Constitutional NF1 Mutations In Neurofibromatosis 1 Patients With Malignant Peripheral Nerve Sheath Tumors

Transcription

1 HUMAN MUTATION Mutation in Brief #664 (2003) Online MUTATION IN BRIEF Constitutional NF1 Mutations In Neurofibromatosis 1 Patients With Malignant Peripheral Nerve Sheath Tumors Lan Kluwe 1 *, Reinhard E. Friedrich 1, Matthias Peiper 2, Jan Friedman 3, and Victor-F. Mautner 4 1 Department of Maxillofacial Surgery, Department of Surgery, 2 Department of Neurology, University Hospital Hamburg-Eppendorf, Hamburg, Germany; 3 Medical Genetics, University of British Columbia, Vancouver, Canada; 4 Klinikum Nord Ochsenzoll, Hamburg, Germany *Correspondence to: Dr. Lan Kluwe, Laboratory for Tumor Biology and Development Disorders, Department of Maxillofacial Surgery, University Hospital Eppendorf, Martinistr. 52, Hamburg, Germany; Tel.: ; Fax: ; kluwe@uke.uni-hamburg.de Grant sponsor: Hamburger Stiftung zur Förderung der Krebskämpfung, Rudolf-Bartling-Stiftung, Hannover, Germany; Grant number: 162 Communicated by Mark H. Paalman Neurofibromatosis type 1 (NF1) patients have 10% of lifetime risk for developing malignant peripheral nerve sheath tumors (MPNST), one of the most aggressive cancers. We examined the spectrum of constitutional NF1 mutations among 24 NF1 patients with MPNST. We found mutations in 18 patients: four megabase deletions involving the NF1 gene, 13 truncating mutations, and only one missense mutation. One deletion included both exonic and intronic sequences. No typical splicing mutation was found. Five of these mutations were novel: c.3686dela, c.197_204+9del17, c.3044t>c (p.leu1015pro), c.2497delt, and c.6020_6027dup. The proportion of megabase deletions of the NF1 gene found in patients with MPNST (17% = 4/24) was higher than that in a group of unselected NF1 patients (5.4% = 27/500) Wiley-Liss, Inc. KEY WORDS: neurofibromatosis 1; NF1; malignant peripheral nerve sheath tumors; MPNST INTRODUCTION Neurofibromatosis 1 (NF1) is an autosomal dominant disease with an incidence of about 1 in NF1 is characterized by a variety of benign and malignant lesions, including café-au-lait spots, neurofibromas, pilocytic astrocytomas and malignant peripheral nerve sheath tumors (MPNSTs) (Huson & Hughes, 1994; Marchuk et al., 1994). NF1 is caused by mutations of the NF1 tumor supressor gene (MIM# ) located on chromosome 17q11.2 (Cawthon et al; 1990; Viskochil et al., 1990; Wallace et al., 1990). Somatic loss or mutation of the normal NF1 allele has been found in NF1-associated benign neurofibromas as well as in pilocytoc astrocytomas and MPNSTs (Skuse et al., 1989; Legius et al., 1993; Colman et al., 1995; Serra et al., 1997, 2000; Kluwe et al., 1999, 2001), as predicted by the two-hit model for a tumor supressor gene (Knudson, 1971). Malignant peripheral nerve sheath tumors are aggressive Schwann cell neoplasms. About half of all MPNSTs Received 27 May 2003; accepted revised manuscript 20 August WILEY-LISS, INC. DOI: /humu.9193

2 2 Kluwe et al. occur in patients with neurofibromatosis 1, and the lifetime risk of developing a MPNST is 8-13% among NF1 patients (Evans et al., 2002). MPNSTs are a leading cause of death in people with NF1 (Rasmussen et al., 2001). Five year survival rate for NF1 patients with MPNSTs is only 21% (Evans et al., 2002). MPNSTs respond poorly to chemotherapy or radiotherapy, and complete surgical excision with tumor-free surgical margins is the most important prognostic factor for patient survival and local control (Wong et al., 1998). A recent study suggests that NF1 patients whose constitutional mutation is a megabase deletion of the entire NF1 locus develop MPNST more frequently than NF1 patients with other kinds of constitutional mutations (De Raedt et al., 2003). The only previous study of constitutional mutations among NF1 patients with MPNST included only seven patients (Wu et al., 1999). Constitutional