Aberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection
|
|
- Sabina Fitzgerald
- 5 years ago
- Views:
Transcription
1 Aberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection So-Hyun Shin, MSc; Seog-Yun Park, MD; Jae-Sung Ko, MD; Nayoung Kim, MD; Gyeong Hoon Kang, MD N Context. Helicobacter pylori infection is primarily acquired during childhood and persists throughout life in the absence of eradication with antibiotics. Helicobacter pylori infection induces methylation in the promoter CpG island loci in gastric epithelial cells. Thus, aberrant CpG island hypermethylation in gastric epithelial cells likely occurs early in life, although there are no existing data supporting this notion. Objectives. To identify whether aberrant CpG island hypermethylation occurs in pediatric stomach mucosa in association with H pylori infection and to compare methylation profiles of samples from pediatric and adult stomach tissues. Design. We analyzed pediatric (n = 47) and adult (n = 38) gastric mucosa samples for their methylation status in 12 promoter CpG island loci using the MethyLight assay and compared the number of methylated genes and the methylation levels in individual genes between H pylori positive and H pylori negative sample results and between pediatric and adult samples. Results. The average number of methylated genes was significantly higher in H pylori infected pediatric samples than in H pylori negative pediatric samples (3.4 versus 0.3, P,.001) and in H pylori infected adult samples than in H pylori negative adult samples (7.6 versus 0.9, P,.001). Seven genes showed significantly higher methylation levels in H pylori infected pediatric samples than in H pylori negative pediatric samples (all values were P,.05). Conclusions. These results indicate that CpG island hypermethylation occurs in pediatric gastric mucosa in association with H pylori infection and that the genes affected by H pylori associated hypermethylation were similar in pediatric and adult samples. (Arch Pathol Lab Med. 2011;135: ) CpG islands are CpG-rich DNA sequences that are found in the promoters and 59 exon sequences of approximately 60% to 70% of human genes. 1 In association with tumorigenesis, promoter CpG islands can undergo hypermethylation, which is an alternative to mutations that inactivate tumor suppressor genes or tumor-related genes. Promoter CpG island hypermethylation is found in virtually all types of human cancers and is recognized as an important mechanism of tumorigenesis. Although promoter CpG islands were traditionally thought to be protected from aberrant hypermethylation in healthy cells (except in imprinting genes or genes on inactive X chromosomes), promoter CpG island hypermethylation is now known to occur in healthy cells during aging and chronic persistent inflammation. 2 5 Accepted for publication July 20, From the Laboratory of Epigenetics, Cancer Research Institute (Ms Shin), the Department of Pediatrics (Dr Ko), the Department of Internal Medicine and Liver Research Institute (Dr Kim), and the Department of Pathology and Cancer Research Institute (Dr Kang), Seoul National University College of Medicine, Seoul, Korea; and the Department of Pathology, National Cancer Center, Goyang, Korea (Dr Park). The authors have no relevant financial interest in the products or companies described in this article. Reprints: Gyeong Hoon Kang, MD, Department of Pathology, Seoul National University College of Medicine, 28 Yongon-Dong, Chongno- Gu, Seoul , Korea ( ghkang@snu.ac.kr). Promoter CpG island hypermethylation occurs frequently in healthy epithelial cells of the stomach. 6,7 There is considerable evidence supporting the role of Helicobacter pylori infection in the induction of promoter CpG island hypermethylation in normal gastric epithelial cells Although H pylori infection is prevalent in the adult population, it is acquired during childhood and persists through adulthood in the absence of treatment with antibiotics. 11,12 Thus, it is likely that aberrant CpG island hypermethylation, which is frequently found in the H pylori infected adult stomach, is also acquired early in life. However, no information is available in the literature, to our knowledge, regarding the acquisition of CpG island hypermethylation in association with H pylori infection in pediatric stomach tissues. In this study, we analyzed the methylation status of pediatric and adult gastric stomach tissues at 12 CpG island loci that are frequently hypermethylated in the stomach in association with H pylori and/or cancer 13 and compared both the methylation levels and the frequency of methylation at individual loci in relation to Hpyloriinfection status and age. The aim of our study was to identify whether aberrant hypermethylation of promoter CpG islands occurs in pediatric gastric mucosal tissues and whether the acquisition of promoter CpG island hypermethylation is related to H pylori infection. Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 759
2 Table 1. MATERIALS AND METHODS Patients and Tissues A total of 135 pediatric patients who visited Seoul National University Children s Hospital, Seoul, Korea, for gastroscopy between February 2005 and January 2008 were enrolled in the study. Two biopsy samples were taken from the greater curvature of the antrum and from the body of the stomach. One sample from each site was fixed in neutral-buffered formalin solution and processed for hematoxylin-eosin staining and modified-giemsa staining for histologic evaluation and assessment of H pylori infection, respectively. A rapid urease test (Campylobacter-like organism [CLO] test; Delta West Pty Ltd, Bentley, Australia) was performed on the remaining specimen from each site and monitored for up to 24 hours. All pediatric case results that were positive for H pylori were included in the methylation study because of their rarity, and age- and gendermatched case results that were negative for H pylori were selected accordingly: H pylori positive pediatric samples (male to female ratio, 16:11; average age, 10 years; range, 4 18 years); and H pylori negative pediatric samples (male to female ratio, 12:8; average age, 9 years; range, 4 17 years). Cases showing intestinal metaplasia were excluded from the study because metaplastic epithelial cells are known to harbor hypermethylation of multiple CpG island loci regardless of H pylori infection. Thus, of 135 pediatric patients, a total of 47 tissue samples (47 pediatric patients) were included in the methylation analysis. Archival samples of stomach biopsy tissues from adult patients (n 5 38) enrolled in a previous study were included in this study: H pylori negative adult samples (male to female ratio, 10:6; average age, 55 years; range, years); and H pylori positive samples (male to female ratio, 13:9; average age, 56 years; range, years). These patients had been evaluated previously for H pylori infection status using 3 tests: serum anti H pylori immunoglobulin G (IgG) levels, tissue CLO test, and Giemsa staining of histologic slides. Adults with negative test results from all 3 tests were regarded as being negative for H pylori. For pediatric samples, the serum anti H pylori IgG test was not performed, and patients with positive results from the CLO test or from analysis of their Giemsa-staining results were considered positive for H pylori. The Ethics Committee of the Seoul National University Hospital approved the protocol, and prior written consent was obtained from all participating patients or their parents or guardians. Bisulfite Modification Sixteen archival tissue sections (4 mm thick) were stained with hematoxylin-eosin. Using knife blades, stained tissue sections were scraped, placed into microtubes, and digested in lysis buffer containing proteinase K. Bisulfite modification of the digested tissue samples (18 ml) was performed using the EZ DNA methylation kit (Zymo Research Co, Orange, California). MethyLight Assay From 25 DNA methylation markers that had been examined for their methylation status in nonneoplastic gastric mucosa and in gastric cancer in a previous study, 13 we selected 7 markers showing H pylori2associated hypermethylation (CALCA, CDH1, CRABP1, CYP1B1, DAPK1, GRIN2B, TWIST1) and 5 additional markers displaying cancer-associated hypermethylation (HOXA1, NEUROG1, NR3C1, SMAD9, TIMP3). The oligonucleotide sequences of the primers and the probes used have been Primers for Bisulfite Genomic Sequencing Gene Forward Primer (59 to 39) Reverse Primer (59 to 39) T m, uc Product, bp CDH1 TTTTAGTAATTTTAGGTTAGAGGGTTAT CAAACTCACAAATACTTTACAATTCC TIMP3 TTTGTTTTTTTAGTTTTTGTTTTTT ATCCCCCAAACTCCAACTACC Step-down PCR (60 to 54) 300 Abbreviations: bp, base pair; PCR, polymerase chain reaction; T m, melting temperature. described. 14 Briefly, 2 sets of primers and probes designed to bind specifically to bisulfite-converted DNA were used in each reaction: One set of primers and a probe were used for every methylated target to be analyzed (methylated reaction), and another pair of primers and a probe were used as the reference locus (ALU, normalization control reaction). The normalization control reactions were methylation-independent measurements to control for DNA amplification and to normalize input DNA. M.SssI-treated, placental genomic DNA was used as a reference sample for complete methylation to determine the percentage of methylated reference (PMR) at a particular locus. The PMR was defined as (methylated reaction/normalization control reaction) sample /(methylated reaction/normalization control reaction) M.SssI. We considered a CpG island locus to be methylated if the PMR value was greater than 4. Our rationale was that samples with PMR values less than 4 are not substantially methylated, and the PMR cutoff value of 4 has been validated by previous studies based on the distribution of PMR values in the tested CpG island loci, and correlation of protein expression loss with methylation positivity in CDKN2A, MLH1, and MGMT is determined by the PMR cutoff value of 4. 15,16 Bisulfite Genomic Sequencing The CpG island DNA methylation status was determined by polymerase chain reaction analysis after bisulfite modification and was followed by bisulfite genomic sequencing. All bisulfite genomic sequencing primers were designed so that the amplified segments included extra bases in both upstream and downstream regions of the segment amplified by the MethyLight primer set. Primer sequences are shown in Table 1. Polymerase chain reaction products were cloned into the pgem-t Easy vector (Promega Corporation, Madison, Wisconsin), and at least 10 individual clones were sequenced. Statistics All statistical calculations were done using SPSS software (version 12.0; SPSS, Chicago, Illinois). The Student t test and analysis of variance (ANOVA) were used to compare the number of methylated genes between 2 groups and among 3 or more groups, respectively. Both the Student t test and the Mann- Whitney U test were used to compare PMR values of individual genes between 2 groups. Values of P,.05 were considered statistically significant. RESULTS We analyzed 85 gastric mucosal samples, including H pylori negative pediatric samples (n 5 20), H pylori positive pediatric samples (n 5 27), H pylori negative adult samples (n 5 16), and H pylori positive adult samples (n 5 22), for their methylation status at 12 CpG island loci (Figure 1). Cases were arbitrarily considered positive for methylation at a specific CpG island locus if they showed PMR values greater than 4. Inflammatory scores of these 4 groups, based on the updated Sydney system, are summarized in Table 2. Comparison of Results From DNA Methylation Samples That Were Positive and Negative for H pylori The average number of methylated genes was 0.3, 3.4, 0.9, and 7.6 for H pylori negative and H pylori positive 760 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al
3 Figure 1. Map of gene methylation results from Helicobacter pylori2negative (HP 2 ) and H pylori2positive (HP + ) pediatric and adult gastric mucosal tissue samples. Box color represents the degree of methylation. Abbreviation: PMR, percentage of methylated reference. pediatric samples and H pylori2negative and H pylori positive adult samples, respectively (ANOVA, P,.001; Figure 2). The resulting differences in the number of methylated genes were statistically significant between H pylori negative and positive pediatric samples (0.3 versus 3.4, P,.001) and between H pylori negative and positive adult samples (0.9 versus 7.6, P,.001). Methylation levels of the 12 CpG island loci were compared between H pylori negative and positive samples in both pediatric and adult groups. In the pediatric group, 7 CpG island loci (CDH1, DAPK1, CRABP1, GRIN2B, TIMP3, CALCA, and TWIST1) showed significantly higher methylation levels in results from H pylori positive samples than those from H pylori negative samples (all values, P,.05; Table 2. Inflammatory Score Results From Pediatric and Adult Gastric Biopsy Samples Pediatric Gastric Mucosa Samples Positive, No. (%) Negative, No. (%) Adult Gastric Mucosa Samples Positive, No. (%) Negative, No. (%) Neutrophils Absent 1 (3.7) 19 (95.0) 1 (4.5) 14 (87.5) Mild 4 (14.8) 1 (5.0) 2 (9.1) 2 (12.5) Moderate 21 (77.8) 0 16 (72.7) 0 Marked 1 (3.7) 0 3 (13.6) 0 Mononuclear cells Absent Mild 1 (3.7) 19 (95.0) 1 (4.5) 14 (87.5) Moderate 19 (70.4) 1 (5.0) 14 (63.6) 2 (12.5) Marked 7 (25.9) 0 7 (31.8) 0 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 761
