Methylation in Squamous Cell Carcinoma and Precancerous Lesions of the Cervix Uteri

Transcription

1 J Korean Med Sci 2005; 20: ISSN Coyright The Korean Academy of Medical Sciences Estein-Barr Virus and 16 INK4A Methylation in Squamous Cell Carcinoma and Precancerous Lesions of the Cervix Uteri Methylation of 16 is an imortant mechanism in cervical carcinogenesis. However, the relationshi between cervical squamous cell carcinoma (SCC) and Estein-Barr virus (EBV) remains controversial. Here, we exlored whether EBV infection and/or 16 gene inactivation would lay any role in cervical carcinogenesis. Eighty-two secimens included 41 invasive SCCs, 30 cervical intraeithelial neolasm (CIN; CIN 1, 11 cases, CIN II, 3 cases, CIN III 16 cases) and 11 nonneolastic cervices. EBV was detected by olymerase chain reaction (PCR) for EBNA-1 and in situ hybridization for EBER-1. The 16 methylation-status and the exression of 16 rotein were studied by methylation-secific PCR and immunohistochemistry, resectively. The materials were divided into four grous: 1) nonneolastic cervices, 2) CIN I, 3) CIN II-III and 4) invasive SCCs. 16 methylation and 16 immunoexressions increased in CIN and invasive SCCs than nonneolastic tissue. 16-methylation and 16-immunoreactivities were higher in the EBV-ositive grou (=0.009, < 0.001) than in the EBV-negative grou. EBV was detected more frequently in CIN and SCCs than nonneolastic cervices. In conclusion, a correlation between 16 methylation, 16 immunoreactivity and the detection of EBV strongly suggested that the cooeration of EBV and 16 gene may lay a synergic effect on cell cycle deregulation. Key Words : Protein 16; Methylation; Heresvirus 4, Human; Estein-Barr Virus Infections; Cervix Neolasms; Carcinogenesis Na Rae Kim, Zhenhua Lin*, Kyong Rae Kim, Hyun Yee Cho, Insun Kim* Deartment of Pathology, Gachon Medical School Gil Medical Center, Incheon; Deartment of Pathology*, Guro Hosital, Korea University College of Medicine, Seoul; Deartment of Surgery, College of Medicine, Konkuk University, Chungju, Korea Received : 5 November 2004 Acceted : 31 March 2005 Address for corresondence Insun Kim, M.D. Deartment of Pathology, Guro Hosital, Korea University School of Medicine, 80 Guro-dong, Guro-gu, Seoul , Korea Tel : , Fax : iskim@korea.ac.kr *This study was suorted by Brain Korea 21 Task Force. INTRODUCTION The 16 gene is one of the cell cycle regulating genes and encodes a nuclear rotein, 16 which inhibits the D-tye cyclin/cyclin-deendent kinase comlexes that hoshorylate the retinoblastoma gene roduct (Rb), thus blocking G1-S cycle rogression (1, 2). The inactivation of 16 tumor suressor gene romotes cell roliferation, and is found in many different tyes of carcinomas such as gastric carcinoma, bladder tumor, glioma, breast cancer and head and neck tumors (3). There is comelling evidence that the inactivation of 16 is an imortant genetic event in immortalization of keratinocytes (4). In revious studies of the 16 in cervical carcinomas, methylation secific olymerase chain reaction (PCR) has shown a high level of methylation (1, 5), concordant with reorts that the 16 gene is frequently inactivated through methylation rather than mutation or deletion. DNA methylation is a frequent eigenetic event in many human cancers (6, 7), and the factors inducing methylation remain unclear, but structural abnormalities of local DNA, and exosure to heavy metals are only known causes (8). A growing number of cancer-related genes are being recognized for the resence of dense methylation of cytosine in normally unmethylated CG-rich sequences, called CG islands within the 5 gene romoter regions. Besides 16 gene inactivation, viral infection also articiates in the dysregulation of cell cycle. A clear relationshi between human aillomavirus (HPV) and cervical squamous cell carcinomas (SCCs) is well established; HPV-infected invasive SCCs tend to exress more immunoreactivity for 16 rotein or 16 methylation status than do HPV-negative cervical carcinomas, which is now regarded as surrogate biomarkers of HPV infection along with Ki-67 labeling index (5, 9, 10). Estein-Barr virus (EBV) was suggested as another oncogenic virus in cervical carcinogenesis, based on findings of clonal nature of EBV in cervical carcinoma cells and the resence of EBV in recancerous lesions of the cervix (11). Since then, much debate has been evoked because of divergent results including a relatively high revalence rate of EBV-ositive nonneolastic cervical tissue, which shed doubt on the ossibility. However, heterogeneous reorts on lymhoeithelioma-like carcinoma of the uterine cervix in Asian women showing a higher EBV infection (12), and the co-work of HPV and EBV cannot exclude EBV s direct, or indirect imact 636

2 EBV and 16 Methylation in Cervical Cancer 637 on cervical carcinogenesis (7, 11, 13). Considering that the tumors like gastric or nasoharyngeal carcinomas, which are known to be closely related with EBV s oncogenic effects, were identified in a high frequency of 16 methylation (14, 15), a close relationshi exists between EBV and 16 gene. In Korea, one study about HPB and 16 methylation has been retrieved (16), and few studies about EBV detection or 16 alterations in cervical carcinomas have been retrieved (17, 18). There is, however, virtually no ublished information on the methylation changes during the multistage athogenesis of EBV-related cervical lesions. In this study, we exlored EBV infection of the uterine cervix with reference to 16 gene that is frequently methylated in cervical carcinomas. Moreover, we investigated as to whether the two factors lay an indeendent or synergic role during cervical carcinogenesis. Tumor samles MATERIALS AND METHODS Eighty-two, formalin-fixed, araffin-embedded cervical lesions were used for immunohistochemical, olymerase chain reaction (PCR) and in situ hybridization (ISH) studies. Materials were obtained from the athology files of Anam Hosital, Korea University College of Medicine between 1995 and Samles included 41 cases of SCCs, 30 cases of cervical intraeithelial neolasms (CIN 1; 11 cases, CIN II; 3 cases, CIN III; 16 cases), and 11 cases of non-neolastic cervices. DNA extraction DNA samles were extracted from several serial six m- thick araffin sections as reviously described (19). Briefly, tissue samles were treated with lysis buffer containing 100 g/ml roteinase K (Merck, Darmstadt, Germany) at 48 for 48 hr. DNA extraction was then erformed by henol/ chloroform treatment and reciitation with ethanol. The quality of the DNA extracted was confirmed with a beta-globin gene-secific rimer air (BGLO1 and BGLO2), which amlifies 110 base airs. Bisulfite modification and methylation-secific olymerase chain reaction (MSPCR) for detecting 16 DNA methylation atterns in the CG islands of the 16 were determined by MSPCR assays by Herman et al. (20). Briefly, 200 to 300 ng DNA was first treated with 3 mol/l sodium bisulfite to convert nonmethylated cytosine to uracil residues. As a diagnostic ste, we used heminested PCR to increase the sensitivity of detection with rimers 16M/16 mol/l2r for the first and 16Mf/16Mr for the second ste under conditions as described. Base sequences of used rimers are as follows; 16-methylated (16-M): forward; 5 TTA TTA GAG GGT GGG GGCG GATCGC 3 reverse; 5 GACCCCGAACCGCGACCGTAA 3 16-unmethylated (16-U): forward; 5 TTATTAGAGGG- TGGGGTGGATTGT 3 reverse; 5 CAACCCCAAACCACAACCATAA 3 In all cases, the amlification of nonmethyl-secific alleles served as controls for the efficiency of cytosine conversion and DNA quality. Controls without DNA and ositive controls for U and M reactions were erformed for each set of PCRs. The PCR roduct was visualized in agarose gels stained with ethidium bromide under ultraviolet illumination. DNA methylation was determined by the resence of a150-b and 151-b fragments in those samles amlified with the 16- M and 164-U rimers, resectively. Positive PCR roducts in 16-M and/or 16-U are interreted as methylated, and PCR roducts in only 16-U are interreted as unmethylated status. Immunohistochemistry for 16 Immunohistochemical staining of 16 was erformed with 16 monoclonal antibody (SC 468; Santa Cruz Biochemicals, CA, U.S.A.) diluted at 1:50. Immunodetection was erformed with biotinylated antimouse immunoglobulins, followed by eroxidase-labeled stretavidin, LSAB-2 (DAKO, Glostru, Denmark) with diaminobenzidine chromogen as the substrate. Each section was counterstained with hematoxylin. Incubation omitting the secific antibody, as well as with unrelated antibodies, was used as a control of the technique. A ositive control was included with each slide. The results were interreted as ositive according to the established criteria by Geradts et al. (21). PCR for detection of EBV To examine the resence of EBV DNA in the samles, 0.1 g DNA from a cervical samle was subjected to PCR analysis using EBNA-1 rimers which target a 138 base air segment of the Bam H1W internal reeat (IR 1) region described by Coates et al. (22). Base sequences of rimers were as follows; EBNA-1 Forward : 5 TGATAACCATGGACGAGGAC 3 Reverse : 5 CTTCAAGTTGCATTGGCTGC 3 Thirty-five PCR cycles at 95 for 7 min, at 94 for 1 min, at 58 for 40 sec, and at 72 for 40 sec were carried out. And it was carried out at 72 for 7 min Polymerase chain reaction was carried out in dulicate or trilicate. The amlified roducts were run on 2% Nuieve/agarose gel and were transferred onto a Hybond N+ membrane (Amersham Biosciences, Usala, Sweden). They were stained with ethidium bromide and examined under ultraviolet illumination. As a ositive control of EBNA-1, B95-8 cell line was used.

3 638 N.R. Kim, Z. Lin, K.R. Kim, et al. In situ hybridization (ISH) for EBV EBV ISH was erformed using oligonucleotide robes against EBV-encoded RNA-1 (EBER-1; Novocastra, Newcastle, U.K.), following reviously reorted rocedures (23). EBER-1 ositivity was shown by latently EBV-infected cells. Briefly, EBER-1 ISH was erformed on each case using digoxigenin-labeled riborobes roduced from lasmid temlates. A ste-by-ste descrition of one of the testing rotocols, which uses EBER-1 was executed on each case and hybridized overnight. RNase was used to facilitate the washing away of unbound robe and a detection system based on the alication of antibody to digoxigenin was linked to alkaline hoshatase. It was counterstained with hematoxylin. Known cases of EBV-harboring tonsils were used as controls. Strong signals of the nuclei were interreted as ositive results. Data analysis M m u m u m u m u m u m u m u Non-neolastic cervices were immunonegative for 16 rotein excet for basal cells that are known to normally exress 16 rotein, but 53% of cervical intraeithelial neolasm (16/30 cases) and 68.3% of invasive squamous cell carcinomas (28/41) exressed 16 rotein. These results were sig16 MSPCR 16 IHC EBNA-1 PCR EBER-1 ISH 151 b Fig. 1. Methylation status of the 16 gene detected by methylationsecific PCR. Lane 1-3, CIN; lane 4-6, cervical carcinoma; lane 7, normal cervical tissue; M, Molecular weight marker; lanes m, reactions using 16-M rimers secific for the methylated CG sites. lanes u, reactions using 16-U rimers secific for the unmethylated CG sites. Table 1. Results of revalence of EBV, 16 hyermethylation and 16 immunoreactivities Normal 0/ / / (n=11) (0%) (0%) (9.1%) (0%) CIN I 5/11 4/11 4/11 2/11 (n=11) (45.5%) (36.4%) (36.4%) (18.2%) CIN II +III 7/19 12/19 7/19 4/19 (n=19) (36.8%) (63.2%) (36.8%) (21.1%) SCC 25/41 28/41 15/41 14/41 (n=41) (61%) (68.3%) (36.6 %) (34.1%) PCR, olymerase chain reaction; ISH, in situ hybridization; CIN, cervical intraeithelial neolasm; SCC, squamous cell carcinoma; MSPCR, methylation-secific PCR; IHC, immunohistochemistry. We divided the cases into four grous as follows: non-neolastic normal cervical tissue, low grade dyslastic lesions (cervical intraeithelial neolasm, CIN I), high grade lesions (CIN II and III) and invasive SCCs. Subsequently, we comared EBV infection with 16 methylation and 16 rotein exression. Statistical analysis was erformed by means of SPSS software version 10. The associations between the discrete variables were assessed using McNemar s exact test and chi-square test. The same tests were used to evaluate the influence of the tumor grade of CIN. Differences were considered statistically significant for <0.05. RESULTS All the results of 16 methylation, 16 rotein exression, EBNA-1 PCR and EBER-1 ISH of the eighty-two cases were shown in Table methylation status Non-neolastic cervices showed unmethylation in all the cases, but 40% (12/30) of cervical intraeithelial neolasms and 61% of invasive squamous cell carcinomas (25/41) showed 16 methylation (=0.003, Fig. 1, Table 1). There existed statistical differences among CIN I, II and III (=0.03, data not shown), while the advanced stage of squamous cell carcinomas (stage IIb) revealed a higher 16 methylation rate than the early stage (I, IIa) of squamous cell carcinomas, however, the results were not statistically significant (=0.107, Table 2). Immunohistochemistry for 16 rotein Table 2. Comarison of 16 methylation status and EBV status according to the tumor stages FIGO stage 16 MSPCR 16 IHC EBNA-1 PCR EBER-1 ISH IA (n=8) 3/ / / / (37.5%) (50%) (25%) (25%) IB (n=17) 8/17 12/17 9/17 7/17 (47.1%) (70.6%) (52.9%) (41.2%) IIA (n=9) 7/9 8/9 4/9 4/9 (77.8%) (88.9%) (44.4%) (44.4%) IIB (n=7) 7/7 3/7 0/7 1/1 (100%) (42.9%) (0%) (100%) MSPCR, methylation-secific PCR; IHC, immunohistochemistry; PCR, olymerase chain reaction; ISH, in situ hybridization.

4 EBV and 16 Methylation in Cervical Cancer 639 A B C D Fig. 2. Immunohistochemistry for 16. Focal nuclear staining in the basal cells of the non-neolastic cervical tissue (A, 16 immunostain, 200), CIN I (B, 16 immunostain, 200), CIN III (C, 16 immunostain, 200) and intense nuclear staining in invasive squamous cell carcinoma (D, 16 immunostain, 400). M N C Table 3. Comarison of 16 methylation status and 16 immunoreactivity between EBV-ositive and -negative cervical lesions 16 MSPCR M U Total 16 immunohistochemistry M U Total Fig. 3. Analysis of EBV using EBNA-1 rimer. Lane 1-2, Normal cervical tissue; lane 3-6, Squamous cell carcinoma; lane 7-9, CIN; lane N, Negative control; lane C, Positive control; M, molecular weight marker. nificantly different among the four grous (=0.001, Table 1, Fig. 2). However, no differences existed among the three grades of cervical intraeithelial neolasms (=0.600, data not shown). In comarison of invasive carcinomas according to the stage, there was a higher exression rate in more advanced stages, but no statistically significant differences existed (= 0.192, Table 2). EBV detection 138 b EBV was detected by EBNA-1 PCR in 9.1% of non-neolastic cervical tissue (1/11), 36.7% of cervical intraeithelial neolasm (11/30) and 36.6% of invasive squamous cell carcinomas (15/41) (Fig. 3). There was no statistically significant difference in the detection rate of EBV among the four EBV detected by PCR Total PCR, olymerase chain reaction; MSPCR, methylation-secific PCR; M, methylated; U, unmethylated. grous (=0.331, Table 1), whereas a significant difference existed between the two grous (non-neolastic cervices vs. recancerous CIN and cervical cancers, =0.040, data not shown). There were no statistical differences among the grades of CIN (=0.747, data not shown). EBNA-1-ositive cervical lesions showed a 70.4% (19/27) ositive detection rate in EBER-1 ISH (Fig. 4). In comarison of invasive carcinomas according to the tumor stages, the EBV detection rate did not show a statistically different rate between each stage (=0.124, Table 2). Exact test of concordance of 16 MSPCR with the immunohistochemistry of 16 rotein, and the EBV detection rate By McNemar s exact test, 16 MSPCR and the immunohistochemical results were roven to be concordant, while the detection rate of EBV was different between in situ hybridization and PCR.

5 640 N.R. Kim, Z. Lin, K.R. Kim, et al. A B C D Fig. 4. (A) EBER-1 signals detected by in situ hybridization ( 200). No signals are detected in squamous cell carcinoma. (B) In CIN I, some of the dyslastic cells show nuclear staining ( 200). (C) In CIN III, dyslastic cells show nuclear staining ( 400). (D) In squamous cell carcinoma, tumor cells and some intervening lymhocytes show nuclear staining for EBER-1 ( 400). Correlation among 16 methylation, 16 immunoreactivity and EBV detection The cervical lesions ositive for EBV by PCR showed a higher rate of 16 methylation and/or 16 immunoositivity, which was statistically significant (Table 3). DISCUSSION In this study, 61% of squamous cell carcinomas of the uterine cervix showed 16 methylation, which was higher than 31% in the reort of Wong and his colleagues (2). Cervical carcinomas are known to show a high roortion of 16 methylation, while other gynecological malignancies have variable frequencies (24). Sano et al. (4) reorted that invasive squamous cell carcinoma and CIN lesions (low and high grades) exhibited higher 16 immunoreactivity than non-neolastic cervices. Based on the results that dyslastic lesions rogressed toward carcinomas with increasing 16 methylation, methylation has been thought to lay a critical role in oncogenesis as in lymhoma or carcinomas of other organs (25). However, the frequency of 16 methylation between early and advanced stages showed no statistically significant difference, which is quite different from those of the tumors in the head and neck, breast or bladder (2, 26, 27). This result may indicate that early cervical carcinogenesis requires 16 methylation, but additional molecular genetic events are necessary for its rogression. Variable data on 16 immunoreactivities and cervical carcinomas have been described in the literature; most of them reorted loss of 16 rotein (28), while some reorted the reexression of 16 rotein (29). In our study, dyslastic cervical eithelium and squamous cell carcinomas showed a higher exression of 16 rotein in the cervical eithelium, which contradicts most of the revious studies, but fits well with that of Klaes et al. (29). The statistically concordance desite discreancy in individual comarison between 16 immunohistochemistry and 16 MSPCR in this study indicates that the former may emloy an inexensive screening method to detect squamous cells showing early dyslastic changes. Interretation of immunoreactivity for 16 rotein has some limitations because 16 exression is variable in normal, dyslastic eithelium and neolastic tissue; basal layer of nonneolastic exocervix exresses weak and focal nuclear stainability (30). Theoretically, 16 rotein should be exressed only in the nuclei but cytolasmic staining attern was occasionally observed, and its significance remains unclear. Cytolasmic immunoreactivity may be induced by a nonsecific utake or may be caused by functional heterogeneity (21). Some of the cultured cells ertaining to 16 gene show nuclear negativity but with variable cytolasmic reactivities, or cytolasmic 16 detected by immunoblotting may indicate that this cytolasmic localization of 16 is dormant like that of the tumor suressor gene, which has functions different from the nuclear one (31). A discreancy in the results between the two detection methods for 16 inactivation was noted in our series. MSPCR has been known to be more sensitive and secific than Southern hybridization (20). In contrast, immunohistochemistry using 16 monoclonal antibody is simle and useful but has several technical limitations. For examle, 16 rotein is rone to break during the rocess-

6 EBV and 16 Methylation in Cervical Cancer 641 ing, and heterogeneous immunoreactivity in nonneolastic tissue could cause confusion during interretation. Progressive increase of 16 immunoreactivity and methylation were observed at carcinomatous rogression. Timmermann et al. (32) demonstrated that eithelial cells gained increased activity of beta-galactosidase that is associated with senescence and roduced 16 rotein with no normal suressor function. The reexression of this incomlete rotein detected by immnohistochemical method may be exlained (33). In this study, 60.5% of EBV-ositive cervical tissues were 16-methylated, whereas 68.2% of EBV-negative cervical tissues were 16-unmethylated. These results were similar to those of nasoharyngeal undifferentiated carcinoma or EBVositive gastric carcinomas, where there was likewise a trend toward an association between EBV infection and loss of 16 exression. One ossible exlanation for the association of 16 loss and EBV infection is that EBV-infected tumors could have a higher growth rate and therefore a greater oortunity to accumulate more mutations, including those of 16. In this study, we confirmed EBV infection by PCR and ISH. There was disconcordance between the results through EBV PCR and ISH. In general, the amlification of DNA through PCR was ossible even in one viral article, thus, theoretically it is a more sensitive method than ISH (9). In ractice, a sensitive and secific ractical method for detecting EBV is ISH (34). Cases of EBV-negativity by PCR but EBV-ositive reaction by ISH in this study, seemed to be caused by insufficient amlification rocess. In this study, 39% of SCCs were EBV-ositive, which was not a high frequency comared to non-neolastic tissues or CIN. However, EBV-ositive carcinomas showing a high rate of 16 methylation suggested that EBV alone does not lay a key role in uterine cervical squamous eithelium, rather it may be involved in the earliest ste of oncogenesis, which is somewhat dissimilar to that of nasoharyngeal carcinoma or Burkitt s lymhoma. Recent develoment of molecular genetics for carcinogenesis and virus, methylation of CG islands ossessing 16 is induced by the integration of viral DNA into host cells (34, 35). It was suggested that methylation of foreign DNA integrated with host DNA or adjacent host DNA, esecially cell cycle regulatory site is the first ste of carcinogenesis (36), which is similar to those of SV40 in relation to malignant mesothelioma or EBV in relation to EBV-ositive gastric carcinomas (15, 37). Methylation of EBV genome inhibits suression of immunodominant viral antigen by EBV-infected tumor cells and escaes immunosurveillance (15). Pharmacological blocking by methylation inhibitor causes tumor suressor gene to be rotected from aberrant methylation, might finally gain its own function, which the tumor cells exose immunosurveillance system. Actually, clinical alication is now being attemted (38). On this mechanism, the relationshi between EBV infection and 16 methylation lays a role in the early change of cervical carcinogenesis, and may rovide romise for future treatments. In conclusion, we did not find an association between 16 methylation status and stage. These observations well corresonded to the fact that 16 inactivation is an early eigenetic event in cervical cancer. A more intense reactivity of 16 rotein was associated with 16 methylated status in this study, which might imly that 16 immunoreactivity reresents the reactivation of senescent 16 rotein in cancers, keeing with a revious reort of cervical carcinoma, but differs from the correlation with the advanced stage of cervical SCC in the earliest study of Wong et al. (2). Although our findings need to be extended to a larger series, the attern of 16 methylation in cervical lesions with or without EBV-infection may hel identify subgrous at increased risk for accelerated rogression. REFERENCES 1. Nuovo GJ, Plaia TW, Belinsky SA, Baylin SB, Herman JG. In situ detection of the hyermethylation-induced inactivation of the 16 gene as an early event in oncogenesis. Proc Natl Acad Sci USA 1999; 96: Wong YF, Chung TK, Cheung TH, Nobori T, Yu AL, Yu J, Batova A, Lai KW, Chang AM. Methylation of 16 INK4A in rimary gynecologic malignancy. Cancer Lett 1999; 136: Herman JG, Merlo A, Mao L, Laidus RG, Issa JP, Davidson NE, Sidransky D, Baylin SB. Inactivation of the CDKN2/16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res 1995; 55: Sano T, Oyama T, Kashiwabara K, Fukuda T, Nakajima T. Exression status of 16 rotein is associated with human aillomavirus oncogenic otential in cervical and genital lesions. Am J Pathol 1998; 153: Baylin SB, Esteller M, Rountree MR, Bachman KE, Schuebel K, Herman JG. Aberrant atterns of DNA methylation, chromatin formation and gene exression in cancer. Hum Mol Genet 2001; 10: Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC, Baylin SB, Sidransky D. 5 CG island methylation is associated with transcritional silencing of the tumour suressor 16/CDKN2/ MTS1 in human cancers. Nat Med 1995; 1: Keating JT, Ince T, Crum CP. Surrogate biomarkers of HPV infection in cervical neolasia screening and diagnosis. Adv Anat Pathol 2001; 8: Keating JT, Cviko A, Riethdorf S, Riethdorf L, Quade BJ, Sun D, Duensing S, Sheets EE, Munger K, Crum CP. Ki-67, cyclin E, and 16 INK4 are comlimentary surrogate biomarkers for human ailloma virus-related cervical neolasia. Am J Surg Pathol 2001; 25: Landers RJ, O Leary JJ, Crowley M, Healy I, Annis P, Burke L, O Brien D, Hogan J, Kealy WF, Lewis FA. Estein-Barr virus in normal, re-malignant and malignant lesions of the uterine cervix. J Clin Pathol 1993; 46: Taylor Y, Melvin WT, Sewell HF, Flannelly G, Walker F. Prevalence

7 642 N.R. Kim, Z. Lin, K.R. Kim, et al. of Estein-Barr virus in the cervix. J Clin Pathol 1994; 47: Sasagawa T, Shimakage M, Nakamura M, Sakaike J, Ishikawa H, Inoue M. Estein-Barr virus (EBV) genes exression on cervical intraeithelial neolasia and invasive cervical cancer: a comarative study with human aillomavirus (HPV) infection. Hum Pathol 2000; 31: Noel J, Lesagnard L, Fayt I, Verhest A, Dargent J. Evidence of human ailloma virus infection but lack of Estein-Barr virus in lymhoeithelioma-like carcinoma of uterine cervix: reort of two cases and review of the literature. Hum Pathol 2001; 32: Shibosawa E, Tsutsumi K, Koizuka I, Hoshikawa M, Takakuwa T. Absence of nuclear 16 from Estein-Barr virus-associated undifferentiated nasoharyngeal carcinomas. Laryngoscoe 2000; 110: Schneider BG, Gulley ML, Eagan P, Bravo JC, Mera R, Geradts J. Loss of 16/CDKN2A tumor suressor rotein in gastric adenocarcinoma is associated with Estein-Barr virus and anatomic location in the body of the stomach. Human Pathol 2000; 31: Kang GH, Lee S, Kim WH, Lee HW, Kim JC, Rhyu MG, Ro JY. Estein-barr virus-ositive gastric carcinoma demonstrates frequent aberrant methylation of multile genes and constitutes CG island methylator henotye-ositive gastric carcinoma. Am J Pathol 2002; 160: Cho NH, Kim YT, Kim JW. Alteration of cell cycle in cervical tumor associated with human Paillomavirus: Cyclin-deendent kinase inhibitors. Yonsei Med J 2002; 43: Kim IS, Kang JS, Choi AN, Kim YS. The revalence of Estein-Barr virus in uterine cervical cancer: Detection by PCR and in situ PCR methods. Korean J Obstet Gynecol 2000; 43: Jeong HJ, Lee ES, Lin ZH, Park SH, Kim IS, Kang JS. Detection of Estein-Barr virus in the inflammatory and neolastic uterine cervical lesions. Korean J Cytoathol 2001; 12: Doyle JJ, Doyle JL. A raid DNA isolation rocedure for small quantities of fresh leaf tissue. Phytochem Bull 1987; 19: Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-secific PCR: a novel PCR assay for methylation status of CG islands. Proc Natl Acad USA 1996; 93: Geradts J, Kratzke RA, Niehans GA, Lincoln CE. Immunohistochemical detection of the cyclin-deendent kinase inhibitor 2/multile tumor suressor gene 1 (CDKN2/MTS1) roduct 16 INK4A in archival human solid tumors: correlation with retinoblastoma rotein exression. Cancer Res 1995; 55: Coates PJ, d Ardenne AJ, Khan G, Kangro HO, Slavin G. Simlified rocedures for alying the olymerase chain reaction to routinely fixed araffin wax sections. J Clin Pathol 1991; 44: Chang KL, Chen YY, Shibata D, Weiss LM. Descrition of an in situ hybridization methodology for detection of Estein-Barr virus RNA in araffin-embedded tissues, with a survey of normal and neolastic tissues. Diagn Mol Pathol 1992; 1: Virmani AK, Muller C, Rathi A, Zoechbauer-Mueller S, Mathis M, Gazdar AF. Aberrant methylation during cervical carcinogenesis. Clin Cancer Res 2001; 7: Wong YF, Chung TK, Cheung TH, Nobori T, Yim SF, Lai KW, Phil M, Yu AL, Diccianni MB, Li TZ, Chang AM. 16INK4 and 15INK4B alterations in rimary gynecologic malignancy. Gynecol Oncol 1997; 65: Salem C, Liang G, Tsai YC, Coulter J, Knowles MA, Feng AC, Groshen S, Nichols PW, Jones PA. Progressive increases in de novo methylation of CG islands in bladder cancer. Cancer Res 2000; 60: Yuen PW, Man M, Lam KY, Kwong YL. Clinicoathological significance of 16 gene exression in the surgical treatment of head and neck squamous cell carcinomas. J Clin Pathol 2002; 55: Villuendas R, Sanchez-Beato M, Martinez JC, Saez AI, Martinez- Delgado B, Garcia JF, Mateo MS, Sanchez-Verde L, Benitez J, Martinez P, Piris MA. Loss of 16/INK4A rotein exression in non- Hodgkin s lymhomas is a frequent finding associated with tumor rogression. Am J Pathol 1998; 153: Klaes R, Friedrich T, Sitkovsky D, Ridder R, Rudy W, Petry U, Dallenbach-Hellweg G, Schmidt D, von Knebel Doeberitz M. Overexression of 16 INK4A as a secific marker for dyslastic and neolastic eithelial cells of the cervix uteri. Int J Cancer 2001; 92: Nielsen GP, Stemmer-Rachamimov AO, Shaw J, Roy JE, Koh J, Louis DN. Immunohistochemical survey of 16 INK4A exression in normal human adult and infant tissues. Lab Invest 1999; 79: Shiozawa T, Nikaido T, Shimizu M, Zhai Y, Fujii S. Immunohistochemical analysis of the exression of cdk4 and 16 INK4 in human endometrioid-tye endometrial carcinoma. Cancer 1997; 80: Timmermann S, Hinds PW, Munger K. Re-exression of endogenous 16 ink4a in oral squamous cell carcinoma lines by 5-aza-2 -deoxycytidine treatment induces a senescence-like state. Oncogene 1998; 17: Gum J, Koh J. An antibody to 16 INK4A recognizes a modified form of galectin-3. Hybridoma 2001; 20: Takeuchi H, Kobayashi R, Hasegawa M, Hirai K. Detection of latent Estein-Barr virus (EBV) DNA in araffin sections of nasoharyngeal carcinomas exressing no EBV-encoded small RNAs using in situ PCR. Arch Virol 1997; 142: Remus R, Kammer C, Heller H, Schmitz B, Schell G, Doerfler W. Insertion of foreign DNA into an established mammalian genome can alter the methylation of cellular DNA sequences. J Virol 1999; 73: Klein CB, Costa M. DNA methylation, heterochromatin and eigenetic carcinogens. Mutat Res 1997; 386: Toyooka S, Pass HI, Shivaurkar N, Fukuyama Y, Maruyama R, Toyooka KO, Gilcrease M, Farinas A, Minna JD, Gazdar AF. Aberrant methylation and simian virus 40 tag sequences in malignant mesothelioma. Cancer Res 2001; 61: Reid GK, Besterman JM, MacLeod AR. Selective inhibition of DNA methyltransferase enzymes as a novel strategy for cancer treatment. Curr Oin Mol Ther 2002; 4: