Table showing various modified oligonucleotides synthesized using UnyLinker loaded solid supports.
|
|
- Emmeline Bennett
- 5 years ago
- Views:
Transcription
1 Table showing various modified oligonucleotides synthesized using UnyLinker loaded solid supports. Oligo Synthesized Sequence 5 3 Oligo 1 2 -O-Methoxyethyl modified phosphorothioate 2- nucleotide gapmer ISIS Oligo 2 [CTG]-AGTCTGTTT-[TCCATTCT] Oligo 3 Oligo 4 Oligo 5 Oligo 6 Oligo 7 Oligo 8 [GCTCC]-TTCCACTGAT-[CCTGC] [GCCTC]-AGTCTGCTTC[GCACC] [TGGAA]-AGGCTTATAC-[CCCTC] [TCCCGC]-CTGTGACA-[TGCATT] d[gcccaagctggcatccgtca] [CAGC]-AGCAGAGTCTTCA-[TCAT] Oligo Synthesized Sequence 5 3 Oligo #9 5 -PO-d[AATGCATGTCACAGGCGGGA] Oligo #1 Oligo #11 Oligo #12 Oligo #13 Oligo #14 Oligo #15 Oligo #16 Oligo #17 m C ms T m ms C mo A mo G m mo C mo A m mo C mo A mo T m mo C mo T mo A m mo C mo A mo A mo G ms A ms A ms A m C ms T m ms C ms A ms G m ms C ms A m ms C ms A ms T m ms C ms T ms A m ms C ms A ms A ms G ms A ms A ms A A ro A eo G ro C eo A ro A eo C ro G eo A ro G eo A ro A eo G ro C eo G ro A eo U ro A eo A r 5 -A m es C es A m es C es A es A es A es T es T m es C es G es G es T es T m es C es T es A m es C es A es G es G es G e PO 3 -U ro U ro A ro U ro C ro G mo C mo U ro U ro C mo U mo C ro G ro U ro U ro G ro C mo U mo U m 5 - m C es G m es C es G es T es A m es C m es C es A es A es A es A es G es T es A es A es T es A es A es T es G e m C es U m fs C es A fs G es C fs A es C fs A es U m fs C es U fs A es C fs A es A fs G es A es A e 5 -T m es C es A m es C es A es A es G es T es T es A es G es G es G es T m es C es T m es C es A es G es G es G es A e S33
2 Oligo #18 Oligo #19 Oligo #2 Oligo #21 Oligo #22 Oligo #23 Oligo #24 Oligo #25 Oligo #26 Oligo #27 Oligo #28 Oligo #29 Oligo #3 Oligo #31 Oligo #32 Oligo #33 Oligo #34 Oligo #35 Oligo #36 Oligo #37 5 -G m es C es T m es C es A es T es T es T es A es G es T m es C es T es G m es C m es C es T es G es A es T e m C ls T ls G ds C ds T ds A ds G ds C ds C ds T ds C ds T ds G ds G ds A ds T ds T ds T ds G ls A l m C lo T lo G ds C ds T ds A ds G ds C ds C ds T ds C ds T ds G ds G ds A ds T ds T ds T do G lo A l 5 -A m es C es A es T es A m es C es T m es C m es C es T es T es T es m C es T m es C es A es G es A es G es T m es C m es C es A e T ls T ls G ls T ds T ds C ds T ds G ds A ds A ds T ds G ds T ds m C ls m C ls A l 5 -A es A m es C m es C es T es A es T m es C m es C es T es G es A es A es T es T es A m es C es T es T es G es A es A e 5 -A m ms C ms A ms A ms A m ms C ms A m ms C m ms C ms A ms T ms T ms G ms T m ms C ms A m ms C ms A m ms C ms T m ms C m ms C ms A m 5 -PO-d[GAGGGGTATAAGCCTTTCCA] G m ls C ls T m ls C ls A ds T ds A m ds C ds T m ds C ds G ds T ds A ds G ds G m ls C m ls C ls A l 5 -G m es C es A m ds C ds T ds T ds T ds G ds T ds G ds G ds T ds G m ds C m ds C ds A ds A ds G ds G m es C e 5 - m C m es C ds A ds G m ds C ds A ds T m ds C ds T ds G m ds C ds T ds G m es C es T es T m es C e 5 - m C es T m ds C es A ds G m es C ds A m es C ds A es T m ds C es T ds A m es C ds A es A ds G es A ds A es A e 5 -Biotin-G es A es A es G es T es A ds G m ds C m ds C ds A ds m C m ds C ds A ds A m ds C ds T es G es T es G m es C e 5 - m C es T fs C fs A fs G fs C fs A fs C fs A fs T fs C fs T fs A fs C fs A fs A fs G fs A fs A es A e 5 -PO 3 -A ro U ro A ro G ro A ro C mo U mo U ro C ro A mo U mo C ro C ro U ro U ro G ro U mo U mo G m 5 -U ro A ro C ro G ro C ro A mo A mo A ro C ro C mo U mo U ro G ro A ro U ro G ro U mo C mo C m 5 - PO 3 -A ro A ro A ro U ro G ro U mo U mo C ro C ro A mo G mo C ro C ro C ro A ro G ro G mo G mo C m 5 -G ro G eo A ro C eo A ro U eo C ro A eo A ro G eo G ro U eo U ro U eo G ro C eo G ro U eo A r 5 -U ro C ro A ro C ro U ro C ro G ro G ro C ro U ro G ro G ro A ro U ro G ro G ro A ro G ro U rs T es T 5 -[CTCTA]-GTTCCTCTCA-[ATGTC] (for plate synthesis comparison) S34
3 Table: Oligonucleotides synthesized on GE Amersham Akta 1/1 and other automated DNA/RNA synthesizers. m C = 5-methyl C; d = 2 -deoxy; e = 2 -O-methoxyethyl; m = 2 - O-methyl; r = 2 -OH; l = LNA; f = 2 -alpha-fluoro; o = PO; s = PS; PO 3 = phosphate monoester. S35
4 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo 1 ma 4 A mi B m/ Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S36
5 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo 2 5 -[CTG]-AGTCTGTTT-[TCCATTCT]-3 mau A mi B m/ Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S37
6 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo 3 5 -[GCTCC]-TTCCACTGAT-[CCTGC]-3 ma 35 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S38
7 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo 4 5 -[GCCTC]-AGTCTGCTTC-[GCACC]-3 ma A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S39
8 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo 5 5 -[TGGAA]-AGGCTTATAC-[CCCTC]-3 ma 35 A min 18.6 B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S4
9 IP-HPLC-MS of DMT-on crude 2 -O-methoxyethyl modified phosphorothioate Oligo 6 5 -[TCCCGC]-CTGTGACA-[TGCATT]-3 mau 25 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S41
10 IP-HPLC-MS of DMT-on reversed phase purified 2 -O-methoxyethyl modified phosphorothioate Oligo 6 5 -[TCCCGC]-CTGTGACA-[TGCATT]-3 mau 4 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S42
11 IP-HPLC-MS of crude DMT-on oligodeoxy phosphorothioate Oligo 7- SYN #1 5 -GCCCAAGCTGGCATCCGTCA-3 mau A min B m/z Upper panel (A): HPLC-UV trace of the crude synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S43
12 IP-HPLC-MS of oligodeoxy phosphorothioate Oligo 7- SYN #1 5 -GCCCAAGCTGGCATCCGTCA-3 ma 4 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S44
13 IP-HPLC-MS of crude DMT-on oligodeoxy phosphorothioate Oligo 7- SYN #2 5 -GCCCAAGCTGGCATCCGTCA-3 mau A min B m/z Upper panel (A): HPLC-UV trace of the crude synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S45
14 IP-HPLC-MS of crude DMT-on oligodeoxy phosphorothioate Oligo 7- SYN #3 5 -GCCCAAGCTGGCATCCGTCA-3 mau A min B m/z S46
15 Capillary gel electropherogram (CGE) analysis of oligodeoxy phosphorothioate 7 using da-loaded solid support. S47
16 IP-HPLC-MS analysis of 2 -O-methoxyethyl modified phosphorothioate Oligo 8 5 -[CAGC]-AGCAGAGTCTTCA-[TCAT]-3 mau 4 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S48
17 IP-HPLC-MS of DMT-on crude 2 -O-methoxyethyl modified phosphorothioate Oligo 9 5 -PO-d[AATGCATGTCACAGGCGGGA]-3 mau 6 A mi B m/ Upper panel (A): HPLC-UV trace of the synthesized oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S49
18 IP-HPLC-MS analysis of 2 -O-methyl modified phosphate/phosphorothioate mixed backbone Oligo 1 using UnyLinker loaded CPG solid support 5 - m C ms T m ms C mo A mo G m mo C mo A m mo C mo A mo T m mo C mo T mo A m mo C mo A mo A mo G ms A ms A ms A-3 mau A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S5
