Aberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection

Transcription

1 Aberrant CpG Island Hypermethylation in Pediatric Gastric Mucosa in Association With Helicobacter pylori Infection So-Hyun Shin, MSc; Seog-Yun Park, MD; Jae-Sung Ko, MD; Nayoung Kim, MD; Gyeong Hoon Kang, MD N Context. Helicobacter pylori infection is primarily acquired during childhood and persists throughout life in the absence of eradication with antibiotics. Helicobacter pylori infection induces methylation in the promoter CpG island loci in gastric epithelial cells. Thus, aberrant CpG island hypermethylation in gastric epithelial cells likely occurs early in life, although there are no existing data supporting this notion. Objectives. To identify whether aberrant CpG island hypermethylation occurs in pediatric stomach mucosa in association with H pylori infection and to compare methylation profiles of samples from pediatric and adult stomach tissues. Design. We analyzed pediatric (n = 47) and adult (n = 38) gastric mucosa samples for their methylation status in 12 promoter CpG island loci using the MethyLight assay and compared the number of methylated genes and the methylation levels in individual genes between H pylori positive and H pylori negative sample results and between pediatric and adult samples. Results. The average number of methylated genes was significantly higher in H pylori infected pediatric samples than in H pylori negative pediatric samples (3.4 versus 0.3, P,.001) and in H pylori infected adult samples than in H pylori negative adult samples (7.6 versus 0.9, P,.001). Seven genes showed significantly higher methylation levels in H pylori infected pediatric samples than in H pylori negative pediatric samples (all values were P,.05). Conclusions. These results indicate that CpG island hypermethylation occurs in pediatric gastric mucosa in association with H pylori infection and that the genes affected by H pylori associated hypermethylation were similar in pediatric and adult samples. (Arch Pathol Lab Med. 2011;135: ) CpG islands are CpG-rich DNA sequences that are found in the promoters and 59 exon sequences of approximately 60% to 70% of human genes. 1 In association with tumorigenesis, promoter CpG islands can undergo hypermethylation, which is an alternative to mutations that inactivate tumor suppressor genes or tumor-related genes. Promoter CpG island hypermethylation is found in virtually all types of human cancers and is recognized as an important mechanism of tumorigenesis. Although promoter CpG islands were traditionally thought to be protected from aberrant hypermethylation in healthy cells (except in imprinting genes or genes on inactive X chromosomes), promoter CpG island hypermethylation is now known to occur in healthy cells during aging and chronic persistent inflammation. 2 5 Accepted for publication July 20, From the Laboratory of Epigenetics, Cancer Research Institute (Ms Shin), the Department of Pediatrics (Dr Ko), the Department of Internal Medicine and Liver Research Institute (Dr Kim), and the Department of Pathology and Cancer Research Institute (Dr Kang), Seoul National University College of Medicine, Seoul, Korea; and the Department of Pathology, National Cancer Center, Goyang, Korea (Dr Park). The authors have no relevant financial interest in the products or companies described in this article. Reprints: Gyeong Hoon Kang, MD, Department of Pathology, Seoul National University College of Medicine, 28 Yongon-Dong, Chongno- Gu, Seoul , Korea ( ghkang@snu.ac.kr). Promoter CpG island hypermethylation occurs frequently in healthy epithelial cells of the stomach. 6,7 There is considerable evidence supporting the role of Helicobacter pylori infection in the induction of promoter CpG island hypermethylation in normal gastric epithelial cells Although H pylori infection is prevalent in the adult population, it is acquired during childhood and persists through adulthood in the absence of treatment with antibiotics. 11,12 Thus, it is likely that aberrant CpG island hypermethylation, which is frequently found in the H pylori infected adult stomach, is also acquired early in life. However, no information is available in the literature, to our knowledge, regarding the acquisition of CpG island hypermethylation in association with H pylori infection in pediatric stomach tissues. In this study, we analyzed the methylation status of pediatric and adult gastric stomach tissues at 12 CpG island loci that are frequently hypermethylated in the stomach in association with H pylori and/or cancer 13 and compared both the methylation levels and the frequency of methylation at individual loci in relation to Hpyloriinfection status and age. The aim of our study was to identify whether aberrant hypermethylation of promoter CpG islands occurs in pediatric gastric mucosal tissues and whether the acquisition of promoter CpG island hypermethylation is related to H pylori infection. Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 759

2 Table 1. MATERIALS AND METHODS Patients and Tissues A total of 135 pediatric patients who visited Seoul National University Children s Hospital, Seoul, Korea, for gastroscopy between February 2005 and January 2008 were enrolled in the study. Two biopsy samples were taken from the greater curvature of the antrum and from the body of the stomach. One sample from each site was fixed in neutral-buffered formalin solution and processed for hematoxylin-eosin staining and modified-giemsa staining for histologic evaluation and assessment of H pylori infection, respectively. A rapid urease test (Campylobacter-like organism [CLO] test; Delta West Pty Ltd, Bentley, Australia) was performed on the remaining specimen from each site and monitored for up to 24 hours. All pediatric case results that were positive for H pylori were included in the methylation study because of their rarity, and age- and gendermatched case results that were negative for H pylori were selected accordingly: H pylori positive pediatric samples (male to female ratio, 16:11; average age, 10 years; range, 4 18 years); and H pylori negative pediatric samples (male to female ratio, 12:8; average age, 9 years; range, 4 17 years). Cases showing intestinal metaplasia were excluded from the study because metaplastic epithelial cells are known to harbor hypermethylation of multiple CpG island loci regardless of H pylori infection. Thus, of 135 pediatric patients, a total of 47 tissue samples (47 pediatric patients) were included in the methylation analysis. Archival samples of stomach biopsy tissues from adult patients (n 5 38) enrolled in a previous study were included in this study: H pylori negative adult samples (male to female ratio, 10:6; average age, 55 years; range, years); and H pylori positive samples (male to female ratio, 13:9; average age, 56 years; range, years). These patients had been evaluated previously for H pylori infection status using 3 tests: serum anti H pylori immunoglobulin G (IgG) levels, tissue CLO test, and Giemsa staining of histologic slides. Adults with negative test results from all 3 tests were regarded as being negative for H pylori. For pediatric samples, the serum anti H pylori IgG test was not performed, and patients with positive results from the CLO test or from analysis of their Giemsa-staining results were considered positive for H pylori. The Ethics Committee of the Seoul National University Hospital approved the protocol, and prior written consent was obtained from all participating patients or their parents or guardians. Bisulfite Modification Sixteen archival tissue sections (4 mm thick) were stained with hematoxylin-eosin. Using knife blades, stained tissue sections were scraped, placed into microtubes, and digested in lysis buffer containing proteinase K. Bisulfite modification of the digested tissue samples (18 ml) was performed using the EZ DNA methylation kit (Zymo Research Co, Orange, California). MethyLight Assay From 25 DNA methylation markers that had been examined for their methylation status in nonneoplastic gastric mucosa and in gastric cancer in a previous study, 13 we selected 7 markers showing H pylori2associated hypermethylation (CALCA, CDH1, CRABP1, CYP1B1, DAPK1, GRIN2B, TWIST1) and 5 additional markers displaying cancer-associated hypermethylation (HOXA1, NEUROG1, NR3C1, SMAD9, TIMP3). The oligonucleotide sequences of the primers and the probes used have been Primers for Bisulfite Genomic Sequencing Gene Forward Primer (59 to 39) Reverse Primer (59 to 39) T m, uc Product, bp CDH1 TTTTAGTAATTTTAGGTTAGAGGGTTAT CAAACTCACAAATACTTTACAATTCC TIMP3 TTTGTTTTTTTAGTTTTTGTTTTTT ATCCCCCAAACTCCAACTACC Step-down PCR (60 to 54) 300 Abbreviations: bp, base pair; PCR, polymerase chain reaction; T m, melting temperature. described. 14 Briefly, 2 sets of primers and probes designed to bind specifically to bisulfite-converted DNA were used in each reaction: One set of primers and a probe were used for every methylated target to be analyzed (methylated reaction), and another pair of primers and a probe were used as the reference locus (ALU, normalization control reaction). The normalization control reactions were methylation-independent measurements to control for DNA amplification and to normalize input DNA. M.SssI-treated, placental genomic DNA was used as a reference sample for complete methylation to determine the percentage of methylated reference (PMR) at a particular locus. The PMR was defined as (methylated reaction/normalization control reaction) sample /(methylated reaction/normalization control reaction) M.SssI. We considered a CpG island locus to be methylated if the PMR value was greater than 4. Our rationale was that samples with PMR values less than 4 are not substantially methylated, and the PMR cutoff value of 4 has been validated by previous studies based on the distribution of PMR values in the tested CpG island loci, and correlation of protein expression loss with methylation positivity in CDKN2A, MLH1, and MGMT is determined by the PMR cutoff value of 4. 15,16 Bisulfite Genomic Sequencing The CpG island DNA methylation status was determined by polymerase chain reaction analysis after bisulfite modification and was followed by bisulfite genomic sequencing. All bisulfite genomic sequencing primers were designed so that the amplified segments included extra bases in both upstream and downstream regions of the segment amplified by the MethyLight primer set. Primer sequences are shown in Table 1. Polymerase chain reaction products were cloned into the pgem-t Easy vector (Promega Corporation, Madison, Wisconsin), and at least 10 individual clones were sequenced. Statistics All statistical calculations were done using SPSS software (version 12.0; SPSS, Chicago, Illinois). The Student t test and analysis of variance (ANOVA) were used to compare the number of methylated genes between 2 groups and among 3 or more groups, respectively. Both the Student t test and the Mann- Whitney U test were used to compare PMR values of individual genes between 2 groups. Values of P,.05 were considered statistically significant. RESULTS We analyzed 85 gastric mucosal samples, including H pylori negative pediatric samples (n 5 20), H pylori positive pediatric samples (n 5 27), H pylori negative adult samples (n 5 16), and H pylori positive adult samples (n 5 22), for their methylation status at 12 CpG island loci (Figure 1). Cases were arbitrarily considered positive for methylation at a specific CpG island locus if they showed PMR values greater than 4. Inflammatory scores of these 4 groups, based on the updated Sydney system, are summarized in Table 2. Comparison of Results From DNA Methylation Samples That Were Positive and Negative for H pylori The average number of methylated genes was 0.3, 3.4, 0.9, and 7.6 for H pylori negative and H pylori positive 760 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al

3 Figure 1. Map of gene methylation results from Helicobacter pylori2negative (HP 2 ) and H pylori2positive (HP + ) pediatric and adult gastric mucosal tissue samples. Box color represents the degree of methylation. Abbreviation: PMR, percentage of methylated reference. pediatric samples and H pylori2negative and H pylori positive adult samples, respectively (ANOVA, P,.001; Figure 2). The resulting differences in the number of methylated genes were statistically significant between H pylori negative and positive pediatric samples (0.3 versus 3.4, P,.001) and between H pylori negative and positive adult samples (0.9 versus 7.6, P,.001). Methylation levels of the 12 CpG island loci were compared between H pylori negative and positive samples in both pediatric and adult groups. In the pediatric group, 7 CpG island loci (CDH1, DAPK1, CRABP1, GRIN2B, TIMP3, CALCA, and TWIST1) showed significantly higher methylation levels in results from H pylori positive samples than those from H pylori negative samples (all values, P,.05; Table 2. Inflammatory Score Results From Pediatric and Adult Gastric Biopsy Samples Pediatric Gastric Mucosa Samples Positive, No. (%) Negative, No. (%) Adult Gastric Mucosa Samples Positive, No. (%) Negative, No. (%) Neutrophils Absent 1 (3.7) 19 (95.0) 1 (4.5) 14 (87.5) Mild 4 (14.8) 1 (5.0) 2 (9.1) 2 (12.5) Moderate 21 (77.8) 0 16 (72.7) 0 Marked 1 (3.7) 0 3 (13.6) 0 Mononuclear cells Absent Mild 1 (3.7) 19 (95.0) 1 (4.5) 14 (87.5) Moderate 19 (70.4) 1 (5.0) 14 (63.6) 2 (12.5) Marked 7 (25.9) 0 7 (31.8) 0 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 761

4 Figure 2. Comparison of results for the average number of methylated genes between negative (HP 2 ) and H pylori positive (HP + ) pediatric and adult tissue samples. Error bars indicate standard error of the mean. Figure 3. Comparison of results on methylation levels of 12 CpG island loci between negative (HP 2 ) and H pylori positive (HP + ) pediatric tissue samples (A) and adult tissue samples (B). The means and standard error of the mean (error bars) are shown. Abbreviation: PMR, percentage of methylated reference. both Student t test and Mann-Whitney U test; Figure 3, A). Results from NEUROG1 also showed higher methylation levels in H pylori positive samples than in H pylori negative samples, but the difference was of marginal significance Figure 4. Comparison of the results of methylation levels of 12 CpG island loci between negative (HP 2 ) pediatric and adult tissue samples (A) and between H pylori positive (HP + ) pediatric and adult samples (B). The means and standard error of the mean (error bars) are shown. Abbreviation: PMR, percentage of methylated reference. (P 5.07, Student t test; P 5.01, Mann-Whitney U test). Six of these 7 loci (all except for TWIST1) also showed Hpylori associated hypermethylation in the adult group (all values, P,.001). Results from NEUROG1 also showed significantly higher methylation levels in Hpylori positive samples than in H pylori negative samples (P 5.01, Student t test; P,.001, Mann-Whitney U test; Figure 3, B). However, the greater TWIST1 methylation results in association with H pylori infection were marginally significant (P 5.09, Student t test; P 5.002, Mann-Whitney U test). Comparison of DNA Methylation Results Between Pediatric and Adult Gastric Mucosal Samples For H pylori negative samples, the average number of methylated genes was greater in adult gastric mucosa than in pediatric gastric mucosa (0.9 versus 0.3; P 5.04, Student t test). Six loci (DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, and TIMP3) showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.05, both Student t test and Mann-Whitney U test; Figure 4, A). The differences in the number of methylated genes and the methylation levels of individual loci suggest an age-related methylation effect. 762 Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al

5 For H pylori positive samples, the average number of methylated genes was greater in adult samples than in pediatric samples (3.4 versus 7.6; P,.001, Student t test). DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, TIMP3, NEUROG1, and SMAD9 showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.01, both Student t test and Mann- Whitney U test; Figure 4, B). The differences in the number of methylated genes and the methylation levels of individual loci may reflect an accumulated effect during the period of H pylori exposure or possibly an age-related methylation effect. To rule out the possibility that increased hypermethylation in adult samples might be related to increased inflammatory cell infiltration, we compared inflammatory scores between H pylori positive pediatric and adult samples; there were no differences in neutrophilic infiltration and mononuclear cell infiltration (P 5.60 and P 5.72, respectively, x 2 test). Bisulfite Genomic Sequencing of CDH1 and TIMP3 Although the MethyLight assay has been evaluated and validated for its precision, 15 we performed bisulfite genomic sequencing of CDH1 and TIMP3 in representative samples to confirm there was a gain of methylation at CpG sites in association with H pylori infection and to determine whether the MethyLight assay accurately reflects the methylation status of these CpG island loci (Figure 5, A and B). We found heavily methylated DNA alleles in samples that had been defined as methylationpositive by the MethyLight assay. COMMENT Samples from pediatric stomach tissues have significant advantages over adult samples when studying aberrant CpG island hypermethylation in association with H pylori infection. For instance, past exposure of the patient to H pylori cannot be completely excluded in adult samples with no visible H pylori as assessed by light microscopic examination, in negative results from the CLO test, and even in negative anti H pylori IgG in serum because the H pylori negative control group may contain individuals who have undergone seroconversion. Pediatric patients are less likely to have undergone seroconversion. In addition, environmental factors 17 particularly alcohol, 18,19 smoking, 19,20 or medications 21 may play confounding roles in the analysis of H pylori related hypermethylation in samples from adult stomach tissues. These factors (except for medication) do not have to be considered in the analysis of pediatric patients. Before this study, we expected that aberrant promoter CpG island hypermethylation would occur in the stomach during childhood because it is well known that H pylori infection is primarily acquired during childhood 11,12 and is closely associated with promoter CpG island hypermethylation in gastric epithelial cells. This study provides evidence to support our notion that promoter CpG island hypermethylation occurs in samples from pediatric stomach tissues in association with H pylori infection. We found that the promoter CpG island loci that were vulnerable to H pylori related hypermethylation were very similar between samples from pediatric and adult stomach tissues. Furthermore, the overall methylation levels in these susceptible CpG island loci were found to be higher in adult samples than in pediatric samples, suggesting that the duration of H pylori exposure may be Figure 5. Genomic structures of CDH1 (A) and TIMP3 (B) and their methylation states in results from pediatric and adult stomach tissue samples. Key: vertical ticks, individual CpG sites; arrow, transcription start site (TSS). Locations of the primers for the MethyLight assay and for the bisulfite genomic sequencing are indicated. Analysis of bisulfite sequencing results identified methylated (closed circle) and unmethylated (open circle) CpG sites within individual alleles in representative tissue samples of H pylori positive (HP + )orhpylori2negative (HP 2 ) samples from pediatric and adult patients. Ten clones were sequenced for each sample. related to the overall higher methylation levels in samples from adult stomach tissues. Sample results from H pylori positive pediatric stomach tissues showed a bimodal distribution of cases in the number of methylated genes per sample, which is in contrast to sample results from H pylori positive adult stomach tissues, which showed a distinct rightward shift toward a higher average number of methylated genes (Figure 6). To exclude the possibility that more genes were methylated in teenage patients (n 5 16) than in younger patients (,10 years old; n 5 11), we compared the average number of methylated genes between these 2 subgroups and observed no difference (3.7 versus 3.2, P 5.66). However, the left-sided group (with fewer methylated genes) was absent in the H pylori positive adult group, which suggests that the left-sided group may shift to become part of the right-sided group with longer exposure to H pylori infection. The bimodal distribution of results from H pylori positive pediatric samples may be Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 763

6 Figure 6. Distribution of the number of methylated genes in results from negative samples (HP 2 ) in pediatric cases, H pylori positive (HP + ) samples in pediatric cases, HP 2 samples in adult cases, and HP + samples in adult cases. explained by the presence of 2 different groups that were heterogeneous in their vulnerability to aberrant CpG island hypermethylation. It is possible that the left-sided group may have genotypes with weaker promoter activities in cytokines, for example, IL1B, than those of the right-sided groups; single nucleotide polymorphism at the 2511 nucleotide of IL1B, which affects its promoter activity, has been demonstrated to be related to differential hypermethylation of some candidate CpG island loci in association with H pylori infection. 22 Age-related hypermethylation, in which methylation of some CpG islands increases with age in tissues without abnormalities, is well known in healthy colon mucosa but is controversial in healthy gastric mucosa. Whereas our previous study using methylation-specific polymerase chain reaction demonstrated age-related hypermethylation in healthy gastric mucosa, 26 Maekita and colleagues 9 reported that there was no age-related hypermethylation in healthy gastric mucosa. Our current study supports the presence of age-related hypermethylation in the gastric mucosa because the number of methylated genes was significantly higher in results from H pylori negative adult samples than it was in results from H pylori negative pediatric samples (0.9 versus 0.3, P 5.04). We also noted differences in the methylation levels of individual loci between results from H pylori negative adult samples and H pylori negative pediatric samples: 6 loci (DAPK, HOXA1, CRABP1, TWIST1, GRIN2B, and TIMP3) showed statistically higher methylation levels in adult samples than in pediatric samples (all values, P,.05). Although these H pylori negative adult samples were obtained from patients who had negative results from the 3 diagnostic tests, including the serum anti H pylori IgG test, the CLO test, and analysis of Giemsa-stained histologic slides, we cannot completely rule out the possibility that these patients may have undergone seroconversion. Thus, we cannot rule out the possibility of H pylori associated hypermethylation effects in age-related hypermethylation. In conclusion, this study demonstrates for the first time, to our knowledge, that promoter CpG island hypermethylation occurs in pediatric gastric mucosa in association with H pylori infection and that the CpG island loci hypermethylated in association with H pylori infection are similar in adult and pediatric gastric samples. This study was supported by grant M N from the Korea Science and Engineering Foundation, funded by the Ministry of Education, Science and Technology (MEST); by grant from the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the MEST; and by grant from a Priority Research Centers Program through the NRF. References 1. Saxonov S, Berg P, Brutlag DL. A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc Natl Acad Sci U S A. 2006;103(5): Issa JP, Ahuja N, Toyota M, Bronner MP, Brentnall TA. Accelerated agerelated CpG island methylation in ulcerative colitis. Cancer Res. 2001;61(9): Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3(6): Issa JP. CpG-island methylation in aging and cancer. Curr Top Microbiol Immunol. 2000;249: Hahn MA, Hahn T, Lee DH, et al. Methylation of polycomb target genes in intestinal cancer is mediated by inflammation. Cancer Res. 2008;68(24): Kang GH, Shim YH, Jung HY, Kim WH, Ro JY, Rhyu MG. CpG island methylation in premalignant stages of gastric carcinoma. Cancer Res. 2001;61(7): Waki T, Tamura G, Tsuchiya T, Sato K, Nishizuka S, Motoyama T. Promoter methylation status of E-cadherin, hmlh1, and p16 genes in nonneoplastic gastric epithelia. Am J Pathol. 2002;161(2): Chan AO, Lam SK, Wong BC, et al. Promoter methylation of E-cadherin gene in gastric mucosa associated with Helicobacter pylori infection and in gastric cancer. Gut. 2003;52(4): Maekita T, Nakazawa K, Mihara M, et al. High levels of aberrant DNA methylation in infected gastric mucosae and its possible association with gastric cancer risk. Clin Cancer Res. 2006;12(3, pt 1): Qian X, Huang C, Cho CH, Hui WM, Rashid A, Chan AO. E-cadherin promoter hypermethylation induced by interleukin-1b treatment or H pylori infection in human gastric cancer cell lines. Cancer Lett. 2008;263(1): Yamada T, Searle JG, Ahnen D, et al; National Institutes of Health Consensus Development Panel on Helicobacter pylori in Peptic Ulcer Disease. Helicobacter pylori in peptic ulcer disease. JAMA. 1994;272(1): Goodman KJ, Correa P. The transmission of Helicobacter pylori: a critical review of the evidence. Int J Epidemiol. 1995;24(5): Yoo EJ, Park SY, Cho NY, Kim N, Lee HS, Kang GH infection-associated CpG island hypermethylation in the stomach and its possible association with polycomb repressive marks. Virchows Arch. 2008;452(5): Weisenberger DJ, Siegmund KD, Campan M, et al. CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet. 2006;38(7): Ogino S, Kawasaki T, Brahmandam M, et al. Precision and performance characteristics of bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8(2): Ogino S, Cantor M, Kawasaki T, et al. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies. Gut. 2006;55(7): Yuasa Y, Nagasaki H, Akiyama Y, et al. DNA methylation status is inversely correlated with green tea intake and physical activity in gastric cancer patients. Int J Cancer. 2009;124(11): Seitz HK, Stickel F. Molecular mechanisms of alcohol-mediated carcinogenesis. Nat Rev Cancer. 2007;7(8): Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al

7 19. Nan HM, Song YJ, Yun HY, Park JS, Kim H. Effects of dietary intake and genetic factors on hypermethylation of the hmlh1 gene promoter in gastric cancer. World J Gastroenterol. 2005;11(25): Poplawski T, Tomaszewska K, Galicki M, Morawiec Z, Blasiak J. Promoter methylation of cancer-related genes in gastric carcinoma. Exp Oncol. 2008;30(2): Tahara T, Shibata T, Yamashita H, et al. Chronic nonsteroidal antiinflammatory drug (NSAID) use suppresses multiple CpG islands hyper methylation (CIHM) of tumor suppressor genes in the human gastric mucosa. Cancer Sci. 2009;100(7): Chan AO, Chu KM, Huang C, et al. Association between Helicobacter pylori infection and interleukin 1b polymorphism predispose to CpG island methylation in gastric cancer. Gut. 2007;56(4): Issa JP, Ottaviano YL, Celano P, Hamilton SR, Davidson NE, Baylin SB. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat Genet. 1994;7(4): Ahuja N, Li Q, Mohan AL, Baylin SB, Issa JP. Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res. 1998;58(23): Nakagawa H, Nuovo GJ, Zervos EE, et al. Age-related hypermethylation of the 59 region of MLH1 in normal colonic mucosa is associated with microsatellite-unstable colorectal cancer development. Cancer Res. 2001; 61(19): Kang GH, Lee HJ, Hwang KS, Lee S, Kim JH, Kim JS. Aberrant CpG island hypermethylation of chronic gastritis, in relation to aging, gender, intestinal metaplasia, and chronic inflammation. Am J Pathol. 2003;163(4): Arch Pathol Lab Med Vol 135, June 2011 Hypermethylation in Pediatric Gastric Mucosa Shin et al 765