4 Figure 2. Comparison of results for the average number of methylated genes between negative (HP 2 ) and H pylori positive (HP + ) pediatric and adult tissue samples. Error bars indicate standard error of the mean. Figure 3. Comparison of results on methylation levels of 12 CpG island loci between negative (HP 2 ) and H pylori positive (HP + ) pediatric tissue samples (A) and adult tissue samples (B). The means and standard error of the mean (error bars) are shown. Abbreviation: PMR, percentage of methylated reference. both Student t test and Mann-Whitney U test; Figure 3, A). Results from NEUROG1 also showed higher methylation levels in H pylori positive samples than in H pylori negative samples, but the difference was of marginal significance Figure 4. Comparison of the results of methylation levels of 12 CpG island loci between negative (HP 2 ) pediatric and adult tissue samples (A) and between H pylori positive (HP + ) pediatric and adult samples (B). The means and standard error of the mean (error bars) are shown. Abbreviation: PMR, percentage of methylated reference. (P 5.07, Student t test; P 5.01, Mann-Whitney U test). Six of these 7 loci (all except for TWIST1) also showed Hpylori associated hypermethylation in the adult group (all values, P,.001). Results from NEUROG1 also showed significantly higher methylation levels in Hpylori positive samples than in H pylori negative samples (P 5.01, Student t test; P,.001, Mann-Whitney U test; Figure 3, B). However, the greater TWIST1 methylation results in association with H pylori infection were marginally significant (P 5.09, Student t test; P 5.002, Mann-Whitney U test). Comparison of DNA Methylation Results Between Pediatric and Adult Gastric Mucosal Samples For H pylori negative samples, the average number of methylated genes was greater in adult gastric mucosa than in pediatric gastric mucosa (0.9 versus 0.3; P 5.04, Student t test). Six loci (DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, and TIMP3) showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.05, both Student t test and Mann-Whitney U test; Figure 4, A). The differences in the number of methylated genes and the methylation levels of individual loci suggest an age-related methylation effect. 762 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al
5 For H pylori positive samples, the average number of methylated genes was greater in adult samples than in pediatric samples (3.4 versus 7.6; P,.001, Student t test). DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, TIMP3, NEUROG1, and SMAD9 showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.01, both Student t test and Mann- Whitney U test; Figure 4, B). The differences in the number of methylated genes and the methylation levels of individual loci may reflect an accumulated effect during the period of H pylori exposure or possibly an age-related methylation effect. To rule out the possibility that increased hypermethylation in adult samples might be related to increased inflammatory cell infiltration, we compared inflammatory scores between H pylori positive pediatric and adult samples; there were no differences in neutrophilic infiltration and mononuclear cell infiltration (P 5.60 and P 5.72, respectively, x 2 test). Bisulfite Genomic Sequencing of CDH1 and TIMP3 Although the MethyLight assay has been evaluated and validated for its precision, 15 we performed bisulfite genomic sequencing of CDH1 and TIMP3 in representative samples to confirm there was a gain of methylation at CpG sites in association with H pylori infection and to determine whether the MethyLight assay accurately reflects the methylation status of these CpG island loci (Figure 5, A and B). We found heavily methylated DNA alleles in samples that had been defined as methylationpositive by the MethyLight assay. COMMENT Samples from pediatric stomach tissues have significant advantages over adult samples when studying aberrant CpG island hypermethylation in association with H pylori infection. For instance, past exposure of the patient to H pylori cannot be completely excluded in adult samples with no visible H pylori as assessed by light microscopic examination, in negative results from the CLO test, and even in negative anti H pylori IgG in serum because the H pylori negative control group may contain individuals who have undergone seroconversion. Pediatric patients are less likely to have undergone seroconversion. In addition, environmental factors 17 particularly alcohol, 18,19 smoking, 19,20 or medications 21 may play confounding roles in the analysis of H pylori related hypermethylation in samples from adult stomach tissues. These factors (except for medication) do not have to be considered in the analysis of pediatric patients. Before this study, we expected that aberrant promoter CpG island hypermethylation would occur in the stomach during childhood because it is well known that H pylori infection is primarily acquired during childhood 11,12 and is closely associated with promoter CpG island hypermethylation in gastric epithelial cells. This study provides evidence to support our notion that promoter CpG island hypermethylation occurs in samples from pediatric stomach tissues in association with H pylori infection. We found that the promoter CpG island loci that were vulnerable to H pylori related hypermethylation were very similar between samples from pediatric and adult stomach tissues. Furthermore, the overall methylation levels in these susceptible CpG island loci were found to be higher in adult samples than in pediatric samples, suggesting that the duration of H pylori exposure may be Figure 5. Genomic structures of CDH1 (A) and TIMP3 (B) and their methylation states in results from pediatric and adult stomach tissue samples. Key: vertical ticks, individual CpG sites; arrow, transcription start site (TSS). Locations of the primers for the MethyLight assay and for the bisulfite genomic sequencing are indicated. Analysis of bisulfite sequencing results identified methylated (closed circle) and unmethylated (open circle) CpG sites within individual alleles in representative tissue samples of H pylori positive (HP + )orhpylori2negative (HP 2 ) samples from pediatric and adult patients. Ten clones were sequenced for each sample. related to the overall higher methylation levels in samples from adult stomach tissues. Sample results from H pylori positive pediatric stomach tissues showed a bimodal distribution of cases in the number of methylated genes per sample, which is in contrast to sample results from H pylori positive adult stomach tissues, which showed a distinct rightward shift toward a higher average number of methylated genes (Figure 6). To exclude the possibility that more genes were methylated in teenage patients (n 5 16) than in younger patients (,10 years old; n 5 11), we compared the average number of methylated genes between these 2 subgroups and observed no difference (3.7 versus 3.2, P 5.66). However, the left-sided group (with fewer methylated genes) was absent in the H pylori positive adult group, which suggests that the left-sided group may shift to become part of the right-sided group with longer exposure to H pylori infection. The bimodal distribution of results from H pylori positive pediatric samples may be Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 763
6 Figure 6. Distribution of the number of methylated genes in results from negative samples (HP 2 ) in pediatric cases, H pylori positive (HP + ) samples in pediatric cases, HP 2 samples in adult cases, and HP + samples in adult cases. explained by the presence of 2 different groups that were heterogeneous in their vulnerability to aberrant CpG island hypermethylation. It is possible that the left-sided group may have genotypes with weaker promoter activities in cytokines, for example, IL1B, than those of the right-sided groups; single nucleotide polymorphism at the 2511 nucleotide of IL1B, which affects its promoter activity, has been demonstrated to be related to differential hypermethylation of some candidate CpG island loci in association with H pylori infection. 22 Age-related hypermethylation, in which methylation of some CpG islands increases with age in tissues without abnormalities, is well known in healthy colon mucosa but is controversial in healthy gastric mucosa. Whereas our previous study using methylation-specific polymerase chain reaction demonstrated age-related hypermethylation in healthy gastric mucosa, 26 Maekita and colleagues 9 reported that there was no age-related hypermethylation in healthy gastric mucosa. Our current study supports the presence of age-related hypermethylation in the gastric mucosa because the number of methylated genes was significantly higher in results from H pylori negative adult samples than it was in results from H pylori negative pediatric samples (0.9 versus 0.3, P 5.04). We also noted differences in the methylation levels of individual loci between results from H pylori negative adult samples and H pylori negative pediatric samples: 6 loci (DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, and TIMP3) showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.05). Although these H pylori negative adult samples were obtained from patients who had negative results from the 3 diagnostic tests, including the serum anti H pylori IgG test, the CLO test, and analysis of Giemsa-stained histologic slides, we cannot completely rule out the possibility that these patients may have undergone seroconversion. Thus, we cannot rule out the possibility of H pylori associated hypermethylation effects in age-related hypermethylation. In conclusion, this study demonstrates for the first time, to our knowledge, that promoter CpG island hypermethylation occurs in pediatric gastric mucosa in association with H pylori infection and that the CpG island loci hypermethylated in association with H pylori infection are similar in adult and pediatric gastric samples. This study was supported by grant M N from the Korea Science and Engineering Foundation, funded by the Ministry of Education, Science and Technology (MEST); by grant from the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the MEST; and by grant from a Priority Research Centers Program through the NRF. References 1. Saxonov S, Berg P, Brutlag DL. A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc Natl Acad Sci U S A. 2006;103(5): Issa JP, Ahuja N, Toyota M, Bronner MP, Brentnall TA. Accelerated agerelated CpG island methylation in ulcerative colitis. Cancer Res. 2001;61(9): Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3(6): Issa JP. CpG-island methylation in aging and cancer. Curr Top Microbiol Immunol. 2000;249: Hahn MA, Hahn T, Lee DH, et al. Methylation of polycomb target genes in intestinal cancer is mediated by inflammation. Cancer Res. 2008;68(24): Kang GH, Shim YH, Jung HY, Kim WH, Ro JY, Rhyu MG. CpG island methylation in premalignant stages of gastric carcinoma. Cancer Res. 2001;61(7): Waki T, Tamura G, Tsuchiya T, Sato K, Nishizuka S, Motoyama T. Promoter methylation status of E-cadherin, hmlh1, and p16 genes in nonneoplastic gastric epithelia. Am J Pathol. 2002;161(2): Chan AO, Lam SK, Wong BC, et al. Promoter methylation of E-cadherin gene in gastric mucosa associated with Helicobacter pylori infection and in gastric cancer. Gut. 2003;52(4): Maekita T, Nakazawa K, Mihara M, et al. High levels of aberrant DNA methylation in infected gastric mucosae and its possible association with gastric cancer risk. Clin Cancer Res. 2006;12(3, pt 1): Qian X, Huang C, Cho CH, Hui WM, Rashid A, Chan AO. E-cadherin promoter hypermethylation induced by interleukin-1b treatment or H pylori infection in human gastric cancer cell lines. Cancer Lett. 2008;263(1): Yamada T, Searle JG, Ahnen D, et al; National Institutes of Health Consensus Development Panel on Helicobacter pylori in Peptic Ulcer Disease. Helicobacter pylori in peptic ulcer disease. JAMA. 1994;272(1): Goodman KJ, Correa P. The transmission of Helicobacter pylori: a critical review of the evidence. Int J Epidemiol. 1995;24(5): Yoo EJ, Park SY, Cho NY, Kim N, Lee HS, Kang GH infection-associated CpG island hypermethylation in the stomach and its possible association with polycomb repressive marks. Virchows Arch. 2008;452(5): Weisenberger DJ, Siegmund KD, Campan M, et al. CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet. 2006;38(7): Ogino S, Kawasaki T, Brahmandam M, et al. Precision and performance characteristics of bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8(2): Ogino S, Cantor M, Kawasaki T, et al. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies. Gut. 2006;55(7): Yuasa Y, Nagasaki H, Akiyama Y, et al. DNA methylation status is inversely correlated with green tea intake and physical activity in gastric cancer patients. Int J Cancer. 2009;124(11): Seitz HK, Stickel F. Molecular mechanisms of alcohol-mediated carcinogenesis. Nat Rev Cancer. 2007;7(8): Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al
7 19. Nan HM, Song YJ, Yun HY, Park JS, Kim H. Effects of dietary intake and genetic factors on hypermethylation of the hmlh1 gene promoter in gastric cancer. World J Gastroenterol. 2005;11(25): Poplawski T, Tomaszewska K, Galicki M, Morawiec Z, Blasiak J. Promoter methylation of cancer-related genes in gastric carcinoma. Exp Oncol. 2008;30(2): Tahara T, Shibata T, Yamashita H, et al. Chronic nonsteroidal antiinflammatory drug (NSAID) use suppresses multiple CpG islands hyper methylation (CIHM) of tumor suppressor genes in the human gastric mucosa. Cancer Sci. 2009;100(7): Chan AO, Chu KM, Huang C, et al. Association between Helicobacter pylori infection and interleukin 1b polymorphism predispose to CpG island methylation in gastric cancer. Gut. 2007;56(4): Issa JP, Ottaviano YL, Celano P, Hamilton SR, Davidson NE, Baylin SB. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat Genet. 1994;7(4): Ahuja N, Li Q, Mohan AL, Baylin SB, Issa JP. Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res. 1998;58(23): Nakagawa H, Nuovo GJ, Zervos EE, et al. Age-related hypermethylation of the 59 region of MLH1 in normal colonic mucosa is associated with microsatellite-unstable colorectal cancer development. Cancer Res. 2001; 61(19): Kang GH, Lee HJ, Hwang KS, Lee S, Kim JH, Kim JS. Aberrant CpG island hypermethylation of chronic gastritis, in relation to aging, gender, intestinal metaplasia, and chronic inflammation. Am J Pathol. 2003;163(4): Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 765
CpG Island Hypermethylation in Gastric Carcinoma and Its Premalignant Lesions
The Korean Journal of Pathology 2012; 46: 1-9 REVIEW CpG Island Hypermethylation in Gastric Carcinoma and Its Premalignant Lesions Gyeong Hoon Kang Department of Pathology, Cancer Research Institute, Seoul
More informationThe Role of the CpG Island Methylator Phenotype on Survival Outcome in Colon Cancer
Gut and Liver, Vol. 9, No. 2, March 215, pp. 22-27 ORiginal Article The Role of the CpG Island Methylator Phenotype on Survival Outcome in Colon Cancer Ki Joo Kang*, Byung-Hoon Min, Kyung Ju Ryu, Kyoung-Mee
More informationG astric carcinogenesis is a multistep process involving
463 HELIOBACTER PYLORI Eradication of Helicobacter pylori infection reverses E-cadherin promoter hypermethylation A O O Chan, J Z Peng, S K Lam, K C Lai, M F Yuen, H K L Cheung, Y L Kwong, A Rashid, C
More informationCpG Island Methylator Phenotype in Primary Gastric Carcinoma
Showa Univ J Med Sci 25 2, 127 132, June 2013 Original CpG Island Methylator Phenotype in Primary Gastric Carcinoma Masayuki TOJO 1, Kazuo KONISHI 1, Yuichiro YANO 1, Atsushi KATAGIRI 1, Hisako NOZAWA
More informationEpigenetic profiling of synchronous colorectal neoplasias by quantitative DNA methylation analysis
& 2006 USCAP, Inc All rights reserved 0893-3952/06 $30.00 www.modernpathology.org Epigenetic profiling of synchronous colorectal neoplasias by quantitative DNA methylation analysis Shuji Ogino 1,2,3, Mohan
More informationT ranscriptional inactivation by cytosine methylation at
1000 GASTROINTESTINAL CANCER CpG island methylator phenotype () of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies S Ogino, M Cantor, T Kawasaki,
More informationDepartment of Pathology, Brigham and Women s Hospital, Harvard Medical School, Boston, MA, USA
& 2008 USCAP, Inc All rights reserved 0893-3952/08 $30.00 www.modernpathology.org CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands,
More informationIndex. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Adherence, to bismuth quadruple therapy, 543 546 Adjuvant therapy, probiotics as, 567 569 Age factors, in gastric cancer, 611 612, 616 AID protein,
More informationSupplementary Information
Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang
More informationGastric atrophy: use of OLGA staging system in practice
Gastroenterology and Hepatology From Bed to Bench. 2016 RIGLD, Research Institute for Gastroenterology and Liver Diseases ORIGINAL ARTICLE Gastric atrophy: use of OLGA staging system in practice Mahsa
More informationEvaluation of Markers for CpG Island Methylator Phenotype (CIMP) in Colorectal Cancer by a Large Population-Based Sample
JMD CME Program Journal of Molecular Diagnostics, Vol. 9, No. 3, July 2007 Copyright American Society for Investigative Pathology and the Association for Molecular Pathology DOI: 10.2353/jmoldx.2007.060170
More informationCpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations
Journal of Molecular Diagnostics, Vol. 8, No. 5, November 2006 Copyright American Society for Investigative Pathology and the Association for Molecular Pathology DOI: 10.2353/jmoldx.2006.060082 CpG Island
More informationNew Approaches for Early Detection of Ulcerative Colitis (UC) Associated Cancer and Surgical Treatment of UC Patients
New Approaches for Early Detection of Ulcerative Colitis (UC) Associated Cancer and Surgical Treatment of UC Patients Toshiaki Watanabe, M.D., Ph.D. Department of Surgery, Teikyo University School of Medicine,
More informationSerrated Polyps and a Classification of Colorectal Cancer
Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram
More informationCpG islands are DNA segments of at least 0.5 kb in size,
Four Molecular Subtypes of Colorectal Cancer and Their Precursor Lesions Gyeong Hoon Kang, MD N Context. In addition to chromosomal instability and microsatellite instability (MSI), a third pathway, epigenetic
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationCarcinogenesis in IBD
Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham
More informationCpG Island Methylation According to the Histologic Patterns of Early Gastric Adenocarcinoma
The Korean Journal of Pathology 211; 45: 469-476 http://dx.doi.org/1.4132/koreanjpathol.211.45.5.469 CpG Island Methylation According to the Histologic Patterns of Early Gastric Adenocarcinoma Junjeong
More informationLynch Syndrome Screening for Endometrial Cancer: Basic Concepts 1/16/2017
1 Hi, my name is Sarah Kerr. I m a pathologist at Mayo Clinic, where I participate in our high volume Lynch syndrome tumor testing practice. Today I hope to cover some of the basics needed to understand
More informationHelicobacter pylori Improved Detection of Helicobacter pylori
DOI:http://dx.doi.org/10.7314/APJCP.2016.17.4.2099 RESEARCH ARTICLE Improved Detection of Helicobacter pylori Infection and Premalignant Gastric Mucosa Using Conventional White Light Source Gastroscopy
More informationAberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer
Aberrant DNA methylation of MGMT and hmlh1 genes in prediction of gastric cancer J. Jin 1,2, L. Xie 2, C.H. Xie 1 and Y.F. Zhou 1 1 Department of Radiation & Medical Oncology, Zhongnan Hospital of Wuhan
More informationAssociation of Helicobacter pylori infection with Atrophic gastritis in patients with Dyspepsia