mutations were found in three of these patients, and three patients had deletions of the whole NF1 gene. In the present study, we screened 24 NF1 patients with MPNST for constitutional NF1 mutations and identified mutations in 18. MATERIALS AND METHODS The 24 patients included in the present study were examined in our NF-clinic in Hamburg. All patients had NF1 diagnosed according to the updated NIH criteria (Gutmann et al., 1997). The protocol was approved by the institutional review board, and all participants provided informed consent. All patients underwent MRI of the brain, ultrasound of abdominal organs, ophthalmological investigation, and neurological examinations. DNA was extracted from blood lymphocytes using a QIAamp Blood Kit from Qiagen (Hilden, Germany). Mutation analysis was performed by direct sequencing of 57 constitutive NF1 exons (Fahsold et al., 2000, Kluwe et al., 2000, 2003). Primers for exons 5, 12a, 16, 20, 24, 26, 27b, 34, 39, 40, 41, 43, 44, 45, 46, and 47 were from Abernathys et al. (1997), and those for exons 17, 18, 19a, 22 and 23-1 were from Purandare et al. (1995). Primers for exon 12b were designed in this study (gtgcttcagtaaagcttatttat/acagagcacataaaatgatcaga). All other primers were from Fahsold et al. (2000). Discrepancies between the NF1 genomic sequence (AC004222) and the sequences of the primers for exons 9, 16, 17, 18, 20/21, 30 and 46 were found and corrected. All mutations were confirmed by repeat amplification and sequencing. Positions of mutations at DNA level were numbered using the GenBank NF1 mrna sequence M82814 with first base of the start codon ATG as the first base pair. For position of changes at the protein level, the translation initiator Methionine is numbered as 1. All patients were genotyped using 6 microsatellite markers located in introns 27 (IVS27CA28.4, IVS27TG24.8, M98509, IVS27AAAT2.1, IVS27AC33.1) and 38 (IVS38GT53) of the NF1 gene (Serra et al., 2000). Patients showing only a single allele for all 6 markers were further examined for deletion of the entire NF1 gene by FISH using the intra-nf1 probes A04138 and G02121 (Tinschert et al., 2000). RESULTS Twenty-four patients with NF1 and MPNSTs were included in this study. Their age at diagnosis for MPNST varied from 13 to 58 years (median = 29 years). Thirteen patients died of MPNST, but the other 11 are alive 18 to 184 months after the diagnosis of MPNST. In 13 cases, the MPNST is known to have developed from a plexiform neurofibroma. In the other 11 cases, we could not judge whether the malignant tumors arose from a plexiform neurofibroma because the patients came to us after surgery. We performed direct sequencing of all 57 constitutive exons of the NF1 gene on DNA extracted from the blood of these 24 patients. Fourteen different NF1 mutations were found in exons 2, 10a, 16, 18, 20, 21, 23.2, 27a, 27b, 29, 32, 36 and 37 (Table 1). Eight frame-shift mutations, 5 nonsense mutations, and one missense mutation were identified. The missense mutation of c.3044t>c (p.leu1015pro) in exon 18 was not seen in more than 50 other screened NF1 subjects. No splicing mutation was found. However, one nonsense mutation c.6792c>a is known to lead to mutation-induced exon skipping (Messiaen et al., 1997). The deletion in patient 553 included 8 base pairs of exon 2 and 9 base pair of intron 2 and is likely to affect splicing. However, the exact effect of this mutation could not be examined because no fresh blood was available for preparation of mrna. Five mutations, including the missense mutation, were novel (Table 1), while the other 9 have been reported previously ( html). Four other patients were found to exhibit only a single allele for 6 microsatellite markers in the NF1 gene. Subsequent FISH revealed loss of one of the two signals of each of the intra-nf1 probes A04138 and G02121, indicating that these patients had deletions of the entire NF1 gene.

3 NF1 Mutations and MPNST 3 Table 1. NF1 Mutations Associated with MPNST Patient ID Exon Mutation Alteration at protein level Age at MPNST Survival (months) Missense mutations c.3044t>c, Leu>Pro Leu1015Pro (died) Nonsense mutations a c.1318c>t p.arg340x (died) c.4084c>t p.arg1362x 32 6 (died) a c.4537c>t P.Arg1513X (died) c.6706a>t p.lys2236x c.6792c>a p.tyr2264x and p.ala2253-lys2286del Frameshift mutations c.197_204+9del17 Unknown c.2497delt p.ser833fs c.3457_3460delctca p.leu1153delfs (died) c.3526_3527delag p.arg1176fs 14 9 (died) c.3686dela p.asn1229fs (died) b c.4696_4697deltt p.ala1565fs c.5227_5229delgtainst p.val1743fs c.6020_6027dupctgaggtg p.met2010fs 48 4 (died) NF1 megabase-deletons (died) (died) (died) No mutations found (died) (died) GenBank NF1 mrna sequence M82814; novel mutations in bold. DISCUSSION The mutation detection rate of 75% (18/24) in the present study is compatible with results of most previous studies (Fahsold et al., 2000; Ars et al., 2000; Kluwe et al., 2000, 2003), but certain genetic alterations such as deletions of whole exons would not be detected by the screening techniques used in this study. By combining multiple methods including a protein truncation test, constitutional alterations of the NF1 gene can be found in more than 95% of NF1 patients (Messiaen et al., 2000). Four (17%) out of the 24 patients with MPNST in this study had microdeletions of the NF1 gene. This proportion of microdeletions is higher than that seen in a sample of 500 unselected NF1 patients we studied recently (4.4 to 5.4%, Kluwe et al., 2003, submitted). This finding is consistent with a recent finding that patients with NF1 microdeletions have at least a two-fold increased risk for developing MPNST (De Raedt et al., 2003). The lack of typical splicing mutations among our patients with MPNSTs was unexpected because this is one of the most frequent classes of constitutional mutations in NF1 patients (Ars et al., 2000). We would expect to detect most splicing mutations with the screening technique we used because such mutations were found in patients with plexiform neurofirbomas in our previous study using the same technique (Kluwe et al., 2002). However, some nonsense, missense mutations and frameshift mutations may also alter splicing. For example, the nonsense mutation c.6792c>a is known to cause skipping of exon 37. Also the deletion covering the boundary of exon and intron 2 is likely to alter the splicing of the NF1 transcript. However, alteration in splicing products could not be examined in this study due to lack of mrna.

4 4 Kluwe et al. We also found only one missense mutation among our patients with MPNSTs. A previous study of seven NF1 patients with MPNST found one missense mutation, one splicing mutation, one inframe-deletion and three megabase NF1 deletions (Wu et al., 1999). The results of these two studies taken together suggest that NF1 patients with various kinds of constitutional mutations may develop MPNST. More NF1 patients with MPNST need to be screened to determine the risk related to microdeletions and other classes of constitutional mutations of the NF1 gene. REFERENCES Abernathy CR, Rasmussen SA, Stalker HJ, Zori R, Driscoll DJ, Williams CA, Kousseff BG, Wallace MR NF1 mutation analysis using a combined heteroduplex/sscp approach. Hum Mutat 9: Ars E, Serra E, García J, Kruyer H, Gaona A, Lázaro C, Estivill X Mutations affecting mrna splicing are the most common molecular defects in patients with neurofibromatosis type 1. Hum Mol Genet 9: Cawthon R, Weiss R, Xu G, Viskochil D, Vulver M, Stevens J, Robertson M, Dunn D, Gesteland R, O Connell P, White R A major segment of neurofibromatosis type 1 gene: cdna sequence, genomic structure and point mutations. Cell 62: Colman SD, Williams CA, Wallace MR Benign neurofibromas in type 1 neurofibromatosis (NF1) show somatic deletions of NF1 gene. Nat Genet 11: De Raedt T, Brems H, Wolkenstein P, Vidaud D, Pilotti S, Perrone F, Mautner V, Frahm S, Sciot R, Legius E Elevated risk for MPNST in NF1 microdeletion patients.am J Hum Genet 72: Evans DG, Baser ME, McGaughran J, Sharif S, Howard E, Moran A Malignant peripheral nerve sheath tumours in neurofibromatosis 1. J Med Genet 39: Fahsold R, Hoffmeyer S, Mischung C, Gille C, Ehlers C, Kücükceylan N, Abdel-Nour M, Gewies A, Peters H, Kaufmann D, Buske A, Tinschert S, Nürnberg P Minor lesion mutational spectrum of the entire NF1 gene does not explain ist high mutability but points to a functional domain upstream of the GAP-raleted domain. Am J Hum Genet 66: Gutmann D, Aylsworth A, Carey J, Korf B, Marks J, Pyeritz R, Rubenstein A, Viskochil D The diagnostic evaluation and multidisciplinary management of neurofibromatosis 1 and neurofibromatosis 2. JAMA 278: Huson SM, Hughes RAC The neurofibromatoses: a pathogenetic and clinical overview. London: Chapman & Hall. Kluwe L, Friedrich R, Mautner VF Allelic loss of the NF1 Gene in NF1-associated plexiform neurofibromas. Cytogent Cancer Genet 110: Kluwe L, Hagel C, Tatagiba M, Thomas S, Stavrou D, Ostertag H, von Deimling A, Mautner VF: Loss of NF1 alleles distinguish sporadic from NF1-associated pilocytic astrocytomas. J Neuropathol Exp Neurol. 2001;60: Kluwe L, Friedrich RE, Korf B, Fahsold R, Mautner V-F NF1 mutations in neurofibromatosis 1 patients with plexiform neurofibromas. Hum Mutat 19:309. Kluwe L, Siebert R, Gesk S, Tinschert S, Kehrer-Sawatzki H, Mautner V-F Screening of 500 unselected neurofibromatosis type 1 patients for deletions of the NF1 gene. Submitted to Hum Mutat. Knudson AG. Mutation and cancer: statistical study of retinoblastoma Pro Natl Acad Sci USA 68: Legius E, Marchuk DA, Collins FS, Glover TW Somatic deletion of the neurofibromatosis type 1 gene in a neurofibromsarcoma supports a tumor suppressor gene hypothesis. Nat Genet 3: Marchuk DA, Collins FS. Molecular genetics of neurofibromatosis 1. In Huson SM, Hughes RAC, editors The neurofibromatoses. A pathogenetic and clinical overview. London: Chapman and Hall p Messiaen LM, Callens T, Mortier G, Beysen D, Vandenbroucke I, Van Roy N, Speleman F, et al Exhaustive mutation analysis of the NF1 gene allows identification of 95% of mutations and reveals a high frequency of unusual splicing defects. Hum Mut 15:

5 NF1 Mutations and MPNST 5 Purandare SM, Huntsman-Breidenbach H, Li Y, Lin Zhu X, Sawada S, Neil SM, Brothman A, White R, Cawthon R, Viskochil D Identification of neurofibromatosis 1 (NF1) homologous loci by direct sequencing, fluorescence in situ hybridization, and PCR amplification of somatic cell hybrids. Genomics 30: Rasmussen SA, Yang Q, Friedman JM Mortality in neurofibromatosis 1: an analysis using U.S. death certificates. Am J Hum Genet 68: Serra E, Puig S, Otero D, Gaona A, Kruyer H, Ars E, Estivill X, Lazaro C Confirmation of a double-hit model for the NF1 gene in benign neurofibromas. Am J Hum Genet 61: Serra E, Rosenbaum T, Winner U, Aledo R, Ars E, Estivill X, Lenard H-G, Lazaro C Schwann cells harbor the somatic NF1 mutation in neurofibromas: evidence of two different Schwann cell subpopulations. Hum Mol Genet 9: Skuse GR, Koschiolek BA, Rowley PT Molecular genetic analysis of tumors in von Recklinghausen neurofibromatosis: loss of heterozygosity for chromosome 17. Genes Chromosom Cancer 1: Tinschert S, Naumann I, Stegmann E, Buske A, Kaufmann D, Thiel G, Jenne DE Segmental neurofibromatosis is caused by somatic mutation of the neurofibromatosis type 1 (NF1) gene. Eur J Hum Genet 8: Viskochil D, Buchberg AM, Xu G, Stevens J, Wolff RK, Culver M, Carey JC, Copeland NG, Jenkins NA, White R, O Connel P Deletions and translocations interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell 62: Wallace MR, Marchuk DA, Andersen LB, Letcher R, Oden HM, Saulino AM, Fountain JW, Brereton AM, Nicholson J, Mitchell AL, Brownstein BH, Collins FS Type 1 neurofibromatosis gene: identification of a large transcript disrupted in three NF1 patients. Science 249: Wong WW, Hitose T, Scheithauer BW, Schild SE, Gunderson LL Malignant peripheral nerve sheath tumor: analysis of treatment outcome. Int J Radiation Oncology Biol Phys 42: Wu R, López-Correa C, Rutkowski JL, Baumbach LL, Glover TW, Legius E Germline mutations in NF1 patients with malignancies. Genes Chromosomes Cancer 26: