Keywords: Ischemic Stroke;Hemorrhagic Stroke; E-Selectin S128R Gene; Polymorphism; Nitric Oxide Synthase (NOS).

Transcription

1 ISSN Vol.03,Issue.18 August-2014, Pages: Role of E-Selectin (S128R) Gene Polymorphism in Ischemic and Hemorrhagic Stroke MOHAMMED SUAD IBRAHIM 1, DR. B.VIJAYA LAKSHMI 2 1 Research Scholar, Dept of Biotechnology, Institute of Science & Technology, JNTU, Hyderabad, India. 2 Dept of Molecular Biology, Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Hyderabad, India. Abstract: A stroke is a permanent neurological deficit caused by an inadequate perfusion of a region of the brain. Around one third of stroke victims die within one year and an equal number of patients are permanently disabled. Stroke is the third leading cause of death worldwide. Stroke develops from a complex cascade of cellular events that ultimately lead to cerebral infarction. Ischemic strokes account for 85% and hemorrhagic stroke accounts for 15% of all strokes. A genome-wide scan for susceptibility genes for stroke, have identified a number genes responsible for stroke in different pathways. However, studies in inflammatory pathway in stroke has been less elucidated globally and especially in India. E-selection, also known as human leukocyte differentiation antigen CD62E, induces adhesion of activated endothelial cells to leukocytes, subsequently mediates leukocyte activation and triggers a series of inflammatory reactions, leading to atherosclerosis. The S128R variant has been reported to attract substantial amount of leukocytes that damage the vascular tissues of brain. Therefore this variant can be useful in establishing the genetic predisposition among patients for ischemic or hemorrhagic stroke. The study group consists of 30 ischemic and 30 hemorrhagic stroke patients from Nizam s Institute of Medical Sciences and the two types of stroke were differentiated by MRI and CT scan reports. As a control group equal number of healthy individuals matched for sex and age were recruited from the same demographic area. Information on epidemiological factors such as age, sex, family history, occupation, addictions etc along with blood samples were collected after obtaining informed consent from all the study subjects in a standard performance. DNA isolation was done using standard phenol-chloroform method and genotypes were determined by PCR-RFLP technique. The obtained genotypic data was further used for statistical analysis to test the significance of results. Thus, this study will help in screening and analyzing the role of the E- selection alleles that may predispose the South Indian population to stroke. Keywords: Ischemic Stroke;Hemorrhagic Stroke; E-Selectin S128R Gene; Polymorphism; Nitric Oxide Synthase (NOS). I. INTRODUCTION Stroke is a form of cardiovascular disease affecting the blood supply to the brain also referred to as cerebrovascular disease or apoplexy. A stroke is a sudden interruption in the blood supply of the brain. Most strokes are caused by an abrupt blockage of arteries leading to the brain (ischemic stroke). Other strokes are caused by bleeding into brain tissue when a blood vessel bursts (hemorrhagic stroke). When the symptoms of a stroke last only a short time (less than an hour), this is called a transient ischemic attack (TIA) or mini-stroke. Risk factors for stroke are divided into two main categories modifiable and non-modifiable. Modifiable risk factors are manageable and include: hypertension, dyslipidaemia, diabetes, smoking, alcohol abuse, physical inactivity, obesity etc. Non-modifiable risk factors of stroke includes: age, gender, ethnicity, previous strokes or TIA and hereditary factors. Stroke can be sub-divided into two types that are ischemic and hemorrhagic. An ischemic stroke is death of an area of brain tissue resulting from an inadequate supply of blood and oxygen to the brain due to blockage of an artery (5).This results in tissue hypoperfusion, hypoxia and eventual cell death secondary to a failure of energy production. The three main mechanisms are involved in the development of an ischemic stroke, and they are associated with atherothrombotic, embolic and small vessel diseases. Ischemic stroke accounts for 85% of all cases. Hemorrhagic stroke accounts for about 25% of stroke cases in Western countries and 20% in India. It results from a weakened vessel that ruptures and bleeds into the surrounding brain. The blood accumulates and compresses the surrounding brain tissue. The two types of hemorrhagic strokes are intracerebral (within the brain) hemorrhage or subarachnoid hemorrhage. Hemorrhagic stroke occurs when a weakened blood vessel ruptures. Two types of weakened blood vessels usually cause hemorrhagic stroke: aneurysms and arteriovenous malformations (AVMs). The primary causes of these ruptures are hypertension and amyloid angiopathy etc. Stroke is the third largest killer, after cancer and heart attack. According to the survey conducted by WHO, the incidence of stroke in India is around 130/100,000 people every year. It affects men more than women SEMAR GROUPS TECHNICAL SOCIETY. All rights reserved.

2 Stroke death rates are higher in the South Eastern United States, compared with other regions of the country. Blacks and American Indians, Asians and Hispanics die from stroke at younger age than whites. There is marked geographic heterogeneity in the incidence of the stroke. Stroke occurs more frequently in older people but can occur in persons of all ages, including children. About two thirds of stroke risk can be explained by variation in known risk factors. Stroke is a complex genetic disorder with a heterogenous phenotype influenced by genetic factors. A number of genetic variants involved in different pathways have been reported to account for pathophysiology of stroke. Mutation in many genes like Apo lipoprotein E (APOE), Methylene Tetrahydro Folate Reductase (MTHFR), Factor V Leiden, Angiotensin Converting Enzyme (ACE), Endothelial Nitric Oxide Synthase (NOS) have already been studied in association with stroke. The human E-selectin gene is located on chromosome number 1q24.2, spans approximately 13 kb long and consists of 14 exons and 13 introns. The Ser128Arg polymorphism (A to C mutation) of E-selectin gene was first of all explained by Wenzel et al.[13]. There are few reports on the association of this polymorphism with stroke in Indian patients. Therefore, the present study was taken up to investigate the association of E-selectin gene polymorphism (S128R) with ischemic stroke and hemorrhagic stroke in a South Indian population from Andhra Pradesh. MOHAMMED SUAD IBRAHIM, DR. B.VIJAYA LAKSHMI restriction enzyme by incubating at 37 C for 5 min followed by separation of fragments on 2 % agarose gel. Wild-type (AA) genotype shows the presence of fragments of 219 and 138 bp, heterozygous (AC) genotype 357 bp, 219 and 138 base pairs (bp), and variant genotype (CC) was detected as 357 bp. III. RESULT AND DISCUSSION A. Demographic Features During the present study, 30 ischemic, 30 hemorrhagic stroke patients and 30 controls were analyzed. The mean age of patients and controls were 57.3, 54.2 and 54.9 years respectively. Healthy individuals matched for age and sex were considered as controls. Comparison of risk factors between controls and hemorrhagic stroke patients revealed that the family history of stroke, family history of hypertension, diabetics, smokers and alcoholics were common among hemorrhagic patients when compared to controls. TABLE I: Demographic Features of Study Population II. MATERIALS AND METHODS 30 ischemic stroke patients (males/ females=24:6), 30 hemorrhagic stroke patients(male/female=24:6) presenting with new stroke evaluated in the stroke clinic of Nizam's Institute of Medical Sciences, Hyderabad (Andhra Pradesh, India) were included in the study. The study was approved by the ethical committee of the study hospital. All the patients were examined by a qualified stroke neurologist, and ischemic stroke was differentiated by computed tomography (CT) scans and magnetic resonance imaging (MRI). All the patients underwent CTs can as well as MRI. Patients with major cardiac, renal, hepatic, endocrinological disorders, skeletal disorders, and can cerous diseases were excluded from this study. As a control group, 30 healthy individuals matched for sex and age (males/females= 24:6) were recruited from the same demographic area. The controls had no clinical evidence of any cerebrovascular disease. Information on demographic features was collected by using a structured questionnaire. Hypertension, alcohol use, diabetes, and smoking were defined as reported previously [14]. B. Genomic DNA Isolation Fig.1 presents the g-dna was isolated by using Phenol chloroform method and visualized on 0.8% Agarose Gel. Isolation of DNA and Genotyping: The blood was collected in EDTA tubes. Genomic DNA was extracted from blood samples using standard phenol chloroform method. The S128Rpolymorphism of E-selectin gene was analysed by polymerase chain reaction restriction fragment length polymorphism technique. The primers used for the amplification of the E-selectin bearing the polymorphism S128R are forward: 5'ATGGCACTCTGTAGGACTGCT3' and reverse: 5'GTCTCAGCTCACGATCACCAT3'. The amplified 357 bp PCR product was digested with PstI Fig.1. Genomic DNA. C. PCR for E-Selectin Gene Fig.2 presents the region of interest was amplified by carrying out PCR with specific pairs of primers. PCR products were then separated on 1.5% agarose gel and visualized by ethidium bromide staining. This reaction yielded a 357 bp fragment.

3 Role of E- Selection (S128R) Gene Polymorphism in Ischemic and Hemorrhagic Stroke TABLE IV: Nitric Oxide Levels In (Ischemic Stroke) Patient Samples Fig.2. Amplification of E-Selectin gene polymorphim. The PCR product was subjected to RFLP using restriction enzyme PstI. RFLP products were then separated on 2.5% agarose gel and visualized by ethidium bromide staining. The presence of 219bp and 138bp fragments represented the AA genotype(homozygous Normal), 357bp fragment represented the CC (Homozygous Mutant) and the presence of 357bp, 219bp and 138bp fragment represented the AC genotype (Heterozygous) as shown in Fig.3. TABLE V: Nitric Oxide Levels In (Hemorrhagic Stroke) Patients Samples Fig.3. RFLP of E-Selectin (S128R) Gene. TABLE II: Distribution of E-Selectin Genotypes and Allele Frequencies of Study Population D. Estimation of Nitric Oxide The nitric oxide levels were estimated in patient s serum samples. The normal range of nitric oxide is from 2-6 Mol/ML in the serum. The serum Nitric oxide levels were estimated in patients as well as in healthy samples. TABLE III: O.D Values of Standard Nitric Oxide

4 The mean nitric oxide level in ischemic stroke and hemorrhagic stroke patient samples was found to be 8.71mol/ml and 8.74mol/ml where as the mean level in case of control samples was found to be 5.67mol/ml. Nitric oxide levels were elevated in patients in comparison with controls but there was not much of a difference in the levels between the two stroke types. Table VI: Nitric Oxide Levels in Control Samples Table VII: Mean nitric oxide level in patients and controls F. Discussion A number of genetic variants have been found to be related with ischemic and hemorrhagic Stroke. In this study we investigated the association of E-selection gene (S128R) polymorphism and nitric oxide levels with ischemic and hemorrhagic stroke in South Indian Population. As it is a case-control study, 30 samples were collected for each study group. Genotyping was done using PCR-RFLP method. The allelic frequency for A and C allele was found to be 0.68 and 0.32 in ischemic stroke 0.65 and 0.35 for hemorrhagic stroke MOHAMMED SUAD IBRAHIM, DR. B.VIJAYA LAKSHMI patients whereas, in controls the allelic frequency for A and C allele was 0.8 and 0.2 respectively. For the NO estimation the mean levels found were 8.71µmol/ml, 8.74µmol/ml and 5.67µmol/ml for ischemic stroke, hemorrhagic stroke and controls respectively. Our results clearly indicate that S128R polymorphism of E-selection gene may be a useful genetic candidate for studying the association with ischemic and hemorrhagic stroke. However, for a better insight into the role of gene in stroke a larger study sample needs to be analyzed. Additionally the biochemical estimation of NO levels in serum samples also proved to be a potential biochemical indicator in differentiating between cases and control subjects but not between the two types of stroke. IV. CONCLUSION In the present study, we observed the AC genotype to be more prevalent among ischemic stroke patients and mutant CC genotype to be more prevalent among hemorrhagic stroke patients. On the other hand controls were recorded to have more of normal AA genotype. This indicates that this particular gene and the mutant C allele may play a role in predisposing individuals to stroke. Therefore this gene polymorphism might be associated with increased risk of developing stroke in the South Indian population. However, on account of less sample size a strong conclusion about the role of this gene in stroke could not be established. Studies with other variants of E-Selectin gene and with more sample size should be carried out to strengthen and reach a stronger conclusion regarding role of this gene in stroke. V. REFERENCES [1]Abu-Duhier FM et al. FLT3 internal tandem duplication mutations in adult acute myeloid leukaemia define a highrisk group. British Journal of Haematology. 2000; 111(1): [2] Adams HP, Jr, Bendixen BH, Kappelle L J, Biller J, Love BB, Gordon DL and Marsh EE. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trail of Org in Acute Stroke Treatment Stroke 1993; 24: [3] Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell. 4th Ed. New York: Garland Science: Taylor and Francis Group, [4] Altman J, Das GD. Post-natal origin of microneurones in the rat brain. Nature. 1965; 207(5000): [5] Arora S, Dhamija RK, Gaba P, Jais M, Kaintura A, Kumar M, Bhattacharjee J. Study of Genetic, Metabolic and inflammatory risk factors in patients of acute ischemic Stroke. Indian journal of clinical Biochemistery 2008; 23(2): [6] Ay H and Koroshetz WJ. Transient ischemic attack: Are three different types or classes. Risk of Stroke and treatment options. Current treatment options in cardio vascular medicine [7] Bernard PS, Wittwer CT. Real-time PCR technology for cancer diagnostics. Clinical Chemistry. 2002: 48(8): [8] Bhatnager, S. and Andy, O. Neuroscience for the Study of Communicative Disorders, Baltimore, Williams and Wilkins. (1995).

5 Role of E- Selection (S128R) Gene Polymorphism in Ischemic and Hemorrhagic Stroke [9] Blanchard MM, Taillon-Miller P, Nowotny P, etal.pcr buffer optimization with uniform temperature regimen to facilitate automation. Genome Res. 1993; 2: [10] Boden Abala B and Sacco R. Life style factors and stroke risk;exercise,alcohol, diet, obesity, smoking, drug use and stress. Current Arthrosclerosis Reports 2000; 2: [11] Boffetta P, Straif K. Use of smokeless tobacco and risk of myocardial infarction and stroke: systematic review with meta-analysis. BMJ. 2009; 339:b3060. [12] Bonita R. The epidemiology of stroke. Lancet.1992; 339: [13] Wenzel, K., R. Hanke, and A. Spee Polymorphism in the human E-selectin gene detected by PCR-SSCP. Human Genetics 94(4): [14] Munshi, A., S. Shehnaz, S. Kaul, B. Pulla Reddy, S. Alladi, and A. Jyothy Angiotensin converting enzyme insertion/deletion polymorphismand the risk of ischemic stroke in a South Indian population. Journal of Neurological Sciences 272: