11/21/2009. Erlotinib in KRAS Mt patients. Bevacizumab in Squamous patients
|
|
- Edward Wells
- 5 years ago
- Views:
Transcription
1 Decision-Making in Non-Small Cell Lung Cancer (NSCLC): Moving from Empiric to Personalized & Molecular-based Therapy David R. Gandara, MD University of California Davis Cancer Center Disclosures Research Grants: Abbott, BMS/ImClone, Genentech, Lilly, Merck, Novartis, Pfizer Consultant: Amgen, AstraZeneca, Biodesix, Boehringer-Ingelheim, BMS/ImClone, GlaxoSmithKline, Genentech, Lilly, Merck, Novartis, Pfizer, Sanofi-Aventis Board of Directors: Response Genetics Non-Profits: ASCO, IASLC, ESMO, NCI, Addario Foundation Selection of Therapy for NSCLC Patients: Empiric versus Molecular-Based Empiric: current standard, takes into consideration patient characteristics and physician experience Molecular-Based: based on tumor molecular profile or host genetic makeup
2 65 y/o male Smoker Squamous KRAS Mt Low ERCC1 High RRM1 Hypothesis: Personalizing Therapy for Cancer Patients Will Improve Overall Care Patients with the same Diagnosis &Clinical Features (Stage IV Non-small Cell Lung Cancer) 39 y/o female Never-Smoker Adenoca EGFR Mt High ERCC1 Low RRM1 Personalizing Patient Therapy in NSCLC Patients with Stage IV NSCLC Erlotinib in KRAS Mt patients Bevacizumab in Squamous patients Alternate therapy predicted predicted non-responders & toxic responders Standard therapy for Patients predicted to benefit & those not Predisposed to Toxicity Hypothesis : Personalized Treatment Planning based on the molecular profile of the tumor and/or the host (patient) will improve patient outcomes Selection Factors for Individualizing Therapy of NSCLC Grouped Patient Outcomes by Histology Pemetrexed/Cisplatin* Non-Squamous 11.8 mos Predicted Individual Patient Outcomes Now we are translating these findings into the treatment selection paradigm for earlier stage NSCLC as well Squamous 9.4 mos *Scagliotti & Gandara: JCO, 2008 Chemotherapy Anti-EGFR Therapy Anti-Angiogenic Angiogenic Therapy? from Gandara & Scagliotti: Clin Lung Cancer,
3 NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Predictive Biomarkers Maintenance Therapy Hypothesis: Treatment of NSCLC should be Histology-Based Observation: Pemetrexed efficacy in Adenocarcinoma & Large Cell Subsets of NSCLC JMDB: Pemetrexed-Cisplatin vs Gemctiabine- Cisplatin in 1 st line therapy of Advanced NSCLC JMEI: Pemetrexed vs Docetaxel in 2 nd line therapy of Advanced NSCLC JMEN: Pemetrexed vs as Maintenance Therapy of NSCLC FDA restricted use of Pemetrexed to Non-Squamous Histology JMDB: Pemetrexed/Cisplatin vs Gemcitabine/Cisplatin in 1 st Line Therapy of Advanced NSCLC Randomization Factors Stage Performance status Gender Histologic vs cytologic diagnosis History of brain metastases R Cisplatin 75 mg/m 2 day 1 plus Pemetrexed 500 mg/m 2 day 1 Each cycle repeated q3 weeks up to 6 cycles Cisplatin 75 mg/m 2 day 1 plus Gemcitabine 1250 mg/m 2 days 1 & 8 Vitamin B 12, folate, and dexamethasone given in both arms Scagliotti & Gandara. J Clin Oncol 2008;26: JMDB Trial: Cisplatin-Pemextexed (Cis-Pem) vs Cisplatin-Gemcitabine (Cis-Gem) in Adv NSCLC No difference in overall PFS or Survival between study arms Cis-Pem improves Survival in Non-Squamous (SCCA) (HR 1, p=05) Cis-Pem is inferior in SCCA (HR 1.23, p=5) Scagliotti & Gandara. J Clin Oncol 2008;26:
4 JMEI: Pemetrexed Less Effective in Squamous Histology Patients JMEN: Maintenance Pemetrexed vs : Survival by Histology Non-squamous (n = 481) Squamous (n = 182) HR = 0 (95% CI: 6-8); P = 02 HR = 7 (95% CI: 9 3); P = 78 Percent Surviving Pts Randomized to Pemetrexed (8.3 mos) Squamous: Median = 6.2 Nonsquamous: Median = 9.2 HR*=8 P=01 Percent Surviving Pts Randomized to Docetaxel (7.9 mos) Squamous: Median = 7.4 Non-squamous: Median = 8.2 Survival Probability 1 mos Pemetrexed 15.5 mos 1 mos Pemetrexed 9.9 mos Overall Survival (months) Overall Survival (months) Pemetrexed is less effective in Squamous histology patients P Peterson et al. WCLC 2007 Belani CP, et al. ASCO CRA8000. Hypothesis: Histology will ultimately prove to be Suboptimal for Selecting Chemotherapy (or Targeted Therapy) Histologic subtyping groups tumors based on microscopic pattern recognition by a pathologist (using 1800 s technology) At best, Histology = crude molecular selection NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Maintenance Therapy Predictive Biomarkers Robert Hooke Tissue Microarray 4
5 Proposed Predictive Biomarkers for Chemotherapy in NSCLC Thymidylate Synthetase Expression in Lung Cancer Pemetrexed: TS Platinum: ERCC1, Genomic Signature Gemcitabine: RRM1 Taxanes/Vincas: TUBB-III, BRCA-1 TS SCLC High TS Squamous High TS Adeno Low TS Bhattacharjee PNAS 2001 TS mrna Expression in Lung Cancer 6 5 P<01 TS mrna Expression in NSCLC: Analysis of the Response Genetics (RGI) Database N= NSCLC: 141 adenoca, 183 squamous [SCCA] TS relative mrna levels P<01 P<01 P=9 Tumor NSCLC- Total NSCLC- Adenoca NSCLC- SCCA Median TS Range ADC SCC LCC SCLC N=41 N=30 N=34 N=33 Ceppi: Cancer 2006 Broad overlap of TS range between NSCLC-Adeno & NSCLC-SCCA Gandara: WCLC
6 ERCC1 is both Prognostic & Predictive of benefit of Platinum-based Chemotherapy in NSCLC The Nucleotide excision repair gene ERCC1 plays a key role in DNA repair after Cisplatin damage The balance of DNA damage to DNA repair dictates tumor cell death or survival after Cisplatin therapy Data support the prognostic & predictive value of ERCC1 protein expression and mrna levels in NSCLC ERCC1 mrna levels in NSCLC Stage I/II: Resected (Simon: Chest, 2005) High Stage IV: gem/cis (Lord et al. CCR, 2002) Low DNA damage DNA repair S0720: Biomarker-directed Adjuvant Chemotherapy of Stage I NSCLC (ERCC1 & RRM1) NSCLC Stage I pt1(>2cm) pt2n0m0 R0 resection PS 0-1 N=55 Enrollment Surgery Specimen Collection ERCC1 & RRM1 AQUA testing Assignment Cisplatin- Gemcitabine Vs Observation Prognostic Low Predictive High ERCC1: Excision Repair Cross-Complementing Complementing Group 1 RRM1: Ribonucleotide Reductase M1 Zheng, Bepler: NEJM, 2007; Simon: JCO, 2007 Platinum Compound Metabolism & Disposition Cisplatin Cisplatin Cisplatin Cisplatin ABCG2 ABCC2 Translesional replication cell membrane Detoxify S0720: Biomarker-directed Adjuvant Therapy of Stage I NSCLC RRMI > 4 AND ERCC1 > 66.0 Assignment All Others (RRM1< 4 OR ERCC1 < 66.0 ) Damage recognition MLH1 Mismatch repair MSH6 Cell Death XPA ERCC2 ERCC1 XRCC1 Excision repair Observation Good Prognosis Less benefit from chemotherapy Cisplatin-Gemcitabine Poor Prognosis More benefit from chemotherapy Primary Endpoint: Feasibility measured as % of patients in whom treatment assignment can be made (>75%=success) 6
7 Epidermal Growth Factor Receptor (EGFR) Inhibitors in NSCLC: Status of Predictive Biomarkers Gefitinib Erlotinib Single Agent EGFR Mt = (+) predictive EGFR FISH = (+) predictive KRAS Mt = (-) predictive TKIs + Chemo effective TKI Ligand TKI K K MoAb K K Cetuximab Single Agent EGFR Mt predictive SWOG Data EGFR FISH= (+) predictive KRAS Mt predictive Cetux + Chemo = effective Individualizing Anti-EGFR Therapy: Methodology GGCGGGCCAAACTGCTGGGTGCG EGFR mutation status by gene sequencing EGFR gene copy number by fluorescence in situ hybridization (FISH) EGFR protein expression by immunohistochemistry (IHC) Signal Transduction Blocked Signal Transduction Blocked Serum Proteomics by MALDI MS 25 Predictive Biomarkers for EGFR Therapy (IPASS) Conducted in China, Japan, Thailand, Taiwan, Indonesia, Malaysia, Philippines, Hong Kong, and Singapore Patients Chemo-naïve Age 18 years Adenocarcinoma histology Never or ex-light smokers* Life expectancy 12 weeks WHO PS 0-2 Measurable stage IIIB / IV disease Mok: NEJM, 2009 Randomization period: March 2006 October 2007 Gefitinib (250 mg/d) 1:1 randomization Carboplatin (AUC 5 or 6) / paclitaxel (200 mg/m 2 ) 3 weekly # 94% Never-Smokers; ~80% female End Points Primary Progression-free survival (noninferiority) Secondary Objective response rate Overall survival Quality of life Disease-related symptoms Safety and tolerability Exploratory Biomarkers EGFR mutation EGFR-gene-copy number EGFR protein expression Probability of PFS IPASS: Progression-free survival Primary Cox analysis with covariates HR <1 implies a lower risk of progression on gefitinib N Events Gefitinib (74.4%) Carboplatin / paclitaxel (81.7%) HR (95% CI) = 41 (51, 45) p<001 Median PFS (months) 4 months progression-free 6 months progression-free 12 months progression-free % 48% 25% % 48% 7% Gefitinib demonstrated superiority relative to carboplatin / paclitaxel in terms of PFS At risk : Months Gefitinib Carboplatin / paclitaxel Mok: NEJM,
8 Probability of progression-free survival IPASS Trial Progression-Free Survival: Gefitinib vs Carboplatin/Paclitaxel in Adv NSCLC EGFR mutation positive ITT population Cox analysis with covariates Gefitinib (n=132) Carboplatin / paclitaxel (n=129) HR (95% CI) = 8 (6, 4) p<001 No. events gefitinib, 97 (73.5%) No. events C / P, 111 (86.0%) Months EGFR mutation negative Clinical Treatment characteristics by subgroup interaction are test, insufficient p<001 Probability of progression-free survival Gefitinib (n=91) Carboplatin / paclitaxel (n=85) HR (95% CI) = 2.85 (2.05, 3.98) p<001 No. events gefitinib, 88 (96.7%) No. events C / P, 70 (82.4%) Months for selection of 1 st line EGFR TKI Therapy Mok: NEJM, 2009 S0819: Phase III Trial of Chemotherapy +/- Cetuximab (builds on S0342 & S0536) NSCLC Adv Stage Tumor Tissue Available R A N D O M I Z E Paclitaxel Carboplatin *Bevacizumab Paclitaxel Carboplatin Cetuximab *Bevacizumab *Bevacizumab Primary Endpoints: OS (entire study), PFS (EGFR FISH) Cetuximab *Bevacizumab *In Bevacizumab appropriate: as piloted in S0536 Correlative Science: Tumor: EGFR/HER pathways; KRAS Genomic DNA: EGFR polymorphisms Plasma: Proteomic predictor EGFR FISH S0342: Cetuximab + Paclitaxel/Carboplatin: Analysis by EGFR FISH Response (CR/PR) DCR (CR/PR/SD) FISH - 26% 55% FISH + 45% 81% (p=2) 100% 80% 60% 40% 20% 0% Progression Free Survival by FISH Score Group PFS Events / N 1-4 Low 31 / High 41 / 45 Logrank P-value = Months After Enrollment Median in Months 3 (2,4) 6 (5,7) NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Maintenance Therapy 100% 80% 60% Overall Survival by FISH Score Group OS Events / N 1-4 Low 25 / High 29 / 45 Logrank P-value =.04 Median in Months 7 (4,11) 15 (10,19) Predictive Biomarkers 40% 20% 12 June 2007 Hirsch: JCO 2008 (Colorado SPORE) 0% Months After Enrollment 8
9 Maintenance Pemetrexed vs after initial Platinum-based Chemotherapy Stage IIIB/IV Four cycles of platinum-based chemotherapy (no pemetrexed) ECOG PS 0-1 Non-PD (CR, PR, SD) (n=663) Randomization factors: gender PS stage best tumor response non-platinum drug brain mets Pemetrexed 500mg/m 2 q3w d1, until progression (n=441) (n=222) JCO 2009 Maintenance Pemetrexed vs After Platinum-based Chemotherapy Progression-free Survival Overall Survival Progression-free Probability Survival Probability CI: confidence interval; HR: hazard ratio; mos: months Belani CP, et al. ASCO CRA mos HR = 0 (95% CI: 9-3) P <0001 Pemetrexed 4.0 mos HR = 9 (95% CI: 5-5) P = 12 Pemetrexed 13.4 mos 1 mos Survival Probability JMEN: Maintenance Pemetrexed vs : Survival by Histology Non-squamous (n = 481) Squamous (n = 182) HR = 0 (95% CI: 6-8); P = 02 1 mos Belani CP, et al. ASCO CRA8000. Pemetrexed 15.5 mos HR = 7 (95% CI: 9 3); P = 78 1 mos Pemetrexed 9.9 mos JMEN: Maintenance Pemetrexed vs After Platinum-based Chemotherapy JMEN: Systemic Pemetrexed Post-study study Therapy N = 309 N = 178 Any systemic therapy 51% 67% Docetaxel 22% 29% Erlotinib 22% 21% Gefitinib 13% 10% Pemetrexed 1% 19% Post-study study therapy was not balanced between the arms 51% of patients on the pemetrexed arm received further therapy (equates to third-line therapy) Only 19% of placebo-arm arm patients received pemetrexed Would survival benefits have been preserved if more patients on the placebo arm received pemetrexed? Belani CP, et al. ASCO CRA
10 Chemo-naïve advanced NSCLC n = 1949 Mandatory tumor sampling SATURN Study Design 4 cycles of first-line platinum doublet chemotherapy* Stratification factors: EGFR IHC (positive vs negative vs indeterminate) Stage (IIIB vs IV) ECOG PS (0 vs 1) CT regimen (cis/gem vs carbo/doc vs others) Smoking history (current vs former vs never) Region Non-PD n = 889 Erlotinib 150 mg/d 1:1 Co-primary endpoints: PFS in all patients PFS in patients with EGFR IHC+ tumors Secondary endpoints: PD PD OS in all patients and those with EGFR IHC+ tumors, OS and PFS in EGFR IHC tumors; biomarker analyses; safety; time to symptom progression; QOL *Cisplatin/paclitaxel; cisplatin/gemcitabine; cisplatin/docetaxel cisplatin/vinorelbine; carboplatin/gemcitabine; carboplatin/docetaxel carboplatin/paclitaxel CT: chemotherapy; EGFR: epidermal growth factor receptor; IHC: immunohistochemistry Cappuzzo F, et al. ASCO Abstract SATURN: Maintenance Erlotinib vs Progression Free Survival (PFS) Probability Time (weeks) Cappuzzo F, et al. ASCO Abstract Median PFS (wks) PFS at 12 wks (%) HR = 1 (2-2) Log-rank P <001 Erlotinib PFS at 24 wks (%) Erlotinib (n = 437) (n = 447) Empiric Personalized & Molecular-Based Therapy Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer,
11 Algorithm for Therapy of Advanced Stage NSCLC (Good PS): 2012 Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer, 2009 Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer,
Maintenance Therapy for Advanced NSCLC: When, What, Why & What s Left After Post-Maintenance Relapse?
Maintenance Therapy for Advanced NSCLC: When, What, Why & What s Left After Post-Maintenance Relapse? Mark A. Socinski, MD Professor of Medicine Multidisciplinary Thoracic Oncology Program Lineberger Comprehensive
More informationPROGNOSTIC AND PREDICTIVE BIOMARKERS IN NSCLC. Federico Cappuzzo Istituto Toscano Tumori Ospedale Civile-Livorno Italy
PROGNOSTIC AND PREDICTIVE BIOMARKERS IN NSCLC Federico Cappuzzo Istituto Toscano Tumori Ospedale Civile-Livorno Italy Prognostic versus predictive Prognostic: In presence of the biomarker patient outcome
More informationMaintenance paradigm in non-squamous NSCLC
Maintenance paradigm in non-squamous NSCLC L. Paz-Ares Hospital Universitario Virgen del Rocío Sevilla Agenda Theoretical basis The data The comparisons Agenda Theoretical basis The data The comparisons
More informationTargeted Agents as Maintenance Therapy. Karen Kelly, MD Professor of Medicine UC Davis Cancer Center
Targeted Agents as Maintenance Therapy Karen Kelly, MD Professor of Medicine UC Davis Cancer Center Disclosures Genentech Advisory Board Maintenance Therapy Defined Treatment Non-Progressing Patients Drug
More informationEGFR inhibitors in NSCLC
Suresh S. Ramalingam, MD Associate Professor Director of Medical Oncology Emory University i Winship Cancer Institute EGFR inhibitors in NSCLC Role in 2nd/3 rd line setting Role in first-line and maintenance
More informationSlide 1. Slide 2 Maintenance Therapy Options. Slide 3. Maintenance Therapy in the Management of Non-Small Cell Lung Cancer. Maintenance Chemotherapy
Slide 1 Maintenance Therapy in the Management of Non-Small Cell Lung Cancer Frances A Shepherd, MD FRCPC Scott Taylor Chair in Lung Cancer Research Princess Margaret Hospital, Professor of Medicine, University
More informationEGFR MUTATIONS: EGFR PATHWAY AND SELECTION OF FIRST-LINE THERAPY WITH TYROSINE KINASE INHIBITORS
EGFR MUTATIONS: EGFR PATHWAY AND SELECTION OF FIRST-LINE THERAPY WITH TYROSINE KINASE INHIBITORS Federico Cappuzzo Istituto Clinico Humanitas IRCCS Rozzano-Italy The EGFR/HER Family Ligand binding domain
More information1st line chemotherapy and contribution of targeted agents
ESMO PRECEPTORSHIP PROGRAMME NON-SM ALL-CELL LUNG CANCER 1st line chemotherapy and contribution of targeted agents Yi-Long Wu Guangdong Lung Cancer Institute Guangdong General Hospital Guangdong Academy
More informationMaintenance Therapy for Advanced NSCLC: Which Patients, Which Approach?
Maintenance Therapy for Advanced NSCLC: Which Patients, Which Approach? Mark A. Socinski, MD Visiting Professor of Medicine and Thoracic Surgery Director, Lung Cancer Section, Division of Hematology/Oncology
More informationManagement Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective
Management Guidelines and Targeted Therapies in Metastatic Non-Small Cell Lung Cancer: An Oncologist s Perspective Julie R. Brahmer, M.D. Associate Professor of Oncology The Sidney Kimmel Comprehensive
More informationMaintenance therapy in advanced non-small cell lung cancer. Egbert F. Smit MD PhD Dept Thoracic Oncology Netherlands Cancer Institute
Maintenance therapy in advanced non-small cell lung cancer. Egbert F. Smit MD PhD Dept Thoracic Oncology Netherlands Cancer Institute e.smit@nki.nl Evolution of front line therapy in NSCLC unselected pts
More informationChoosing Optimal Therapy for Advanced Non-Squamous (NS) Non-Small Cell Lung Cancer
Choosing Optimal Therapy for Advanced Non-Squamous (NS) Non-Small Cell Lung Cancer Jyoti D. Patel, MD Associate Professor Feinberg School of Medicine Robert H Lurie Comprehensive Cancer Center Northwestern
More informationMedical Oncology: State of the Art Therapy in Advanced NSCLC: 2011 looking toward 2015
Medical Oncology: State of the Art Therapy in Advanced NSCLC: 2011 looking toward 2015 David R. Gandara, MD University of California Davis Cancer Center Algorithm for Therapy of Advanced Stage NSCLC: 2009
More informationMaintenance Treatment for Advanced NSCLC. Yvonne Summers PhD, FRCP ESMO Preceptorship Programme March 2017
Maintenance Treatment for Advanced NSCLC Yvonne Summers PhD, FRCP ESMO Preceptorship Programme March 2017 Milestones in the Palliative Systemic Treatment of NSCLC 1990 2000 2010 2015 Platinum based Chemotherapy
More informationMAINTENANCE TREATMENT CHEMO MAINTENANCE OR TARGETED OF BOTH? Martin Reck Department of Thoracic Oncology LungenClinic Grosshansdorf
MAINTENANCE TREATMENT CHEMO MAINTENANCE OR TARGETED OF BOTH? Martin Reck Department of Thoracic Oncology LungenClinic Grosshansdorf OUTLINE Background and Concept Switch Maintenance Continuation Maintenance
More informationThe Evolving Role of Molecular Markers in Managing Non-Small Cell Lung Cancer
The Evolving Role of Molecular Markers in Managing Non-Small Cell Lung Cancer Nathan A. Pennell, M.D., Ph.D. Assistant Professor Solid Tumor Oncology Cleveland Clinic Taussig Cancer Institute www.cancergrace.org
More information1 st line chemotherapy and contribution of targeted agents in non-driver addicted NSCLC
1 st line chemotherapy and contribution of targeted agents in non-driver addicted NSCLC Dr Ross Soo, FRACP National University Cancer Institute, Singapore National University Health System Cancer Science
More informationMaintenance Treatment of Advanced NSCLC
Maintenance Treatment of Advanced NSCLC Giorgio V. Scagliotti University of Torino Department of Clinical & Biological Sciences giorgio.scagliotti@unito.it UNIVERSTY OF TORINO DEPT. OF OF Maintenance /Consolidation/Sequencing
More informationAntiangiogenic Agents in NSCLC Where are we? Which biomarkers? VEGF Is the Only Angiogenic Factor Present Throughout the Tumor Life Cycle
Antiangiogenic Agents in NSCLC Where are we? Which biomarkers? Martin Reck Department e t of Thoracic c Oncology ogy Hospital Grosshansdorf Germany VEGF Is the Only Angiogenic Factor Present Throughout
More informationExploring Personalized Therapy for First Line Treatment of Advanced Non-Small Cell Lung Cancer (NSCLC)
Exploring Personalized Therapy for First Line Treatment of Advanced Non-Small Cell Lung Cancer (NSCLC) Suresh S. Ramalingam, MD Director of Thoracic Oncology Associate Professor Emory University Atlanta,
More informationMonoclonal Antibodies in the Management of Non-Small Cell Lung Cancer (NSCLC): 2016 Update Angioinhibitors and EGFR MAbs
Monoclonal Antibodies in the Management of Non-Small Cell Lung Cancer (NSCLC): 2016 Update Angioinhibitors and EGFR MAbs Corey J Langer, MD, FACP Director Thoracic Oncology Abramson Cancer Center Professor
More informationNSCLC with squamous histology: Current treatment and new options on horizon
NSCLC with squamous histology: Current treatment and new options on horizon Prof. Yasser A.Kader Professor of Oncology Faculty of Medicine, Cairo University 2015 Lung Cancer: Incidence and Mortality New
More information2 nd line Therapy and Beyond NSCLC. Alan Sandler, M.D. Oregon Health & Science University
2 nd line Therapy and Beyond NSCLC Alan Sandler, M.D. Oregon Health & Science University Treatment options for advanced or metastatic (stage IIIb/IV) NSCLC Suitable for chemotherapy Diagnosis Unsuitable/unwilling
More informationBiomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007
Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007 Bruce E. Johnson, MD Dana-Farber Cancer Institute, Brigham and Women s Hospital, and Harvard
More informationESMO THE CHRISTIE PRECEPTORSHIP PROGRAMME. 1 st line chemotherapy for advanced NSCLC. Benjamin BESSE, MD, PhD Head Dpt of Cancer Medicine
ESMO THE CHRISTIE PRECEPTORSHIP PROGRAMME 1 st line chemotherapy for advanced NSCLC Benjamin BESSE, MD, PhD Head Dpt of Cancer Medicine 2017 PD-L1 50% Pembrolizuma b [I,A] Courtesy of J.Remon Adapted from
More informationSystemic therapy in early stage NSCLC. Disclosures
Systemic therapy in early stage NSCLC Christian Manegold, MD Professor of Medicine, Heidelberg University Interdisciplinary Thoracic Oncology Department of Surgery University Medical Center Mannheim, Germany
More information1st-line Chemotherapy for Advanced disease
SESSION 3: ADVANCED NSCLC 1st-line Chemotherapy for Advanced disease JY DOUILLARD MD PhD Professor Emeritus in Medical Oncology Chief Medical Officer (CMO) ESMO Lugano CH Percent Survival HISTORICAL BASIS
More informationHistology in the Decision-making Process
Histology in the Decision-making Process Giorgio V. Scagliotti University of Torino Department of Clinical & Biological Sciences giorgio.scagliotti@unito.it Lung Cancer Four Main Histological Subtypes
More informationIRESSA (Gefitinib) The Journey. Anne De Bock Portfolio Leader, Oncology/Infection European Regulatory Affairs AstraZeneca
IRESSA (Gefitinib) The Journey Anne De Bock Portfolio Leader, Oncology/Infection European Regulatory Affairs AstraZeneca Overview The Drug The Biomarker and Clinical Trials Sampling Lessons Learned The
More informationASCO Highlights Lung Cancer
ASCO Highlights Lung Cancer Anne S. Tsao, M.D. Director, Mesothelioma Program Assistant Professor July 11, 2009 The University of Texas MD ANDERSON CANCER CENTER Department of Thoracic/Head & Neck Medical
More informationVEGF-Inhibitors in NSCLC. Martin Reck Department of Thoracic Oncology Hospital Grosshansdorf Germany
VEGF-Inhibitors in NSCLC Martin Reck Department of Thoracic Oncology Hospital Grosshansdorf Germany Conflicts of interest Advisory Board: AstraZeneca Bristol-Myers Squibb Daiichi Sankyo Eli Lilly Merck
More informationERCC-1 1 and response to chemotherapy. Jean-Charles SORIA, MD, PhD Institut Gustave Roussy
ERCC-1 1 and response to chemotherapy 1 Jean-Charles SORIA, MD, PhD Institut Gustave Roussy Cancer and Chemotherapy: the exemple of Lung Cancer 2 50 CT + supportive care 40 Surgery ± CT Patients (%) 30
More informationAntiangiogenici in combinazione a chemioterapia in prima linea: bevacizumab
Micro-ambiente tumorale. Antiangiogenici e immunoterapia: miti e realtà Milano, 11 Ottobre 2016 Antiangiogenici in combinazione a chemioterapia in prima linea: bevacizumab Francesco Grossi U.O.S. Tumori
More informationChanging demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
More informationMetastatic NSCLC: Expanding Role of Immunotherapy. Evan W. Alley, MD, PhD Abramson Cancer Center at Penn Presbyterian
Metastatic NSCLC: Expanding Role of Immunotherapy Evan W. Alley, MD, PhD Abramson Cancer Center at Penn Presbyterian Disclosures: No relevant disclosures Please note that some of the studies reported in
More informationNew Options for Achieving Individualized Approaches to Non-Small Cell Lung Cancer (NSCLC) Management
New Options for Achieving Individualized Approaches to Non-Small Cell Lung Cancer (NSCLC) Management Ramaswamy Govindan, MD Director Professor of Medicine Director, Thoracic Oncology Program Department
More informationHistology: Its Influence on Therapeutic Decision Making
Histology: Its Influence on Therapeutic Decision Making Mark A. Socinski, MD Professor of Medicine and Thoracic Surgery Director, Lung Cancer Section, Division of Hematology/Oncology Co-Director, UPMC
More informationSquamous Cell Carcinoma Standard and Novel Targets.
Squamous Cell Carcinoma Standard and Novel Targets. Mohamed K. Mohamed, MD, PhD Director of Thoracic Oncology Cone Health Cancer Center Greensboro, NC 1 Mohamed Mohamed, MD, PhD Squamous Cell Carcinoma:
More informationPlotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma
Pieter E. Postmus University of Liverpool Liverpool, UK Plotting the course: optimizing treatment strategies in patients with advanced adenocarcinoma Disclosures Advisor Bristol-Myers Squibb AstraZeneca
More informationOptimal Application of Adjuvant Therapy in NSCLC
Optimal Application of Adjuvant Therapy in NSCLC Heather Wakelee, MD Stanford University, Stanford Cancer Institute Post 1995 Meta-Analysis : NSCLC Randomized Adjuvant Platinum Trials Trial Stage n Chemo
More informationStage III NSCLC: Overview
Locally Advanced NSCLC: New Concepts in Combined Modality Therapy NSCLC: Stage Distribution Randeep Sangha, MD Visiting Assistant Professor UC Davis Cancer Center Sacramento, CA Stage III NSCLC: Overview
More informationPrognostic and predictive biomarkers in
OLOGICAL SCIENCES O DEPT. OF CLINICAL & BIO UNIVERSITY UNIVERSTY OF TORINO Prognostic and predictive biomarkers in early stage NSCLC Giorgio V. Scagliotti University of Torino Department of Clinical &
More informationNSCLC: Terapia medica nella fase avanzata. Paolo Bidoli S.C. Oncologia Medica H S. Gerardo Monza
NSCLC: Terapia medica nella fase avanzata Paolo Bidoli S.C. Oncologia Medica H S. Gerardo Monza First-line Second-line Third-line Not approved CT AND SILENT APPROVAL Docetaxel 1999 Paclitaxel Gemcitabine
More informationTreatment of EGFR mutant advanced NSCLC
Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and Manchester University Hospital Manchester, UK Outline Data on first-line Overcoming T790M mutation
More informationImmune Checkpoint Inhibitors for Lung Cancer William N. William Jr.
Immune Checkpoint Inhibitors for Lung Cancer William N. William Jr. Diretor de Onco-Hematologia Hospital BP, A Beneficência Portuguesa Non-Small Cell Lung Cancer PD-1/PD-L1 Inhibitors in second-line therapy
More informationSecond-line treatment for advanced NSCLC
Second-line treatment for advanced NSCLC Silvia Novello silvia.novello@unito.it UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY DISCLOSURE OF INTEREST Speaker Bureau: Eli Lilly, MSD, BI, BMS, Roche, AZ UNIVERSITY
More informationSlide 1. Slide 2 Post 1995 Meta-Analysis : Slide 3
Slide 1 Optimal Application of Adjuvant Therapy in NSCLC Heather Wakelee, MD Stanford University, Stanford Cancer Institute Slide 2 Post 1995 Meta-Analysis : NSCLC Randomized Adjuvant Platinum Trials Trial
More informationTreatment of EGFR mutant advanced NSCLC
Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and University Hospital of South Manchester, Manchester, UK Outline Data on first-line Overcoming T790M
More informationStrategies in the therapy of advanced NSCLC SAMO Winter-Conference 2008 on Chest tumors
Strategies in the therapy of advanced NSCLC SAMO Winter-Conference 2008 on Chest tumors Miklos Pless Medical Oncology Kantonsspital Winterthur 2 Setting the stage. 1995: Chemotherapy works! Meta-Analysis
More informationDo You Think Like the Experts? Refining the Management of Advanced NSCLC With ALK Rearrangement. Reference Slides Introduction
Do You Think Like the Experts? Refining the Management of Advanced NSCLC With ALK Rearrangement Reference Slides Introduction EML4-ALK Fusion Oncogene Key Driver in 3% to 7% NSCLC Inversion or Translocation
More informationNivolumab: esperienze italiane nel carcinoma polmonare avanzato
NSCLC avanzato: quali novità nel 2018? Negrar, 30 Ottobre 2018 Nivolumab: esperienze italiane nel carcinoma polmonare avanzato Francesco Grossi UOC Oncologia Medica Fondazione IRCCS Ca Granda Ospedale
More informationLung Cancer Non-small Cell Local, Regional, Small Cell, Other Thoracic Cancers: The Question Isn t Can We, but Should We
Lung Cancer Non-small Cell Local, Regional, Small Cell, Other Thoracic Cancers: The Question Isn t Can We, but Should We Edward Garon, MD, MS Associate Professor Director- Thoracic Oncology Program David
More informationSelection of systemic therapy in Advanced NSCLC based on biological factors. State of the Art
Selection of systemic therapy in Advanced NSCLC based on biological factors State of the Art Giorgio V. Scagliotti University of Torino Department of Clinical & Biological Sciences giorgio.scagliotti@unito.it
More informationSecond-line treatment for advanced NSCLC
UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY Second-line treatment for advanced NSCLC Silvia Novello silvia.novello@unito.it UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY Life was so simple back in 2008 Di
More informationHeather Wakelee, M.D.
Heather Wakelee, M.D. Assistant Professor of Medicine, Oncology Stanford University Sponsored by Educational Grant Support from Adjuvant (Post-Operative) Lung Cancer Chemotherapy Heather Wakelee, M.D.
More informationPractice changing studies in lung cancer 2017
1 Practice changing studies in lung cancer 2017 Rolf Stahel University Hospital of Zürich Cape Town, February 16, 2018 DISCLOSURE OF INTEREST Consultant or Advisory Role in the last two years I have received
More informationSlide 1. Slide 2. Slide 3. Individualized Therapy in Lung Cancer : Where are we in 2011? Notable Advances in Cancer Research in the last 2 years
Slide 1 Individualized Therapy in Lung Cancer : Where are we in 2011? Giorgio V. Scagliotti University of Torino Department of Clinical & Biological Sciences giorgio.scagliotti@unito.it Slide 2 Notable
More informationNon-small Cell Lung Cancer: Multidisciplinary Role: Role of Medical Oncologist
Non-small Cell Lung Cancer: Multidisciplinary Role: Role of Medical Oncologist Vichien Srimuninnimit, MD. Medical Oncology Division Faculty of Medicine, Siriraj Hospital Outline Resectable NSCLC stage
More informationMedical Treatment of Advanced Lung Cancer
Medical Treatment of Advanced Lung Cancer Oncology for Scientists April 26, 2018 Edwin Yau, MD., Ph.D. Assistant Professor of Oncology Department of Medicine Department of Cancer Genetics and Genomics
More informationAngiogenesis and tumor growth
Anti-angiogenic agents: where we are? Martin Reck Department of Thoracic Oncology Hospital Grosshansdorf Germany Angiogenesis and tumor growth Journal of experimental Medicine 1972; 133: 275-88 1 Angiogenesis
More informationEstado actual del tratamiento neoadyuvante y adyuvante a la cirugía en estadios iniciales de cáncer de pulmón no microcítico
Estado actual del tratamiento neoadyuvante y adyuvante a la cirugía en estadios iniciales de cáncer de pulmón no microcítico Enriqueta Felip Vall d Hebron University Hospital Barcelona, Spain Stage I-II
More informationReview on activated protocols in advanced non-small cell lung cancer. Rolf Stahel Zürich, Switzerland
Review on activated protocols in advanced non-small cell lung cancer Rolf Stahel Zürich, Switzerland Lucerne, 19.1.2008 Case report 1 75 y/o man retired, held many jobs from working as driver, attendant
More informationCombined Modality Therapy State of the Art. Everett E. Vokes The University of Chicago
Combined Modality Therapy State of the Art Everett E. Vokes The University of Chicago What we Know Some patients are cured (20%) Induction and concurrent chemoradiotherapy are each superior to radiotherapy
More informationLudger Sellmann 1, Klaus Fenchel 2, Wolfram C. M. Dempke 3,4. Editorial
Editorial Improved overall survival following tyrosine kinase inhibitor treatment in advanced or metastatic non-small-cell lung cancer the Holy Grail in cancer treatment? Ludger Sellmann 1, Klaus Fenchel
More informationLung Cancer Epidemiology. AJCC Staging 6 th edition
Surgery for stage IIIA NSCLC? Sometimes! Anne S. Tsao, M.D. Associate Professor Director, Mesothelioma Program Director, Thoracic Chemo-Radiation Program May 7, 2011 The University of Texas MD ANDERSON
More informationJoachim Aerts Erasmus MC Rotterdam, Netherlands. Drawing the map: molecular characterization of NSCLC
Joachim Aerts Erasmus MC Rotterdam, Netherlands Drawing the map: molecular characterization of NSCLC Disclosures Honoraria for advisory board/consultancy/speakers fee Eli Lilly Roche Boehringer Ingelheim
More informationSURGICAL GRAND ROUNDS
SURGICAL GRAND ROUNDS David H. Harpole, Jr., M.D. New Options for Achieving Individualized Approaches to Non-small Cell Lung Cancer Management Dr. Harpole has financial relationships with the following
More informationLONDON CANCER NEW DRUGS GROUP RAPID REVIEW. Erlotinib for the third or fourth-line treatment of NSCLC January 2012
Disease background LONDON CANCER NEW DRUGS GROUP RAPID REVIEW Erlotinib for the third or fourth-line treatment of NSCLC January 2012 Lung cancer is the second most common cancer in the UK (after breast),
More informationIndividualized therapy in lung cancer Where are we in 2012?
UNIVERSITY OF OF TORINO DEPARTMENT OF ONCOLOGY Individualized therapy in lung cancer Where are we in 2012? Giorgio V. Scagliotti University of Torino Professor of Medical Oncology Department of Oncology
More informationUnderstanding Options: When Should TKIs be Considered?
Advanced Stage Squamous NSCLC: Evolution and Increasing Complexity of the Therapeutic Landscape Understanding Options: When Should TKIs be Considered? David R. Gandara, MD University of California Davis
More informationSao Paulo, Abril 2014
Tratamento de Manutencao e outros Sao Paulo, Abril 2014 Rogerio C. Lilenbaum, M.D. Professor of Medicine Yale Cancer Center Chief Medical Officer Smilow Cancer Hospital What Is Maintenance Therapy? Use
More informationEGFR-directed monoclonal antibodies in non-small cell lung cancer: how to predict efficacy?
Review Article EGFR-directed monoclonal antibodies in non-small cell lung cancer: how to predict efficacy? Robert Pirker Department of Medicine I, Medical University of Vienna, 1090 Vienna, Austria Corresponding
More informationThe road less travelled: what options are available for patients with advanced squamous cell carcinoma?
Robert Pirker Medical University of Vienna Vienna, Austria The road less travelled: what options are available for patients with advanced squamous cell carcinoma? Disclosures Honoraria for advisory board/consulting
More informationOverview of Lung Cancer :Perspectives from Cancer Genotype. Ji-Youn Han, MD, PhD. Center for Lung Cancer National Cancer Center
Overview of Lung Cancer :Perspectives from Cancer Genotype Ji-Youn Han, MD, PhD. Center for Lung Cancer National Cancer Center Histologic classification of lung cancer Therapeutic plateau reached with
More informationHead and Neck Cancer:
Head and Neck Cancer: Robert Haddad M.D. Clinical Director Head and Neck Oncology Program Dana Farber Cancer Institute Boston, MA Predictive Biomarkers: HPV Abstract 6003: Survival Outcomes By HPV Status
More informationKey Words. Erlotinib Non-small cell lung cancer Maintenance treatment
The Oncologist Regulatory Issues: FDA The Oncologist CME Program is located online at http://cme.theoncologist.com/. To take the CME activity related to this article, you must be a registered user. Approval
More informationPERIOPERATIVE TREATMENT OF NON SMALL CELL LUNG CANCER. Virginie Westeel Chest Disease Department University Hospital Besançon, France
PERIOPERATIVE TREATMENT OF NON SMALL CELL LUNG CANCER Virginie Westeel Chest Disease Department University Hospital Besançon, France LEARNING OBJECTIVES 1. To understand the potential of perioperative
More informationConversations in Oncology. November Kerry Hotel Pudong, Shanghai China
Conversations in Oncology November 12-13 Kerry Hotel Pudong, Shanghai China Immunotherapy of Lung Cancer Professor Caicun Zhou All materials are for scientific exchanges. Afatinib and nintedanib are not
More informationΕλλάδα Ελευθεριάδου Ειδικός Πνευμονολόγος Επιστημονική συνεργάτης της Πνευμονολογικής Κλινικής ΑΠΘ Νοσοκομείου Παπανικολάου και υποψήφια διδάκτορας
Ελλάδα Ελευθεριάδου Ειδικός Πνευμονολόγος Επιστημονική συνεργάτης της Πνευμονολογικής Κλινικής ΑΠΘ Νοσοκομείου Παπανικολάου και υποψήφια διδάκτορας ΑΠΘ Μετεγχειριτική αντιμετώπιση του ΜΜΚΠ Significant
More informationPatient Selection: The Search for Immunotherapy Biomarkers
Patient Selection: The Search for Immunotherapy Biomarkers Mark A. Socinski, MD Executive Medical Director Florida Hospital Cancer Institute Orlando, Florida Patient Selection Clinical smoking status Histologic
More informationOverall survival with afatinib versus chemotherapy in patients with NSCLC harboring common EGFR
Overall survival with afatinib versus chemotherapy in patients with NSCLC harboring common EGFR mutations: subgroup analyses by race/ethnicity in LUX-Lung 3 and LUX-Lung 6 Yi-Long Wu, 1 Lecia V Sequist,
More informationHOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY
HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering
More informationcontinuing education Non-small cell lung cancer: Molecular targets and emerging options for care Daniel Morgensztern, MD
continuing education educational objectives After participating in this activity, clinicians should be better able to Perform diagnostic/molecular testing (EGFR, KRAS, EML4-ALK) for NSCLC according to
More informationSponsor / Company: Sanofi Drug substance(s): Docetaxel (Taxotere )
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance(s):
More informationSystemic therapy for Non-Small Cell Lung Cancer in 2013 (What you should know)
Systemic therapy for Non-Small Cell Lung Cancer in 2013 (What you should know) นายแพทย ช ยย ทธ ย ทธ เจร ญธรรม หน วยมะเร งว ทยา ภาคว ชาอาย ร อาย รศาสตร Inter-hospitol Conference, 16 th March 2013 Systemic
More informationAgenda. 6:30pm 7:00pm. Dinner. 7:00pm 7:15pm. NSCLC Treatment in 2014: Focus on Use of 2nd Generation TKIs in Clinical Practice.
Agenda 6:30pm 7:00pm Dinner 7:00pm 7:15pm Welcome and Introductions Natasha Leighl, MD 7:15pm 7:50pm 7:50pm 8:00pm NSCLC Treatment in 2014: Focus on Use of 2nd Generation TKIs in Clinical Practice Questions
More informationTratamiento de la enfermedad avanzada en cáncer de pulmón
Tratamiento de la enfermedad avanzada en cáncer de pulmón S. Ponce Aix! S. Oncología Médica Hospital Universitario 12 de Octubre Madrid Survival by stage NSCLC Stage Distribution NSCLC Stage 5-year Survival
More informationThe Evolving Role of Adjuvant Therapies
Therapy-predictive markers for adjuvant chemotherapy The Evolving Role of Adjuvant Therapies Micrometastasis Prognostic Markers (BRCA1) Cured No Further Tx Chemosensitive Rafael Rosell th European Perspectives
More informationTreatment of EGFR-Mutation+ NSCLC in 1st- and 2nd-Line
Treatment of EGFR-Mutation+ NSCLC in 1st- and 2nd-Line Martin Reck David F. Heigener Department of Thoracic Oncology Hospital Grosshansdorf Germany Identification of driver mutation in tumor specimens
More informationTreatment of advanced NSCLC in 2013: Algorithm, failures, and perspectives
Treatment of advanced NSCLC in 2013: Algorithm, failures, and perspectives Prof. Christian Manegold Medical Faculty Mannheim University of Heidelberg Disclosures Consultancy: Hoffmann-La Roche, Pfizer,
More informationVirtual Journal Club: Front-Line Therapy and Beyond Recent Perspectives on ALK-Positive Non-Small Cell Lung Cancer.
Virtual Journal Club: Front-Line Therapy and Beyond Recent Perspectives on ALK-Positive Non-Small Cell Lung Cancer Reference Slides ALK Rearrangement in NSCLC ALK (anaplastic lymphoma kinase) is a receptor
More informationMolecular Targets in Lung Cancer
Molecular Targets in Lung Cancer Robert Ramirez, DO, FACP Thoracic and Neuroendocrine Oncology November 18 th, 2016 Disclosures Consulting and speaker fees for Ipsen Pharmaceuticals, AstraZeneca and Merck
More informationPRACTICE GUIDELINE SERIES
ELLIS et al. PRACTICE GUIDELINE SERIES The role of the epidermal growth factor receptor tyrosine kinase inhibitors as therapy for advanced, metastatic, and recurrent nonsmall-cell lung cancer: a Canadian
More informationBiomarkers in oncology drug development
Biomarkers in oncology drug development Andrew Stone Stone Biostatistics Ltd EFSPI Biomarkers and Subgroups June 2016 E: andrew@stonebiostatistics.com T: +44 (0) 7919 211836 W: stonebiostatistics.com available
More informationLung Cancer: Personalized Approaches to Non-Small Cell and Small Cell Lung Cancer
Lung Cancer: Personalized Approaches to Non-Small Cell and Small Cell Lung Cancer Speaker: Bruce E. Johnson, MD Chief Clinical Research Officer, Dana-Farber Cancer Institute Professor of Medicine, Harvard
More informationin combination with cisplatin as first-line doublet 3 as maintenance agent following non-pemetrexed platinum doublet 4
Overall survival (OS) results from PARAMOUNT study of maintenance plus best supportive care (BSC) versus plus BSC, immediately after induction with - Cisplatin, in patients with advanced Nonsquamous Non-small
More informationThe Evolving Management
The Evolving Management of Advanced Lung Cancer CAGPO October 19th, 2013 M. Vincent Professor MB ChB, FRCPC, MRCP(UK) (Senate Stream) Dept. of Oncology Staff Medical Oncologist Thoracic & GI MDT London
More informationTake home message. Emilio Bria. II SESSIONE: Immunoterapia nel tumore del polmone
II SESSIONE: Immunoterapia nel tumore del polmone Take home message Emilio Bria Oncologia, Dipart. di Medicina, Università di Verona, Az. Osp. Univ. Int., Verona emilio.bria@univr.it Roma, 28 Marzo 2017
More informationLUNG CANCER TREATMENT: AN OVERVIEW
LUNG CANCER TREATMENT: AN OVERVIEW KONSTANTINOS N. SYRIGOS, M.D., Ph.D. Αναπλ. Καθηγητής Παθολογίας-Ογκολογίας, Ιατρικής Σχολής Αθηνών. Διευθυντής Ογκολογικής Μονάδας, Νοσ. «Η Σωτηρία». Visiting Professor
More informationImmunotherapy in the clinic. Lung Cancer. Marga Majem 20 octubre 2017
Immunotherapy in the clinic. Lung Cancer Marga Majem 20 octubre 2017 mmajem@santpau.cat Immunotherapy in the clinic. Lung Cancer Agenda Where we come from? Immunotherapy in Second line Immunotherapy in
More information