.F. Fu, P. Li, M. Tan, X. Li, M. Li and C.H. Wang Department of Respiratory
More informationPolymorphism of XRCC1 Gene Exon 6 (Arg194Trp) in Relation to Micronucleus Frequencies in Hospital Radiation Workers
Atom Indonesia Vol. 44 No. 2 (218) 15-111 N. Adventini et al. / Atom Indonesia Vol. 43 No. xxx (217) xxx - xxx Atom Indonesia Journal homepage: http://aij.batan.go.id Polymorphism of XRCC1 Gene Exon 6
More informationEffect of ERCC1 polymorphism on the response to chemotherapy and clinical outcome of non-small cell lung cancer
Effect of ERCC1 polymorphism on the response to chemotherapy and clinical outcome of non-small cell lung cancer H. Gao 1, R.C. Ge 2, H.Y. Liu 3, Y. Wang 4 and S. Yan 4 1 Department of General Internal
More informationIL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationAsingle inherited mutant gene may be enough to
396 Cancer Inheritance STEVEN A. FRANK Asingle inherited mutant gene may be enough to cause a very high cancer risk. Single-mutation cases have provided much insight into the genetic basis of carcinogenesis,
More informationFrequency of XRCC1 Exon 9 G>A gene polymorphism in Saudi Arabian population: A comparative study with worldwide
JBUON 2018; 23(4): 1195-1199 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Frequency of XRCC1 Exon 9 G>A gene polymorphism in Saudi Arabian population:
More informationAssociation between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis
Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis B.W. Yu 1 *, L.Q. Zhang 1 *, X.L. Teng 1, Y. Zhang 1, L.B. Zou 2 and H.Y. Ying 3 l Department of Clinical Laboratory,
More informationInvestigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma
Investigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma Q. Zhang 1, L.Y. Lv 1, B.J. Li 1, J. Zhang 1 and F. Wei 2 1 Department of Orthopaedics,
More informationVariations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
More informationDNA repair gene XRCC1 Arg194Trp polymorphism and susceptibility to hepatocellular carcinoma: A meta analysis
ONCOLOGY LETTERS 8: 1725-1730, 2014 DNA repair gene XRCC1 Arg194Trp polymorphism and susceptibility to hepatocellular carcinoma: A meta analysis WENYAN LI 1, FENG YANG 2, YONGXIAN GUI 1 and JUNJIE BIAN
More informationTITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
More informationAllelic and Haplotype Frequencies of the p53 Polymorphisms in Brain Tumor Patients
Physiol. Res. 51: 59-64, 2002 Allelic and Haplotype Frequencies of the p53 Polymorphisms in Brain Tumor Patients E. BIROŠ, I. KALINA, A. KOHÚT 1, E. BOGYIOVÁ 2, J. ŠALAGOVIČ, I. ŠULLA 3 Department of Medical
More informationTHE ROLE OF XRCC1 POLYMORPHISMS IN BASE EXCISION REPAIR OF ETHENO-DNA ADDUCTS IN FRENCH VINYL CHLORIDE WORKERS
Nofer Institute of Occupational Medicine, Łódź, Poland OCCUPATIONAL PAPERS International Journal of Occupational Medicine and Environmental Health 2006;19(1):45 52 DOI 10.2478/v10001-006-0006-9 THE ROLE
More informationSignificant Association of Ku80 Single Nucleotide Polymorphisms with Bladder Cancer Susceptibility in Taiwan
Significant Association of Ku80 Single Nucleotide Polymorphisms with Bladder Cancer Susceptibility in Taiwan CHAO-HSIANG CHANG 1,2*, CHANG-FANG CHIU 2,3*, SHIU-YUN LIANG 2*, HSI-CHIN WU 1,2, CHIA-LIN CHANG
More informationXRCC1 gene polymorphisms in a population sample and in women with a family history of breast cancer from Rio de Janeiro (Brazil)
Short Communication Genetics and Molecular Biology, 32, 2, 255-259 (2009) Copyright 2009, Sociedade Brasileira de Genética. Printed in Brazil www.sbg.org.br XRCC1 gene polymorphisms in a population sample
More informationAward Number: W81XWH TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. Rajvir Dahiya, Ph.D. CONTRACTING ORGANIZATION:
More informationAssociation between genetic polymorphisms of PTGS2 and glioma in a Chinese population
Association between genetic polymorphisms of PTGS2 and glioma in a Chinese population R.P. Lin 1, C.Y. Yao 2 and D.X. Ren 1 1 Department of Neurosurgery, First People s Hospital of Shenyang, Shenyang,
More informationInvestigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small Cell Lung Cancer
Original Article Middle East Journal of Cancer; January 2018; 9(1): 13-17 Investigation of Programmed Cell Death-1 (PD-1) Gene Variations at Positions PD1.3 and PD1.5 in Iranian Patients with Non-small
More informationAberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer
Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer J. Jin 1,2, L. Xie 2, C.H. Xie 1 and Y.F. Zhou 1 1 Department of Radiation & Medical Oncology, Zhongnan Hospital of Wuhan
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationAssociation between interleukin gene polymorphisms and risk of recurrent oral ulceration
Association between interleukin gene polymorphisms and risk of recurrent oral ulceration C. Jing and J.-Q. Zhang Department of Stomatology, The First Affiliated Hospital of PLA General Hospital, Beijing,
More informationAssociation between the XPG gene Asp1104His polymorphism and lung cancer risk
Association between the XPG gene Asp1104His polymorphism and lung cancer risk B. Zhou, X.M. Hu and G.Y. Wu Department of Thoracic Surgery, Hunan Provincial Tumor Hospital, Changsha, China Corresponding
More informationDistribution of Polymorphisms in DNA Repair Genes (RAD51 and XRCC3) in Cases of De Novo Acute Myeloid Leukaemia
Journal of Molecular Diagnosis and Vaccines Vol. 6, 2008 Page: 1-9 Distribution of Polymorphisms in DNA Repair Genes (RAD51 and XRCC3) in Cases of De Novo Acute Myeloid Leukaemia 1* Amani Sorour, 2 Dalia
More informationAdditions to the Medical Geologist s Toolbox
Additions to the Medical Geologist s Toolbox Application of Sensitive Biological Endpoints to Assess Human Exposure and Potential Health Effects at Low Environmental Contaminant Concentrations Malcolm
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationGenetic Predictors of Radiosensitivity.
Genetic Predictors of Radiosensitivity. Richard G. Stock, MD Professor, Director of Genito-Urinary Oncology Department of Radiation Oncology Ichan School of Medicine at Mount Sinai New York, NY DISCLOSURE
More informationHuman leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
More informationRESEARCH ARTICLE. Comprehensive Assessment of Associations between ERCC2 Lys751Gln/Asp312Asn Polymorphisms and Risk of Non- Hodgkin Lymphoma
RESEARCH ARTICLE Comprehensive Assessment of Associations between ERCC2 Lys751Gln/Asp312Asn Polymorphisms and Risk of Non- Hodgkin Lymphoma Jue-Yu Zhou 1& *, Li-Wen He 1,2&, Jie Liu 3, Hai-Lang Yu 1, Min
More informationCytochrome P450 2E1 RsaI/PstI and DraI Polymorphisms Are Risk Factors for Lung Cancer in Mongolian and Han Population in Inner Mongolia
www.springerlink.com Chin J Cancer Res 23(2): 107-111, 2011 107 Original Article Cytochrome 450 2E1 RsaI/stI and DraI olymorphisms Are Risk Factors for Lung Cancer in Mongolian and Han opulation in Inner
More informationIL-17 rs genetic variation contributes to the development of gastric cancer in a Chinese population
IL-17 rs2275913 genetic variation contributes to the development of gastric cancer in a Chinese population B.L. Xu, Y.T. Li, S.X. Dong, J. Qi, H.M. Feng, L. Zi and D.Y. Yang Department of General Surgery,
More informationOriginal Article A meta-analysis of XPD/ERCC2 Lys751Gln polymorphism and melanoma susceptibility
Int J Clin Exp Med 2015;8(8):13874-13878 www.ijcem.com /ISSN:1940-5901/IJCEM0011635 Original Article A meta-analysis of XPD/ERCC2 Lys751Gln polymorphism and melanoma susceptibility Yalin Sun 1*, Hao Zhang
More informationASSOCIATION BETWEEN MTHFR (C677T) GENE POLYMORPHISM WITH BREAST CANCER IN NORTHERN IRAN
WCRJ 2017; 4 (2): e876 ASSOCIATION BETWEEN MTHFR (C677T) GENE POLYMORPHISM WITH BREAST CANCER IN NORTHERN IRAN A. HEDAYATIZADEH-OMRAN, R. ALIZADEH-NAVAEI, F. TOGHANI-HULARI, O. AMJADI Gastrointestinal
More informationSupplementary information
Supplementary information Hepatitis B virus genotype, mutations, human leukocyte antigen polymorphisms and their interactions in hepatocellular carcinoma: a multi-centre case-control study Juan Wen, Ci
More informationClinical Importance of MTHFR Gene Polymorphism in Coronary Artery Disease: A Study from India
Human Journals Research Article September 2018 Vol.:13, Issue:2 All rights are reserved by Alpana Saxena et al. Clinical Importance of MTHFR Gene Polymorphism in Coronary Artery Disease: A Study from India
More informationLung cancer remains the deadliest cancer worldwide despite
ORIGINAL ARTICLE ERCC2/XPD Lys751Gln and Asp312Asn Gene Polymorphism and Lung Cancer Risk A Meta-Analysis Involving 22 Case Control Studies Ping Zhan, MD,* Qin Wang, MD, Shu-Zhen Wei, MD, Jing Wang, MD,
More informationOriginal Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in patient with glioma
Int J Clin Exp Pathol 2015;8(8):9463-9467 www.ijcep.com /ISSN:1936-2625/IJCEP0011215 Original Article Blood-based DNA methylation of DNA repair genes in the non-homologous end-joining (NEHJ) pathway in
More informationRole of IL-8 rs4073 and rs polymorphisms in the development of primary gouty arthritis in a Chinese population
Role of IL-8 rs4073 and rs2227306 polymorphisms in the development of primary gouty arthritis in a Chinese population Y.X. Cui, H. Zhao and H.Q. Guo Department of Rheumatism, Yan an University Affiliated
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationTitle:The effect of CD14 and TLR4 gene polimorphisms on asthma phenotypes in adult Turkish asthma patients: a genetic study
Author's response to reviews Title:The effect of CD14 and TLR4 gene polimorphisms on asthma phenotypes in adult Turkish asthma patients: a genetic study Authors: Fusun Sahin (fusunsahin19700@hotmail.com)
More informationA common genetic variant of 5p15.33 is associated with risk for prostate cancer in the Chinese population
A common genetic variant of 5p15.33 is associated with risk for prostate cancer in the Chinese population Q. Ren 1,3 *, B. Xu 2,3 *, S.Q. Chen 2,3 *, Y. Yang 2,3, C.Y. Wang 2,3, Y.D. Wang 2,3, X.H. Wang
More informationORIGINAL ARTICLE. DNA Repair Gene ERCC1 and ERCC2/XPD Polymorphisms and Risk of Squamous Cell Carcinoma of the Head and Neck
ORIGINAL ARTICLE DNA Repair Gene ERCC1 and ERCC2/XPD Polymorphisms and Risk of Squamous Cell Carcinoma of the Head and Neck Erich M. Sturgis, MD; Kristina R. Dahlstrom, BS; Margaret R. Spitz, MD, MPH;
More informationThe Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationInfluence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
More informationXRCC3 THR241MET POLYMORPHISM IS NOT ASSOCIATED WITH LUNG CANCER RISK IN A ROMANIAN POPULATION
DOI: 10.15386/cjmed-523 XRCC3 THR241MET POLYMORPHISM IS NOT ASSOCIATED WITH LUNG CANCER RISK IN A ROMANIAN POPULATION ANDREEA CATANA 1, MONICA POP 2, DRAGOS HOREA MARGINEAN 1, IOANA CRISTINA BLAGA 1, MIHAI
More informationGenetic variability of DNA repair mechanisms in chemotherapy treatment outcome of gastric cancer patients
Genetic variability of DNA repair mechanisms in chemotherapy treatment outcome of gastric cancer patients G. Zhong 1, H.K. Li 2, T. Shan 1 and N. Zhang 1 1 Department of Gastrointestinal Surgery, Tianjin
More informationDepartment of Respiratory Medicine, Zhengzhou Central Hospital Affiliated to Zhengzhou University, Zhengzhou, China
Association of glutathione S-transferase (GST) genetic polymorphisms with treatment outcome of cisplatin-based chemotherapy for advanced non-small cell lung cancer in a Chinese population H.L. Xiao 1,
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Hartman M, Loy EY, Ku CS, Chia KS. Molecular
More informationPolymorphic study of OGG1 gene in gastric cancer patients of Kashmir valley
Polymorphic study of OGG1 gene in gastric cancer patients of Kashmir valley Rukhsana Akhtar 1, Nazia 2, Zainab Mushtaq 3 1,2,3 Department of Clinical Biochemistry, University of Kashmir, (India) ABSTRACT
More informationKeywords: Ischemic Stroke;Hemorrhagic Stroke; E-Selectin S128R Gene; Polymorphism; Nitric Oxide Synthase (NOS).
www.semargroup.org, www.ijsetr.com ISSN 2319-8885 Vol.03,Issue.18 August-2014, Pages:3722-3726 Role of E-Selectin (S128R) Gene Polymorphism in Ischemic and Hemorrhagic Stroke MOHAMMED SUAD IBRAHIM 1, DR.
More informationISPUB.COM. Gardnerella vaginalis and breast cancer. L Tumanova, V Mitin, N Godoroja, N Botnariuc INTRODUCTION SPECIMEN COLLECTION
ISPUB.COM The Internet Journal of Oncology Volume 6 Number 2 L Tumanova, V Mitin, N Godoroja, N Botnariuc Citation L Tumanova, V Mitin, N Godoroja, N Botnariuc.. The Internet Journal of Oncology. 2008
More informationA Polymorphism Located Near PMAIP1/Noxa Gene Influences Susceptibility to Hodgkin Lymphoma Development in South India
DOI:10.22034/APJCP.2017.18.9.2477 RESEARCH ARTICLE A Polymorphism Located Near PMAIP1/Noxa Gene Influences Susceptibility to Hodgkin Lymphoma Development in South India Dimpal N Thakkar 1, Sunitha Kodidela
More information