Interleukin-16 (IL-16) Gene Polymorphisms in Iranian Patients with Colorectal Cancer

Transcription

1 Interleukin-16 (IL-16) Gene Polymorphisms in Iranian Patients with Colorectal Cancer Pedram Azimzadeh, Sara Romani, Seyed Reza Mohebbi, Shabnam Kazemian, Mohsen Vahedi, Shohreh Almasi, Seyed Reza Fatemi, Mohammad Reza Zali Research Center for Gastroenterology and Liver Diseases Shahid Beheshti University of Medical Sciences, Tehran, Iran Abstract Background & Aims: A number of theories have been put forward to clarify the etiology of colorectal cancer (CRC), such as genetic alterations and cytokine production. A combination of inflammatory cytokines has an important role in cancer development. The aim of our study was to screen for alterations located in promoter and exons of IL-16 gene sequence, to determine the distribution of genotypes in individuals with CRC and healthy controls in a sample of Iranian population. Methods: The case group consisted of 260 individuals with colorectal cancer and the control group included 405 healthy individuals. Three IL-16 gene polymorphisms (rs , rs , rs ) were genotyped using PCR-RFLP method. RFLP results were confirmed by direct sequencing. Results: A significant association between rs SNP in the IL-16 gene and the risk of CRC was found. The TG genotype of rs T/G polymorphism showed significant association with a 1.75 fold increased risk of CRC (P=0.005; adjusted OR: 1.759; 95% CI: ). In addition a significant association between CC genotype of rs T/C polymorphism and decreased risk of CRC in male subjects (P=0.045; adjusted OR: 0.192; 95% CI: ) was determined. Conclusion: This study is the first report of IL-16 gene polymorphisms among CRC patients from Iran. Our results suggest an influence of rs T>G and rs T/C polymorphisms on the altered risk of CRC. Key words Interleukin-16 single nucleotide polymorphism genetic predisposition to disease colorectal cancer. Received: Accepted: J Gastrointestin Liver Dis December 2011 Vol. 20 No 4, Address for correspondence: Seyed Reza Mohebbi Research Center for Gastroenterology and Liver Diseases Shahid Beheshti University of Medical Sciences, Tehran, Iran srmohebbi@rigld.ir Introduction Colorectal cancer is the fourth common cause of cancer and the third common cause of cancer-related deaths worldwide [1]. A number of theories have been put forward to clarify the etiology of colorectal cancer (CRC), such as genetic alterations and cytokine production [2-5]. Interleukin- 16 (IL-16) is a multifunctional cytokine that was initially recognized as a chemotactic factor known as a lymphocyte chemo attractant factor. IL-16 along with several other cytokines including IL-1, IL-6, IL-8, IL-11, IL-17, Eotaxin and Tumor necrosis factors (TNF) (α and β) are part of a group named chronic inflammation cytokines [6, 7]. These cytokines act as the mediators of systemic or tissue specific inflammation. Altered production of such immune mediators could affect the tissue resident cells such as macrophages and endothelial cells, and may result in a systemic response to an inflammatory reaction [3, 6, 8]. The gene encoding IL-16 cytokine consists of 8 exons spanning approximately 17 kb of genomic DNA and located on chromosome 15q26.3 in the human genome [9, 10]. There are two isoforms of IL-16 protein, leukocyte IL-16 and neuronal IL-16 which are named as isoforms 1 and 2 respectively [9, 11]. Several studies have focused on a close association between inflammatory factors such as pro inflammatory cytokines and cancers [12, 13]. A combination of inflammatory cytokines that is produced by epithelial cells of the colon and rectum in the tumor microenvironment might have an important role in cancer development [8, 14, 15]. There are polymorphisms located within the regulatory and coding regions that could influence the gene transcription and cause person-to-person deviation in the IL-16 production [16, 17]. Information about the relationship of IL-16 polymorphism and CRC in the Iranian population does not exist. For our study we selected three previously validated single nucleotide polymorphisms (SNPs) of IL-16 gene that include non-synonymous SNP C/T Ser (Serine) to Pro (Proline) substitution (rs ), a T/G Asn (Asparagine) to Lys (Lysine) substitution in exon 6 of IL-16 gene sequence (rs ) and common SNP T/C located at 295 bp upstream from the start site of transcription that is associated

2 372 Azimzadeh et al with an expression level of IL-16 protein (rs ) [18, 19]. The aim of our study was to screen for single nucleotide polymorphisms located in promoter and exons of IL-16 gene sequence, to determine the distribution of genotypes in individuals with CRC and healthy controls in a sample of the Iranian population. However, in this new study, we evaluated the relationship between the polymorphisms of IL-16 gene and CRC in our population. Methods A total of 665 unrelated Iranian subjects enrolled in this study. The case group consisted of 260 individuals (mean age 56.3 years) who were referred to the Research Center for Gastroenterology and Liver Diseases (RCGLD), Shahid Beheshti University of Medical Sciences, with positive colonoscopy and pathology results for a colon or rectum malignant tumor. The control group included 405 healthy individuals (mean age 45.3 years) without family history of gastrointestinal disorders. All controls had eligible colonoscopy results with no malignant tumors, adenomatous polyps or inflammatory ulcers. This study was confirmed by the Ethics Committee of the Research Center for Gastroenterology and Liver diseases, Shahid Beheshti University of Medical Sciences. Genomic DNA was isolated from 5ml of peripheral blood leukocytes using the standard phenol-chloroform method. Genotype determination was performed by polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP). Characteristics of restriction enzymes used for RFLP and PCR primer sequences are summarized in Table I. The RFLP products (digested PCR products) were electrophoresed on a 2.5% low electroendosmosis Agarose gel and stained with ethidium bromide to visualize the fragments using an UV gel documentation instrument (Vilber Lourmat, France). To confirm the genotyping results with RFLP method, 10 percent of samples were sequenced using an automated genetic analyzer 3130xl (Applied Biosystems, USA) and the results were fully concordant. The Student s t test was performed to assay the statistical significance of age and BMI. The chi-square test was used for comparisons of the distribution of the allele and genotype frequencies. Hardy Weinberg equilibrium was tested with the chi-square test to compare the observed genotype frequencies among studied cases and controls with the expected genotype frequencies. Logistic regression was applied to calculate odds ratio (OR) and 95% confidence intervals and to adjust the data for confounding factors such as age and gender. P values less than 0.05 were considered significant and the SPSS statistical software version 13 was used for all the statistical analyses. Results Two hundred and sixty patients with the diagnosis of CRC were studied including 139 males (53.5%) and 121 females (46.5%). The control group consisted of 405 non-cancer subjects, 196 males (48.4%) and 209 females (51.6%). The percentage of male and female subjects in the two studied groups was not significantly different (P>0.05). As revealed in Table II, the mean age of the CRC group was significantly higher than that in the healthy controls group (P<0.05). To remove the effect of age variation as a confusing factor, we used the logistic regression method for adjustment of data. No significant differences were found between the CRC group and healthy controls when we investigated the BMI and smoking behavior (P>0.05). There was no significant deviation in the genotype frequency of rs and rs polymorphisms from the Hardy-Weinberg equilibrium (P>0.05) but the rs genotypes were not fitted to this equilibrium (P=0.002). To resolve the deviation, we increased the number of control subjects, but the deviation remained. To our knowledge Table I. Information for the studied SNPs in Interleukin-16 gene sequence. SNPs (Reference sequence) Location (Base change) Primer sequence rs (C/T) Forward primer: 5 - CACTGTGATCCCGGTCCAGTC-3 Reverse primer: 5 - TTCAGGTACAAACCCAGCCAG C -3 [18] rs (T/G) Forward primer: 5 -GCTCAGGTTCACAGAGTGTTTCCATA-3 Reverse primer: 5 -TGTGACAATCACAGCTTGCCTG-3 [18] rs (T/C) Forward primer: 5 -CTCCACACTCAAAGCCTTTTGTTCCTATG a A-3 Reverse primer: 5 -ATACACGCTGGTTCCTTCTGT -3 [18] PCR product size (bp) Restriction Enzyme (Incubation temperature C) RFLP fragments size (bp) 164 BsmAI (55) C: 164 T: Nde I (37) T: 171 G: AhdI (37) T: 280 C: a The underlined base in the forward primer is different from that of the original sequence and serves as the introduction of a recognition site for the restriction enzyme AhdI.

3 IL-16 gene polymorphisms and colorectal cancer 373 Table II. Characteristics of studied population Variables Controls Cases Pvalue (n=405) (n=260) Age 45.3 ± ± 12 <0.001 (Mean ± SD) a BMI a ± ± Gender, b Male 196 (48.4) 139 (53.5) Female 209 (51.6) 121 (46.5) Smoking b Smoker 47 (11.6) 36 (13.8) Non-Smoker 358 (88.4) 224 (86.2) Tumor location Colon _ 183 (70.4) - Rectum 77 (29.6) a According to the Student s t-test results; b According to the chisquare test results. this deviation could be related to sample size, selection of cases, ethnic diversity, or the incomplete panmixia of Iranian population. In case-control genetic association studies, a main concern is that the population may consist of hidden subpopulations, also known as population stratification. So we can explain this problem by a hidden subpopulation stratification [20, 21]. We found a significant association between the rs SNP in the IL-16 gene and the risk of CRC. The TG genotype of rs T/G polymorphism showed a significant association with a 1.75 fold, increased risk of CRC (P: 0.005; adjusted OR: 1.759; 95% CI: ). There was no significant difference in the distribution of IL-16 gene rs C/T and rs T/C polymorphisms genotypes and the two allelic forms, when CRC patients were compared with the healthy control group. The distribution of allele and genotype frequency for three selected SNPs among the healthy controls and the CRC cases are summarized in Table III. In the overall studied samples, the rs T/C polymorphism was not significantly associated with a CRC risk. On the other hand, after stratification of the data (Table IV) by gender, a significant association between CC genotype of rs T/C polymorphism and decrease of CRC risk in male subjects (P= 0.045; adjusted OR: 0.192; 95% CI: ) was found. Also men who carried TG genotype for rs polymorphism in the IL-16 gene sequence, were associated with an increased risk of CRC (P= 0.036; adjusted OR: 1.778; 95% CI: ). Table III. Allele and genotype distribution of three studied SNPs among CRC patients and healthy control subjects. SNP Variable Controls (n=405) rs Genotypes Cases (n=260) Adjusted* OR (95%CI), P value CC 324 (80.0) 196 (75.4) 1.00 (Reference) CT 77 (19.0) 56 (21.5) ( ), TT 4 (1.0) 8 (3.1) ( ), Alleles C 725 (89.5) 448 (86.2) 1.00 (Reference) T 85 (10.5) 72 (13.8) ( ), rs Genotypes TT 124 (30.6) 62 (23.8) 1.00 (Reference) TG 226 (55.8) 178 (68.5) ( ), GG 55 (13.6) 20 (7.7) ( ), Alleles T 474 (58.5) 302 (58.1) 1.00 (Reference) G 336 (41.5) 218 (41.9) ( ), rs Genotypes TT 274 (67.7) 178 (68.5) 1.00 (Reference) TC 112 (27.7) 73 (28.1) ( ), CC 19 (4.7) 9 (3.5) ( ), Alleles T 660 (81.5) 429 (82.5) 1.00 (Reference) C 150 (18.5) 91 (17.5) ( ), * Adjusted for confounder variables such as Age and Gender.

4 374 Azimzadeh et al Table IV. Stratification analysis of three studied polymorphisms according to gender groups. SNP Variable Male Female Controls (n=196) Cases (n=139) Adjusted* OR (95% CI), p value Controls (n=209) Cases (n=121) Adjusted* OR (95% CI), P value rs Genotypes, CC 155 (79.1) 102 (73.4) 1.00 (Reference) 169 (80.9) 94 (77.7) 1.00 (Reference) CT 38 (19.4) 35 (25.2) ( ), (18.7) 21 (17.4) ( ), TT 3 (1.5) 2 (1.4) ( ), (0.5) 6 (5.0) ( ), Alleles, C 348 (88.8) 239 (86.0) 1.00 (Reference) 337 (89.2) 209 (86.4) 1.00 (Reference) T 44 (11.2) 39 (14.0) ( ), (10.8) 33 (13.6) ( ), rs Genotypes, TT 61 (31.1) 34 (24.5) 1.00 (Reference) 63 (30.1) 28 (23.1) 1.00 (Reference) TG 107 (54.6) 93 (66.9) ( ), (56.9) 85 (70.2) ( ), GG 28 (14.3) 12 (8.6) ( ), (12.9) 8 (6.6) ( ), Alleles, T 229 (58.4) 161 (57.9) 1.00 (Reference) 245 (58.6) 185 (64.7) 1.00 (Reference) G 163 (41.6) 117 (42.1) ( ), (41.4) 101 (35.3) ( ), rs Genotypes, TT 129 (65.8) 95 (68.3) 1.00 (Reference) 145 (69.4) 83 (68.6) 1.00 (Reference) TC 56 (28.6) 42 (30.2) ( ), (26.8) 31 (25.6) ( ), CC 11 (5.6) 2 (1.4) ( ), (3.8) 7 (5.8) ( ), Alleles, T 314 ( 80.1) 232 ( 83.5) 1.00 (Reference) 346 ( 82.8) 197 ( 81.4) 1.00 (Reference) C 78 ( 19.9) 46 ( 16.5) ( ), ( 17.2) 45 (18.6%) ( ), * Adjusted for age as a confounder variable. Dicussion According to consequential roles that are considered for cytokines in the immune response regulation process, probable variations in cytokine genes or expression may have traceable effects on an individual s susceptibility to colorectal cancer [22-24]. Influence of genetic alterations regarding the increase or decrease of the risk of cancer development has been proven by several investigations [2, 5, 25, 26]. Few studies have directly examined the mechanisms in which IL-16 is involved in cancer development and the definite mechanism by which IL-16 is involved in cancer development and progression is still under evaluation [18]. Patients with inflammatory bowel disorders are at risk for cancers of the colon and rectum [27]. Interleukin-16 is a multifunctional cytokine involved in many inflammatory disorders. This cytokine can stimulate the production of several proinflammatory cytokines such as the TNF-α, IL- 1b, IL-6 by mononuclear cells [28]. Disregulation of these cytokines could promote the development and progression of human gastric and colon carcinoma [29-31]. IL-16 as a modulator of T-cell activation also could affect the mononuclear cells of peripheral blood and its subpopulations. IL-16 has been shown to induce the expression of the TNF-α which plays an important role in apoptosis and cell survival (major tumorgenesis mechanisms) and these phenomena do propose a pathophysiological task for IL-16 as a mediator of cancer [32, 33]. We conducted a case-controlled study to explain the possible association between IL-16 gene sequence variations and the risk of CRC among Iranian population. To our knowledge, there is only one study that has examined these polymorphisms of IL-16 gene among CRC patients so far. Gao et al in 2009 [18] performed similar SNP genotyping to our approaches and have shown the same SNP profiles

5 IL-16 gene polymorphisms and colorectal cancer 375 regarding our results with some exceptions. They reported an association between the IL-16 rs T>G gene polymorphism with colorectal and gastric cancer (GC), and a significant difference in the distribution of rs T>G genotypes when the CRC and GC group and healthy controls from both genders were compared. They also reported that IL-16 rs T allele is less frequent in women of CRC and GC groups in comparison with healthy women. The result suggests that this non-synonymous polymorphism is associated with the risk of CRC development in female subjects. In this present study a TG genotype associated with an increasing risk of CRC that is consistent with a previous study was evidenced. On the other hand, we did not find any statistically difference between the distribution of rs T allele and CRC that was not consistent with the mentioned study. Several studies of inflammatory and autoimmune diseases suggest an association between the IL-16 gene polymorphisms and an increased risk of diseases. Xue et al in 2008 [34] examined the distribution of the rs T>G, rs T/C and rs C/T variants of IL-16 gene sequence among systemic lupus erythematosus (SLE) patients and healthy controls. They found a significant difference between all three SNPs and susceptibility to SLE in a Chinese population. Gu et al in 2008 [10] performed a study to determine whether the polymorphisms of IL-16 gene contributes to the risk for Graves disease. Finally, the rs T/C polymorphism was reported to have a significant association with the increased susceptibility to Graves disease. Despite the results of Gao et al in 2009 [18] who reported the lack of an association between the IL-16 gene rs T/C polymorphism and CRC risk, we found a CC genotype of this polymorphism associated with a CRC risk among male subjects. On the other hand, Zhu et al in 2010 [35] reported a significant association between CC genotype of rs T/C polymorphism and decreased risk of renal cell carcinoma (RCC), and Gao et al in 2009 [36] performed a study on a group of nasopharyngeal carcinoma patients and found TG genotype of rs polymorphism associated with a higher risk of the disease as compared with the TT genotype. As a final point, previous studies have shown that rs T>G polymorphism is associated with risks of CRC, GC [18], SLE [34] and NPC [36], rs C/T polymorphism is associated with a risk of CRC, GC [18] and SLE [34], rs T/C polymorphism is associated with RCC [35] and an endometriosis [37] risk and is not associated with asthma [38]. Conclusion This preliminary study was the first report of IL-16 gene polymorphisms among CRC patients from Iran. Our results suggest an influence of rs T>G and rs T/C polymorphisms on the altered risk of CRC. The mechanisms by which the IL-16 gene polymorphisms affect the risk of CRC remain unclear. Further studies in different populations are needed to validate these results. Conflicts of interest None to declare. Acknowledgements The present project was supported by the Research Center for Gastroenterology and Liver Diseases (RCGLD), Shahid Beheshti University of Medical sciences, Tehran, Iran. The authors would like to thank the RCGLD lab staff Mahsa Khanyaghma, Hanieh Mirtalebi and Farahnaz Jabbarian for their valuable technical assistance. References 1. Moghimi-Dehkordi B, Safaee A, Zali MR. Prognostic factors in 1,138 iranian colorectal cancer patients. Int J Colorectal Dis 2008; 23: Lubbe SJ, Pittman AM, Matijssen C, et al. Evaluation of germline Bmp4 mutation as a cause of colorectal cancer. Hum Mutat 2011; 32(1): E1928-E Grivennikov SI, Karin M. Inflammatory cytokines in cancer: tumour necrosis factor and interleukin 6 take the stage. Ann Rheum Dis 2011; 70(Suppl 1): i Klampfer L. Cytokines, inflammation and colon cancer. Curr Cancer Drug Targets 2011; 11: Loktionov A. Common gene polymorphisms, cancer progression and prognosis. Cancer Lett 2004; 208: Feghali CA, Wright TM. Cytokines in Acute and Chronic Inflammation. Front Biosci 1997; 1(2): d Aukrust P, Gullestad L, Ueland T, Damas JK, Yndestad A. Inflammatory and anti-inflammatory cytokines in chronic heart failure: potential therapeutic implications. Ann Med 2005; 37: Fantini MC, Pallone F. Cytokines: from gut inflammation to colorectal cancer. Curr Drug Targets 2008; 9: Kim HS. Assignment of human interleukin 16 (IL16) to chromosome 15q26.3 by radiation hybrid mapping. Cytogenet Cell Genet 1999; 84: Gu XJ, Cui B, Zhao ZF, et al. Association of the interleukin (IL)-16 gene polymorphisms with Graves disease. Clin Immunol 2008; 127: Bannert N, Vollhardt K, Asomuddinov B, et al. PDZ Domainmediated interaction of interleukin-16 precursor proteins with myosin phosphatase targeting subunits. J Biol Chem 2003; 278: Coussens LM, Werb Z. Inflammation and cancer. Nature 2002; 420: Lu H, Ouyang W, Huang C. Inflammation, a key event in cancer development. Mol Cancer Res 2006; 4: Sheu BC, Chang WC, Cheng CY, Lin HH, Chang DY, Huang SC. Cytokine regulation networks in the cancer microenvironment. Front Biosci 2008; 13: Rakoff-Nahoum S. Why cancer and inflammation? Yale J Biol Med 2006; 79: YIlmaz V, Yentür SP, Saruhan-Direskeneli G. IL-12 and IL-10 polymorphisms and their effects on cytokine production. Cytokine 2005; 30:

6 376 Azimzadeh et al 17. Lio D, Scola L, Crivello A, et al. Inflammation, genetics, and longevity: further studies on the protective effects in men of IL promoter SNP and its interaction with TNF-Α -308 promoter SNP. Journal of medical genetics 2003; 40: Gao LB, Rao L, Wang YY, et al. The association of interleukin-16 polymorphisms with IL-16 serum levels and risk of colorectal and gastric cancer. Carcinogenesis 2009; 30: Nakayama EE, Wasi C, Ajisawa A, Iwamoto A, Shioda T. A new polymorphism in the promoter region of the human interleukin-16 (IL-16) gene. Genes Immun 2000; 1: Khlat M, Cazes MH, Génin E, Guiguet M. Robustness of case-control studies of genetic factors to population stratification: magnitude of bias and type I error. Cancer Epidemiol Biomarkers Prev 2004; 13: Wang L, Li Q, Li Z, Zheng G. Bayes Factors in the Presence of Population Stratification. Stat Probab Lett 2011; 81: Ramensky V, Bork P, Sunyaev S. Human non-synonymous SNPs: server and survey. Nucleic Acids Res 2002; 30: Risch N, Merikangas K. The future of genetic studies of complex human diseases. Science 1996; 273: Lin WW, Karin M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J Clin Invest 2007; 117: Park K, Woo M, Nam J, Kim JC. Start codon polymorphisms in the vitamin D receptor and colorectal cancer risk. Cancer Lett 2006; 237: Mahmoudi T, Mohebbi SR, Pourhoseingholi MA, Fatemi SR, Zali MR. Vitamin D receptor gene apai polymorphism is associated with susceptibility to colorectal cancer. Dig Dis Sci 2010; 55: Itzkowitz SH, Yio X. Inflammation and cancer IV. Colorectal cancer in inflammatory bowel disease: the role of inflammation. Am J Physiol Gastrointest Liver Physiol 2004; 287: G7-G Mathy NL, Scheuer W, Lanzendörfer M, et al. Interleukin 16 stimulates the expression and production of pro inflammatory cytokines by human monocytes. Immunology 2000; 100: Mochizuki Y, Nakanishi H, Kodera Y, et al. TNF-alpha promotes progression of peritoneal metastasis as demonstrated using a green fluorescence protein (GFP)-Tagged human gastric cancer cell line. Clin Exp Metastasis 2004; 21: Muc-Wierzgon M, Nowakowska-Zajdel E, Kokot T, et al. Genetic disregulation of TNF alpha and TNF alpha type II receptors in colon cancer at the II and III stage of disease. J Biol Regul Homeost Agents 2006; 20: Apte RN, Dotan S, Elkabets M, et al. The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev 2006; 25: van Horssen R, Ten Hagen TL, Eggermont AM. TNF-alpha in cancer treatment: molecular insights, antitumor effects, and clinical utility. Oncologist 2006; 11: Lejeune FJ, Ruegg C, Lienard D. Clinical applications of TNF-alpha in cancer. Curr Opin Immunol 1998; 10: Xue H, Gao L, Wu Y, et al. The IL-16 gene polymorphisms and the risk of the systemic lupus erythematosus. Clin Chim Acta 2009; 403: Zhu J, Qin C, Yan F, et al. IL-16 polymorphism and risk of renal cell carcinoma: association in a Chinese population. Int J Urol 2010; 17: Gao LB, Liang WB, Xue H, et al. Genetic polymorphism of interleukin-16 and risk of nasopharyngeal carcinoma. Clin Chim Acta 2009; 409: Gan XL, Lin YH, Zhang Y, Yu TH, Hu LN. Association of an Interleukin-16 Gene Polymorphism with the Risk and Pain Phenotype of Endometriosis. DNA Cell Biol 2010; 29: Hosseini-Farahabadi S, Tavakkol-Afshari J, Rafatpanah H, Farid Hosseini R, Khaje Daluei M. Association between the polymorphisms of IL-4 gene promoter (-590C>T), IL-13 coding region (R130Q) and IL-16 gene promoter (-295T>C) and allergic asthma. Iran J Allergy Asthma Immunol 2007; 6: 9-14.