ADVANCES IN BIORESEARCH Adv. Biores., Vol 8 [3] May 2017: 137-141 2017 Society of Education, India Print ISSN 0976-4585; Online ISSN 2277-1573 Journal s URL:http://www.soeagra.com/abr.html CODEN: ABRDC3
More informationRisk Factors for Gastric Tumorigenesis in Underlying Gastric Mucosal Atrophy
Gut and Liver, Vol. 11, No. 5, September 2017, pp. 612-619 ORiginal Article Risk Factors for Gastric Tumorigenesis in Underlying Gastric Mucosal Atrophy Ji Hyun Song 1, Sang Gyun Kim 2, Eun Hyo Jin 1,
More informationThe silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
More informationHelicobacter pylori Is Associated with mir-133a Expression through Promoter Methylation in Gastric Carcinogenesis
Gut and Liver, Vol., No. 1, January 1, pp. 5- ORiginal Article Helicobacter pylori Is Associated with mir-133a Expression through Promoter Methylation in Gastric Carcinogenesis Joo Hyun Lim 1,, Sang Gyun
More informationEndoscopic atrophic classification before and after H. pylori eradication is closely associated with histological atrophy and intestinal metaplasia
E311 before and after H. pylori eradication is closely associated with histological atrophy and intestinal metaplasia Authors Institution Masaaki Kodama, Tadayoshi Okimoto, Ryo Ogawa, Kazuhiro Mizukami,
More informationHLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER
HLA TYPING AND EXPRESSION: POTENTIAL MARKER FOR IDENTIFYING EARLY DYSPLASIA AND STRATIFYING THE RISK FOR IBD-CANCER Megan Garrity, S. Breanndan Moore, M.D., William Sandborn, M.D., Vernon Pankratz, Ph.D.,
More informationLong-Term Effects of Helicobacter pylori Eradication on Metachronous Gastric Cancer Development
Gut and Liver, Vol. 12, No. 2, March 218, pp. 133-141 ORiginal Article Long-Term ffects of Helicobacter pylori radication on Metachronous Gastric Cancer Development Seung Jun Han 1, Sang Gyun Kim 1, Joo
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationClinical and Pathological Significance of Epigenomic Changes in Colorectal Cancer
Clinical and Pathological Significance of Epigenomic Changes in Colorectal Cancer Shuji Ogino, M.D., Ph.D. Associate Professor of Pathology Harvard Medical School Brigham and Women s Hospital Dana-Farber
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationMicrosatellite Instability and Mismatch Repair Protein (hmlh1, hmsh2) Expression in Intrahepatic Cholangiocarcinoma
The Korean Journal of Pathology 2005; 39: 9-14 Microsatellite Instability and Mismatch Repair Protein (hmlh1, hmsh2) Expression in Intrahepatic Cholangiocarcinoma Yun Kyung Kang Woo Ho Kim 1 Department
More informationCorrelation between Gastric Mucosal Morphologic Patterns and Histopathological Severity of
Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 808505, 7 pages http://dx.doi.org/10.1155/2015/808505 Research Article Correlation between Gastric Mucosal Morphologic
More informationp16, an inhibitor of the cyclin D-dependent protein
0023-6837/00/8005-689$03.00/0 LABORATORY INVESTIGATION Vol. 80, No. 5, p. 689, 2000 Copyright 2000 by The United States and Canadian Academy of Pathology, Inc. Printed in U.S.A. Correlation of p16 Hypermethylation
More informationRegression of Advanced Gastric MALT Lymphoma after the Eradication of Helicobacter pylori
Gut and Liver, Vol. 6, No. 2, April 2012, pp. 270-274 CASE REPORT Regression of Advanced Gastric MALT Lymphoma after the Eradication of Helicobacter pylori Soo-Kyung Park, Hwoon-Yong Jung, Do Hoon Kim,
More informationAssociation between common genetic variants in pre-micrornas and the clinicopathological characteristics and survival of gastric cancer patients
Experimental and Therapeutic Medicine 1: 1035-1040, 2010 Association between common genetic variants in pre-micrornas and the clinicopathological characteristics and survival of gastric cancer patients
More informationCommentary. Quantitative DNA Methylation Analysis. The Promise of High-Throughput Epigenomic Diagnostic Testing in Human Neoplastic Disease
JMD CME Program Commentary Journal of Molecular Diagnostics, Vol. 8, No. 2, May 2006 Copyright American Society for Investigative Pathology and the Association for Molecular Pathology DOI: 10.2353/jmoldx.2006.060026
More informationRates of clarithromycin resistance in Helicobacter pylori sampled from healthy subjects in Cheonan, Korea
Rates of clarithromycin resistance in Helicobacter pylori sampled from healthy subjects in Cheonan, Korea Young Sam Yuk 1, Ga-Yeon Kim 2 1. Department of Biomedical Laboratory Science, Dankook University
More informationImmunoglobulin G Antibody against Helicobacter pylori: Clinical Implications of Levels Found in Serum
CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, Sept. 2002, p. 1044 1048 Vol. 9, No. 5 1071-412X/02/$04.00 0 DOI: 10.1128/CDLI.9.5.1044 1048.2002 Copyright 2002, American Society for Microbiology. All Rights
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationCorrelation Between Endoscopic and Histological Findings in Different Gastroduodenal Lesion and its Association with Helicobacter Pylori
ORIGINAL ARTICLE Correlation Between Endoscopic and Histological Findings in Different Gastroduodenal Lesion and its Association with Helicobacter Pylori *A. Sultana 1, SM Badruddoza 2, F Rahman 3 1 Dr.
More informationHelicobacter pylori:an Emerging Pathogen
Bacteriology at UW-Madison Bacteriology 330 Home Page Helicobacter pylori:an Emerging Pathogen by Karrie Holston, Department of Bacteriology University of Wisconsin-Madison Description of Helicobacter
More informationSessile Serrated Polyps
Årsmøtet i Den norske Patologforening 2014 Sessile Serrated Polyps Tor J. Eide Oslo Universitetssykehus The term serrated include a group of lesions with a sawtoothlike appearance of the crypts and the
More informationThe Association of CagA + Helicobacter pylori Infection and Gastric Carcinoma
The Association of CagA + Helicobacter pylori Infection and Gastric Carcinoma PRESENTER: Dr. Md. Khalilur Rahman Student of M.D.(Internal Medicine) Sylhet MAG Osmani Medical College Gastric Cancer- ranked
More informationAberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of PHD3 in a Diverse Set of Malignant Cells Abstract The prolyl-hydroxylase domain family of enzymes (PHD1-3) plays an important
More informationTriple therapy versus sequential therapy for the first-line Helicobacter pylori eradication
Chang et al. BMC Gastroenterology (2017) 17:16 DOI 10.1186/s12876-017-0579-8 RESEARCH ARTICLE Open Access Triple therapy versus sequential therapy for the first-line Helicobacter pylori eradication Ji
More informationBRAF Testing In The Elderly: Same As in Younger Patients?
EGFR, K-RAS, K BRAF Testing In The Elderly: Same As in Younger Patients? Nadine Jackson McCleary MD MPH Gastrointestinal Oncology Dana-Farber/Harvard Cancer Care Boston, MA, USA Outline Colorectal cancer
More informationComparative study of invasive methods for diagnosis of Helicobacter pylori in humans
ISSN: 2319-7706 Volume 2 Number 7 (2013) pp. 63-68 http://www.ijcmas.com Original Research Article Comparative study of invasive methods for diagnosis of Helicobacter pylori in humans V.Subbukesavaraja
More informationChapter 5. Gazzoli I, Loda M, Garber J, Syngal S and Kolodner RD. Cancer Research 2002 Jul 15; 62(14):
Chapter 5 A hereditary nonpolyposis colorectal carcinoma case associated with hypermethylation of the MLH1 gene in normal tissue and loss of heterozygosity of the unmethylated allele in the resulting microsatellite
More informationClinicopathologic Characteristics of Left-Sided Colon Cancers with High Microsatellite Instability
The Korean Journal of Pathology 29; 43: 428-34 DOI: 1.4132/KoreanJPathol.29.43.5.428 Clinicopathologic Characteristics of Left-Sided Colon Cancers with High Microsatellite Instability Sang Kyum Kim Junjeong
More informationHelicobacter and gastritis
1 Helicobacter and gastritis Dr. Hala Al Daghistani Helicobacter pylori is a spiral-shaped gram-negative rod. H. pylori is associated with antral gastritis, duodenal (peptic) ulcer disease, gastric ulcers,
More informationThe Nobel Prize in Physiology or Medicine for 2005
The Nobel Prize in Physiology or Medicine for 2005 jointly to Barry J. Marshall and J. Robin Warren for their discovery of "the bacterium Helicobacter pylori and its role in gastritis and peptic ulcer
More informationAssociation between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
More informationNew developments in pathogenesis, gastric cancer. Matthias Ebert. II. Medizinische Klinik Klinikum rechts der Isar TU München
New developments in pathogenesis, diagnosis, therapy and prevention of gastric cancer Matthias Ebert II. Medizinische Klinik Klinikum rechts der Isar TU München Gastric Cancer Pathogenesis Diagnosis Treatment
More informationNIH Public Access Author Manuscript Gastroenterology. Author manuscript; available in PMC 2009 June 1.
NIH Public Access Author Manuscript Published in final edited form as: Gastroenterology. 2008 June ; 134(7): 1950 1960.e1. doi:10.1053/j.gastro.2008.02.094. Mutations in both KRAS and BRAF may contribute
More informationOriginal Article Frequent CpG island methylation: a risk factor in the progression of traditional serrated adenoma of the colorectum
Int J Clin Exp Pathol 2017;10(9):9666-9674 www.ijcep.com /ISSN:1936-2625/IJCEP0045970 Original Article Frequent CpG island methylation: a risk factor in the progression of traditional serrated adenoma
More informationDNA methylation in the ARG-NOS pathway is associated with exhaled nitric oxide in asthmatic children
DNA methylation in the ARG-NOS pathway is associated with exhaled nitric oxide in asthmatic children Carrie V. Breton, ScD, Hyang-Min Byun, PhD, Xinhui Wang, MS, Muhammad T. Salam, MBBS, PhD, Kim Siegmund,
More informationThe relationship between Helicobacter pylori infection and promoter polymorphism of the Nrf2 gene in chronic gastritis
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 19: 143-148, 2007 143 The relationship between Helicobacter pylori infection and promoter polymorphism of the Nrf2 gene in chronic gastritis TOMIYASU ARISAWA,
More informationDisappearance of Serum Methylated p16 Indicates Longer Survival in Patients with Gastric Cancer
J Gastric Cancer 2013;13(3):157-163 http://dx.doi.org/10.5230/jgc.2013.13.3.157 Original Article Disappearance of Serum Methylated p16 Indicates Longer Survival in Patients with Gastric Cancer Han-Ki Lim,
More informationMutations in Both KRAS and BRAF May Contribute to the Methylator Phenotype in Colon Cancer
GASTROENTEROLOGY 2008;34:950 960 Mutations in Both KRAS and BRAF May Contribute to the Methylator Phenotype in Colon Cancer TAKESHI NAGASAKA,* MINORU KOI,* MATTHIAS KLOOR, JOHANNES GEBERT, ALEX VILKIN,*
More informationLink between Serum Pepsinogen Concentrations and Upper Gastrointestinal Endoscopic Findings
ORIGINAL ARTICLE Gastroenterology & Hepatology https://doi.org/10.3346/jkms.2017.32.5.796 J Korean Med Sci 2017; 32: 796-802 Link between Serum Pepsinogen Concentrations and Upper Gastrointestinal Endoscopic
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationOriginal Policy Date
MP 2.04.38 Genetic Testing for Helicobacter pylori Treatment Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013 Return
More informationA COMPARATIVE STUDY BETWEEN IMMUNOHISTOCHEMISTRY, HEMATOXYLIN & EOSIN AND GEIMSA STAIN FOR HELICOBACTER PYLORI DETECTION IN CHRONIC GASTRITIS
Original Research Article Pathology International Journal of Pharma and Bio Sciences ISSN 0975-6299 A COMPARATIVE STUDY BETWEEN IMMUNOHISTOCHEMISTRY, HEMATOXYLIN & EOSIN AND GEIMSA STAIN FOR HELICOBACTER
More informationPERSPECTIVES. CpG island methylator phenotype in cancer. Jean-Pierre Issa
OPINION CpG island methylator phenotype in cancer Jean-Pierre Issa Abstract DNA hypermethylation in CpG-rich promoters is now recognized as a common feature of human neoplasia. However, the pathophysiology
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationBiology of cancer development in the GI tract
1 Genesis and progression of GI cancer a genetic disease Colorectal cancer Fearon and Vogelstein proposed a genetic model to explain the stepwise formation of colorectal cancer (CRC) from normal colonic
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationPrognostic analysis of gastric mucosal dysplasia after endoscopic resection: A single-center retrospective study
JBUON 2019; 24(2): 679-685 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Prognostic analysis of gastric mucosal dysplasia after endoscopic resection:
More informationCAP Laboratory Improvement Programs. Summary of Microsatellite Instability Test Results From Laboratories Participating in Proficiency Surveys
CAP Laboratory Improvement Programs Summary of Microsatellite Instability Test Results From Laboratories Participating in Proficiency Surveys Proficiency Survey Results From 2005 to 2012 Theresa A. Boyle,
More informationChanges in the seroprevalence of IgG anti-hepatitis A virus between 2001 and 2013: experience at a single center in Korea
pissn 2287-2728 eissn 2287-285X Original Article Clinical and Molecular Hepatology 214;2:162-167 Changes in the seroprevalence of IgG anti-hepatitis A virus between 21 and 213: experience at a single center
More informationThe association between CDH1 promoter methylation and patients with ovarian cancer: a systematic meta-analysis
Wang et al. Journal of Ovarian Research (2016) 9:23 DOI 10.1186/s13048-016-0231-1 RESEARCH The association between CDH1 promoter methylation and patients with ovarian cancer: a systematic meta-analysis
More informationThe effect of proton pump inhibitors on the gastric mucosal microenvironment
Original papers The effect of proton pump inhibitors on the gastric mucosal microenvironment Yen-Chun Peng,,, A F, Lan-Ru Huang, A, C, E, Hui-Ching Ho, C, Chi-Sen Chang, C, E, Shou-Wu Lee, E, Ching-Chang
More informationSynchronous and Subsequent Lesions of Serrated Adenomas and Tubular Adenomas of the Colorectum
Tsumura T, et al 1 Synchronous and Subsequent Lesions of Serrated Adenomas and Tubular Adenomas of the Colorectum T. Tsumura a T. Hiyama d S. Tanaka b M. Yoshihara d K. Arihiro c K. Chayama a Departments
More informationEndocrine Surgery. Characteristics of the Germline MEN1 Mutations in Korea: A Literature Review ORIGINAL ARTICLE. The Korean Journal of INTRODUCTION
ORIGINAL ARTICLE ISSN 1598-1703 (Print) ISSN 2287-6782 (Online) Korean J Endocrine Surg 2014;14:7-11 The Korean Journal of Endocrine Surgery Characteristics of the Germline MEN1 Mutations in Korea: A Literature
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationPrevalence of Helicobacter pylori in Patients with End Stage Renal Disease
2000;20:97-102 Helicobacter pylori Prevalence of Helicobacter pylori in Patients with End Stage Renal Disease Do Ha Kim, M.D., Hwoon-Yong Jung, M.D., Suk-Kyun Yang, M.D. Weon-Seon Hong, M.D. and Young
More informationCyclooxygenase-2 Expression in Gastric Antral Mucosa Before and After Eradication of Helicobacter pylori Infection
THE AMERICAN JOURNAL OF GASTROENTEROLOGY Vol. 94, No. 5, 1999 1999 by Am. Coll. of Gastroenterology ISSN 0002-9270/99/$20.00 Published by Elsevier Science Inc. PII S0002-9270(99)00126-4 Cyclooxygenase-2
More informationHuman Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop
Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Jan 7 th and 8 th, 2014 Brigitte Gomperts, MD University of California, Los Angeles Lung Structure and Function Airway Epithelial
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationUtility of In House made Rapid Urease Broth Test for Detection of Helicobacter pylori Infection in Resource Constraint Settings
Original article: Utility of In House made Rapid Urease Broth Test for Detection of Helicobacter pylori Infection in Resource Constraint Settings 1.Dr. Swati Rahul Dhope, 2. Dr. Sachinkumar Vasantrao Wankhede
More informationColon Cancer and Hereditary Cancer Syndromes
Colon Cancer and Hereditary Cancer Syndromes Gisela Keller Institute of Pathology Technische Universität München gisela.keller@lrz.tum.de Colon Cancer and Hereditary Cancer Syndromes epidemiology models
More informationColon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP
Colon cancer: practical molecular diagnostics Wade S. Samowitz, M.D. University of Utah and ARUP Disclosure Dr. Samowitz may receive royalties in the future related to the Ventana BRAF V600E antibody.
More information594 Lewin, Weinstein, and Riddell s Gastrointestinal Pathology and Its Clinical Implications
594 Lewin, Weinstein, and Riddell s Gastrointestinal Pathology and Its Clinical Implications Figure 13-20. Stages in the natural history of H. pylori. Biopsies from the antrum are on the left and the oxyntic
More informationEPIGENETIC SILENCING OF MLH1 AND p16 INK AND THEIR RELATION TO CERTAIN CLINICO- PATHOLOGICAL FEATURES IN PATIENTS WITH COLORECTAL CANCER
Journal of IMAB - Annual Proceeding (Scientific Papers) 2007, vol. 13, book 1 EPIGENETIC SILENCING OF MLH1 AND p16 INK AND THEIR RELATION TO CERTAIN CLINICO- PATHOLOGICAL FEATURES IN PATIENTS WITH COLORECTAL
More informationDynamic Changes in Helicobacter pylori Status Following Gastric Cancer Surgery
Gut and Liver, Vol. 11, No. 2, March 2017, pp. 209-215 ORiginal Article Dynamic Changes in Helicobacter pylori Status Following Gastric Cancer Surgery Kichul Yoon 1,2, Nayoung Kim 1,3, Jaeyeon Kim 3, Jung
More informationIntroduction. Original articles. Nicolás Rocha, 1 Sandra Huertas, 2 Rosario Albis, 3 Diego Aponte, 4 Luis Carlos Sabbagh. 5
Original articles Correlation of endoscopic and histological findings in diagnosis of gastrointestinal metaplasia in patients referred to the Clinica Colombia for upper endoscopies Nicolás Rocha, 1 Sandra
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationTitle: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study
Author's response to reviews Title: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study Authors: Bernd Frank (b.frank@dkfz.de) Heiko Müller (h.mueller@dkfz.de) Melanie
More informationHelicobacter pylori Infection and Risk of Gastric Cancer in Korea: A Quantitative Systematic Review
Review J Prev Med Public Health 2016;49:197-204 http://dx.doi.org/10.3961/jpmph.16.024 pissn 1975-8375 eissn 2233-4521 Journal of Preventive Medicine & Public Health Helicobacter pylori Infection and Risk
More informationMicrosatellite instability and other molecular markers: how useful are they?
Microsatellite instability and other molecular markers: how useful are they? Pr Frédéric Bibeau, MD, PhD Head, Pathology department CHU de Caen, Normandy University, France ESMO preceptorship, Barcelona,
More informationTitle:DNA Methylation Subgroups and the CpG Island Methylator Phenotype in Gastric Cancer: A Comprehensive Profiling Approach
Author's response to reviews Title:DNA Methylation Subgroups and the CpG Island Methylator Phenotype in Gastric Cancer: A Comprehensive Profiling Approach Authors: Marie Loh (m.loh@imperial.ac.uk) Natalia
More informationOriginal Article General Laboratory Medicine INTRODUCTION
Original Article General Laboratory Medicine Ann Lab Med 2018;38:249-254 https://doi.org/10.3343/alm.2018.38.3.249 ISSN 2234-3806 eissn 2234-3814 Budget Impact of the Accreditation Program for Clinical
More informationExploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies
Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Disclosures MDxHealth Scientific Advisor 2 Case Study 54-year-old man referred for a PSA of 7 - Healthy, minimal
More informationOverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
More informationANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE.
ANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE. Batalla A, Coto E*, González-Lara L, González- Fernández D, Maldonado-Seral C, García-García
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More information