19 IP-HPLC-MS analysis of 2 -O-methyl modified phosphorothioate Oligo 11 using UnyLinker loaded CPG solid support 5 - m C ms T m ms C ms A ms G m ms C ms A m ms C ms A ms T m ms C ms T ms A m ms C ms A ms A ms G ms A ms A ms A-3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S51
20 IP-HPLC-MS analysis of 2 -O-methoxyethyl/RNA modified sequence with phosphate backbone Oligo 12 using UnyLinker loaded CPG solid support 5 -A ro A eo G ro C eo A ro A eo C ro G eo A ro G eo A ro A eo G ro C eo G ro A eo U ro A eo A r -3 mau 12 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S52
21 IP-HPLC-MS analysis of 5 -phosphate-2 -O-methyl/RNA modified sequence with phosphate backbone Oligo 13 using UnyLinker loaded CPG solid support 5 -A m es C es A m es C es A es A es A es T es T m es C es G es G es T es T m es C es T es A m es C es A es G es G es G e -3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S53
22 IP-HPLC-MS analysis of 5 -phosphate-2 -O-methyl/RNA modified phosphate Oligo 14 using UnyLinker loaded CPG solid support 5 -PO 3 -U ro U ro A ro U ro C ro G mo C mo U ro U ro C mo U mo C ro G ro U ro U ro G ro C mo U mo U m -3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S54
23 IP-HPLC-MS analysis of 2 -O-methoxyethyl/RNA modified sequence with phosphate backbone Oligo 15 using UnyLinker loaded CPG solid support 5 - m C es G es m C es G es T es A es m C es m C es A es A es A es A es G es T es A es A es T es A es A es T es G e -3 mau 8 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S55
24 IP-HPLC-MS analysis of 2 -O-methoxyethyl/2 -alpha-fluoro modified phosphorothioate Oligo 16 using UnyLinker loaded CPG solid support 5 - m C es U fs m C es A fs G es C fs A es C fs A es U fs m C es U fs A es C fs A es A fs G es A es A e -3 mau 1 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S56
25 IP-HPLC-MS analysis of 2 -deoxy/lna modified phosphorothioate Oligo 17 using UnyLinker loaded CPG solid support 5 -T es m C es A es m C es A es A es G es T es T es A es G es G es G es T es m C es T es m C es A es G es G es G es A e -3 mau 8 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S57
26 IP-HPLC-MS analysis of modified phosphorothioate Oligo 18 using UnyLinker loaded CPG solid support 5 -G es m C es T es m C es A es T es T es T es A es G es T es m C es T es G es m C es m C es T es G es A es T e -3 mau 6 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S58
27 IP-HPLC-MS analysis of modified phosphorothioate Oligo 19 using UnyLinker loaded CPG solid support 5 - m C ls T ls G ds C ds T ds A ds G ds C ds C ds T ds C ds T ds G ds G ds A ds T ds T ds T ds G ls A l -3 mau 8 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S59
28 IP-HPLC-MS analysis of 2 -deoxy/lna modified phosphate/phosphorothioate mixed backbone Oligo 2 using UnyLinker loaded CPG solid support 5 - m C lo T lo G ds C ds T ds A ds G ds C ds C ds T ds C ds T ds G ds G ds A ds T ds T ds T do G lo A l -3 mau 8 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S6
29 IP-HPLC-MS analysis of modified phosphorothioate Oligo 21 using UnyLinker loaded CPG solid support 5 -A es m C es A es T es A es m C es T es m C es m C es T es T es T es m C es T es m C es A es G es A es G es T es m C es m C es A e -3 mau 5 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S61
30 IP-HPLC-MS analysis of 2 -deoxy/lna modified phosphorothioate Oligo 22 using UnyLinker loaded CPG solid support 5 -T ls T ls G ls T ds T ds C ds T ds G ds A ds A ds T ds G ds T ds m C ls m C ls A l -3 mau 14 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S62
31 IP-HPLC-MS analysis of modified phosphorothioate Oligo 23 using UnyLinker loaded CPG solid support 5 -A es A es m C es m C es T es A es T es m C es m C es T es G es A es A es T es T es A es m C es T es T es G es A es A e -3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S63
32 IP-HPLC-MS analysis of 2 -deoxy/lna modified phosphorothioate Oligo 24 using UnyLinker loaded CPG solid support 5 -A ms m C ms A ms A ms A ms m C ms A ms m C ms m C ms A ms T ms T ms G ms T ms m C ms A ms m C ms A ms m C ms T ms m C ms m C ms A m -3 mau A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S64
33 IP-HPLC-MS analysis of modified Oligo 25 using UnyLinker loaded CPG solid support 5 -PO-d[GAGGGGTATAAGCCTTTCCA]-3 mau 1 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S65
34 IP-HPLC-MS analysis of 2 -deoxy/lna modified phosphorothioate Oligo 26 using UnyLinker loaded CPG solid support 5 -G ls m C ls T ls m C ls A ds T ds A ds m C ds T ds m C ds G ds T ds A ds G ds G ls m C ls m C ls A l -3 mau 5 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S66
35 IP-HPLC-MS analysis of modified Oligo 27 using UnyLinker loaded solid support 5 -G es m C es A ds m C ds T ds T ds T ds G ds T ds G ds G ds T ds G ds m C ds m C ds A ds A ds G ds G es m C e -3 mau 4 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S67
36 IP-HPLC-MS analysis of modified phosphorothioate Oligo 28 made using UnyLinker solid support 5 - m C es m C ds A ds G ds m C ds A ds T ds m C ds T ds G ds m C ds T ds G es m C es T es T es m C e -3 mau 6 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S68
37 IP-HPLC-MS analysis of modified phosphorothioate Oligo 29 made using UnyLinker solid support 5 - m C es T ds m C es A ds G es m C ds A es m C ds A es T ds m C es T ds A es m C ds A es A ds G es A ds A es A e -3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S69
38 IP-HPLC-MS analysis of modified phosphorothioate Oligo 3 made using UnyLinker solid support 5 -Biotin-G es A es A es G es T es A ds G ds m C ds m C ds A ds m C ds m C ds A ds A ds m C ds T es G es T es G es m C e -3 mau A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S7
39 IP-HPLC-MS analysis of modified phosphorothioate Oligo 31 made using UnyLinker solid support 5 -C es U fs C fs A fs G fs C fs A fs C fs A fs U fs C fs U fs A fs C fs A fs A fs G fs A fs A es A e -3 mau A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S71
40 IP-HPLC-MS analysis of modified Oligo 32 made using UnyLinker solid support 5 -PO 3 -A ro U ro A ro G ro A ro C mo U mo U ro C ro A mo U mo C ro C ro U ro U ro G ro U mo U mo G m -3 mau 8 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S72
41 IP-HPLC-MS analysis of modified Oligo 33 made using UnyLinker solid support 5 -U ro A ro C ro G ro C ro A mo A mo A ro C ro C mo U mo U ro G ro A ro U ro G ro U mo C mo C m -3 mau 7 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S73
42 IP-HPLC-MS analysis of modified Oligo 34 made using UnyLinker solid support 5 - PO 3 -A ro A ro A ro U ro G ro U mo U mo C ro C ro A mo G mo C ro C ro C ro A ro G ro G mo G mo C m -3 mau A min B m/z Upper panel (A): HPLC-UV trace of the synthesized oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S74
43 IP-HPLC-MS analysis of modified Oligo 35 made using UnyLinker solid support 5 -G ro G eo A ro C eo A ro U eo C ro A eo A ro G eo G ro U eo U ro U eo G ro C eo G ro U eo A r -3 mau 12 A min B m/z Upper panel (A): HPLC-UV trace of the synthesized oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S75
44 IP-HPLC-MS analysis of modified phosphate/phosphorothioate Oligo 36 made using UnyLinker solid support 5 -U ro C ro A ro C ro U ro C ro G ro G ro C ro U ro G ro G ro A ro U ro G ro G ro A ro G ro U rs T es T-3 mau 6 A mi 1 B m/ Upper panel (A): HPLC-UV trace of the synthesized phosphate/phosphorothioate oligonucleotide. Lower panel (B): The average mass spectrum under the parent peak. S76
45 IP-HPLC-MS of 2 -O-methoxyethyl modified phosphorothioate Oligo synthesized using MOE A nucleoside solid support 5 -[CCGTC]-GCCCTTCAGC-[ACGCA]-3 mau 3 A min mau B min Upper panel (A): The average mass spectrum under the parent peak. Lower panel (B): HPLC-UV trace of the synthesized phosphorothioate oligonucleotide. S77
46 Table 1. Analysis of 2 -O-methoxyethyl modified phosphorothioate Oligo 1 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 1 Results (%) Full length, n 87. Full length, (P=O) Total (n-1) 1.2 Total (n+1).54 Total depurination.95 Total TPT ND TCE ND CNET.26 EPD OCH 3 1. n Early eluting species 3.6 Late eluting species 3.3 Molecular weight is ± 1. amu amu S78
47 Table 2. Analysis of 2 -O-methoxyethyl modified phosphorothioate Oligo 2 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 2 Results (%) Full length, n 9.2 Full length, (P=O) 1.9 Total (n-1) 2. Total (n+1).3 Total depurination.6 Total TPT ND TCE ND CNET.1 EPD.1 2 -OCH 3.7 n Early eluting species 1. Late eluting species 2.9 Molecular weight is ± 1. amu amu S79
48 Table 3. Comparison of 2 -O-methoxyethyl modified phosphorothioate Oligo 3 made using UnyLinker and MOE mec-nucleoside loaded solid support on OligoProcess Sequence: Oligo 3 PS2- UnyLinker PS2 Baseloaded Full length, n Full length, (P=O) Total (n-1) Total (n+1) ND ND Total depurination.55.4 Total TPT.26.6 TCE ND ND CNET ND ND EPD ND ND 2 -OCH n n Early eluting species Late eluting species Molecular weight is ± 1. amu amu amu S8
49 Table 4. Analysis of 2 -O-methoxyethyl modified phosphorothioate Oligo 4 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 4 Results (%) Full length, n 88.5 Full length, (P=O) Total (n-1).94 Total (n+1) ND Total depurination.46 Total TPT ND TCE ND CNET ND EPD ND 2 -OCH 3 1. n Early eluting species 1.4 Late eluting species 3.3 Molecular weight is ± 1. amu amu S81
50 Table 5. Analysis of 2 -O-methoxyethyl modified phosphorothioate Oligo 5 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 5 Results (%) Full length, n 87.4 Full length, (P=O) Total (n-1) 1. Total (n+1) ND Total depurination 1.43 Total TPT ND TCE ND CNET.44 EPD ND 2 -OCH n n Early eluting species 2.1 Late eluting species 1.72 Molecular weight is ± 1. amu amu S82
51 Table 6. Analysis of crude 2 -O-methoxyethyl modified phosphorothioate Oligo 6 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 6 Results (%) Full length, n 93.7 Full length, (P=O) Total (n-1) 2.8 Total depurination.4 Total TPT.7 TCE.3 CNET.17 EPD.5 2 -OCH 3.5 n + 68 Combined UV area % of two main DMT-on peaks Molecular weight is ± 1. amu amu S83
52 Table 7. Analysis of oligodeoxy phosphorothioate Oligo 7 made using UnyLinker loaded solid support on OligoProcess Sequence: Oligo 7-SYN #1 Results (%) Full length, n 88. Full length, (P=O) Total (n-1) 2.6 Total (n+1).68 Total depurination 2.3 Total TPT.37 TCE ND CNET ND n n n Early eluting species 1.26 Late eluting species 2.11 Molecular weight is ± 1. amu amu S84
53 Table 8. Comparison of oligodeoxy phosphorothioate Oligo 7 made using UnyLinker and da-nucleoside loaded solid supports on OligoProcess Results showing reproducibility of performance of UnyLinker on OligoProcess (Oligo 7-SYN #2 & Oligo 7-SYN #3) Sequence: Oligo 7 SYN #2 Results (%) SYN #3 Results (%) da-loaded Results (%) Full length, n Full length, (P=O) Total (n-1) Total depurination Total TPT.1 ND ND TCE ND ND ND CNET n EPD Molecular weight of DMTon 667 amu amu amu oligo ± 1. amu Combined UV area % of two main DMT-on peaks S85
54 Table 9. Analysis of Oligo 8 using UnyLinker loaded solid support Sequence: Oligo 8 Results (%) Full length, n 89.1 Full length, (P=O) Total (n-1) 2.5 Total (n+1) <.1 Total depurination 1.7 Total TPT <.1 TCE <.1 CNET.27 Total other impurities.37 Early eluting species 2.4 Late eluting species 2.2 Molecular weight is ± 1. amu amu S86
55 Table 1. Analysis of Oligo 9 using UnyLinker loaded solid support Sequence: Oligo 9 Results (%) UV purity n 82.2 n depurination 3.18 n Early eluting species 3.7 Late eluting species 3.28 Molecular weight is ± 1. amu amu S87
56 Table 11. Analysis of 2 -O-methyl modified phosphate/phosphorothioate mixed backbone Oligo 1 using UnyLinker loaded CPG solid support Sequence: Oligo 1 Results (%) UV purity 97.3 n 94.1 P=O.71 (n-1) 2.57 Early eluting species 1.1 Late eluting species 1.56 Molecular weight is ± 1. amu amu S88
57 Table 12. Analysis of 2 -O-methyl modified phosphorothioate Oligo 11 using UnyLinker loaded CPG solid support Sequence: Oligo 11 Results (%) UV purity n 87.5 P=O 3.95 (n-1) 3.36 Early eluting species 1.85 Late eluting species 2.52 Molecular weight is ± 1. amu amu S89
58 Table 13. Analysis of 2 -O-methoxyethyl/RNA modified sequence with phosphate backbone Oligo 12 using UnyLinker loaded CPG solid support Sequence: Oligo 12 Results (%) UV purity 9.93 n 88.9 (n-1) 2.57 Early eluting species 8.41 Late eluting species 1.66 Molecular weight is ± 1. amu amu S9
59 Table 14. Analysis of Oligo 13 using UnyLinker loaded solid support Sequence: Oligo 13 Results (%) UV purity n 91.1 P=O 3.33 (n-1) 1.35 depurination 1.46 Early eluting species 1.8 Late eluting species.74 Molecular weight is ± 1. amu amu S91
60 Table 15. Analysis of Oligo 14 using UnyLinker loaded CPG solid support Sequence: Oligo 14 Results (%) UV purity n 85.1 CNET 6.42 (n-1) 1.3 Unknown 1.6 Early eluting species 4.2 Late eluting species 1.6 Molecular weight is ± 1. amu amu S92
61 Table 16. Analysis of Oligo 15 using UnyLinker loaded solid support Sequence: Oligo 15 Results (%) UV purity 95.9 n P=O 1.85 (n-1) 1.92 Early eluting species 1.36 Late eluting species 2.7 Molecular weight is ± 1. amu amu S93
62 Table 17. Analysis of 2 -O-methoxyethyl/2 -alpha-fluoro modified phosphorothioate Oligo 16 using UnyLinker loaded CPG solid support Sequence: Oligo 16 Results (%) UV purity n P=O 3.81 (n-1) 1.36 Unknown 1.1 Early eluting species 7.97 Late eluting species 2.58 Molecular weight is ± 1. amu amu S94
63 Table 18. Analysis of Oligo 17 using UnyLinker loaded CPG solid support Sequence: Oligo 17 Results (%) UV purity 89.8 n 8.89 P=O 2.2 (n-1) 5.4 Early eluting species 5.73 Late eluting species 4.45 Molecular weight is ± 1. amu amu S95
64 Table 19. Analysis of Oligo 18 using UnyLinker loaded CPG solid support Sequence: Oligo 18 Results (%) UV purity n P=O 1.7 (n-1) 1.88 Early eluting species.62 Late eluting species.59 Molecular weight is ± 1. amu amu S96
65 Table 2. Analysis of 2 -deoxy/lna modified phosphorothioate Oligo 19 using UnyLinker loaded CPG solid support Sequence: Oligo 19 Results (%) UV purity n P=O.42 (n-1) 1.42 Total unknowns 4.94 Early eluting species 2.58 Late eluting species 1.7 Molecular weight is ± 1. amu amu S97
66 Table 21. Analysis of 2 -deoxy/lna modified phosphate/phosphorothioate mixed backbone Oligo 2 using UnyLinker loaded CPG solid support Sequence: Oligo 2 Results (%) UV purity n depurination.67 (n-1) 3.36 unknown.43 Early eluting species 5.58 Late eluting species 1.13 Molecular weight is ± 1. amu amu S98
67 Table 22. Analysis of Oligo 21 using UnyLinker loaded CPG solid support Sequence: Oligo 21 Results (%) UV purity n P=O 1.51 (n-1) 2.22 Early eluting species.95 Late eluting species.71 Molecular weight is ± 1. amu amu S99
68 Table 23. Analysis of 2 -deoxy/lna modified phosphorothioate Oligo 22 using UnyLinker loaded CPG solid support Sequence: Oligo 22 Results (%) UV purity n 93.6 P=O 2.11 (n-1) 1.19 Unknown 1.1 Early eluting species 1.65 Late eluting species 1.45 Molecular weight is ± 1. amu amu S1
69 Table 24. Analysis of Oligo 23 using UnyLinker loaded CPG solid support Sequence: Oligo 23 Results (%) UV purity n P=O 2.1 (n-1).95 Early eluting species 1.41 Late eluting species 1.32 Molecular weight is ± 1. amu amu S11
70 Table 25. Analysis of Oligo 24 using UnyLinker loaded CPG solid support Sequence: Oligo 24 Results (%) UV purity n 9.78 P=O 1.93 (n-1) 1.26 Early eluting species 2.23 Late eluting species 1.21 Molecular weight is ± 1. amu amu S12
71 Table 26. Analysis of Oligo 25 using UnyLinker loaded CPG solid support Sequence: Oligo 25 Results (%) UV purity 95.7 n 9.68 P=O.27 (n-1) 1.18 depurination 2.9 Early eluting species 1.26 Late eluting species 3.4 Molecular weight is ± 1. amu amu S13
72 Table 27. Analysis of 2 -deoxy/lna modified phosphorothioate Oligo 26 using UnyLinker loaded CPG solid support Sequence: Oligo 26 Results (%) UV purity 94.1 n 89.1 P=O 1.55 (n-1).6 Unknown 2.29 Early eluting species 3.17 Late eluting species 2.73 Molecular weight is ± 1. amu amu S14
73 Table 28. Analysis of Oligo 27 using UnyLinker loaded solid support Sequence: Oligo 27 Results (%) UV purity 9.2 n 86.5 P=O 3.7 (n-1) 1.9 CNET.33 Early eluting species 3.5 Late eluting species 2.2 Molecular weight is 682. ± 1.2 amu amu S15
74 Table 29. Analysis of Oligo 28 using UnyLinker loaded CPG solid support Sequence: Oligo 28 Results (%) UV purity 95.9 n 93.2 P=O 1.33 (n-1).83 Early eluting species.96 Late eluting species 3.14 Molecular weight is ± 1. amu amu S16
75 Table 3. Analysis of Oligo 29 using UnyLinker loaded CPG solid support Sequence: Oligo 29 Results (%) UV purity 95.6 n P=O 2.23 (n-1) 2.84 Early eluting species.95 Late eluting species 3.46 Molecular weight is ± 1. amu amu S17
76 Table 31. Analysis of Oligo 3 using UnyLinker loaded CPG solid support Sequence: Oligo 3 Results (%) UV purity n P=O 3.81 (n+187) 1.1 Early eluting species 7.96 Late eluting species 2.58 Molecular weight is ± 1. amu amu S18
77 Table 32. Analysis of Oligo 31 using UnyLinker loaded CPG solid support Sequence: Oligo 31 Results (%) UV purity 9.6 n P=O 3.54 Early eluting species 8.5 Late eluting species 1.89 Molecular weight is ± 1. amu amu S19
78 Table 33. Analysis of Oligo 32 using UnyLinker loaded CPG solid support Sequence: Oligo 32 Results (%) UV purity n 77.3 CNET 3.22 (n+methyl).77 (n-1) 1.26 Early eluting species 1.29 Late eluting species.8 Molecular weight is ± 1. amu amu S11
79 Table 34. Analysis of Oligo 33 using UnyLinker loaded CPG solid support Sequence: Oligo 33 Results (%) UV purity n 85.2 n + methyl 5.1 (n-1) 2.75 Early eluting species 5.31 Late eluting species.87 Molecular weight is ± 1. amu amu S111
80 Table 35. Analysis of Oligo 34 using UnyLinker loaded CPG solid support Sequence: Oligo 34 Results (%) UV purity n 7.52 (n-1) 2.59 (n+methyl) 3.29 n Early eluting species Late eluting species 1.37 Molecular weight is ± 1. amu amu S112
81 Table 36. Analysis of Oligo 35 using UnyLinker loaded CPG solid support Sequence: Oligo 35 Results (%) UV purity n 9.78 P=O.3 (n-1) 1.88 n + methyl 2.46 Early eluting species 3.73 Late eluting species 1.49 Molecular weight is ± 1. amu amu S113
82 Table 37. Analysis of Oligo 36 using UnyLinker loaded CPG solid support Sequence: Oligo 36 Results (%) UV purity n 57.8 P=O 1.78 (n-1) 1.98 n + methyl 5.48 Early eluting species Late eluting species.13 Molecular weight is ± 1. amu amu S114
83 Table 38. Comparison of 2 -O-methoxyethyl modified phosphorothioate Oligo 37 made using UnyLinker and MOE mec-nucleoside loaded solid supports on 96-well plate MerMade (Bioautomation) synthesizer (Synthesis #1) Control #1 Control #2 UnyLinker Syn #1 UnyLinker Syn #2 UnyLinker Syn #3 mass % % % % % Full length P=O TPT n-t n-moe mec/moe meu Total S115
84 Table 39. Comparison of 2 -O-methoxyethyl modified phosphorothioate Oligo 37 made using UnyLinker and MOE mec-nucleoside loaded solid supports on 96-well plate MerMade (Bioautomation) synthesizer (Synthesis #2). Results showing reproducibility of performance of UnyLinker loaded on CPG Control Syn #1 Control Syn #2 Control Syn #3 Control Syn #4 UnyLinker Syn #1 UnyLinker Syn #2 UnyLinker Syn #3 UnyLinker Syn #4 % % % % % % % % Full length P=O TPT n-t n-moe mec /MOE meu shortmer full length longmer S116
85 Table 4. Crystal data and structure refinement for iris. Identification code iris Empirical formula C14 H13 N O5 Formula weight Temperature 298(2) K Wavelength.7173 Å Crystal system Monoclinic Space group P2(1)/c Unit cell dimensions a = (3) Å = 9. b = (1) Å = 92.35(13). c = (2) Å = 9. Volume 125.1(4) Å 3 Z 4 Density (calculated) Mg/m 3 Absorption coefficient.117 mm -1 F() 576 Crystal size.14 x.5 x.2 mm 3 Theta range for data collection 2.4 to Index ranges -2<=h<=2, -1<=k<=7, -14<=l<=4 Reflections collected 3555 Independent reflections 2124 [R(int) =.327] Completeness to theta = % Absorption correction None Refinement method Full-matrix least-squares on F 2 Data / restraints / parameters 2124 / / 234 Goodness-of-fit on F Final R indices [I>2sigma(I)] R1 =.393, wr2 =.993 R indices (all data) R1 =.583, wr2 =.1186 Extinction coefficient.9(2) Largest diff. peak and hole.21 and -.24 e.å -3 S117
86 Table 41. Atomic coordinates ( x 14) and equivalent isotropic displacement parameters (Å2x 13) for iris. U(eq) is defined as one third of the trace of the orthogonalized Uij tensor. x y z U(eq) N(1) 2983(1) 1984(3) 6112(1) 34(1) O(1) 457(1) -2145(3) 367(2) 51(1) O(2) -14(1) 289(3) 3527(1) 48(1) O(3) 2276(1) 5185(3) 6411(1) 44(1) O(4) 3428(1) -1347(3) 5427(1) 49(1) O(5) 1179(1) 471(2) 543(1) 34(1) C(1) 187(1) -636(4) 3574(2) 41(1) C(2) 812(1) 1851(4) 3645(2) 41(1) C(3) 1152(1) 2542(4) 486(2) 35(1) C(4) 231(1) 2978(4) 4714(2) 34(1) C(5) 2422(1) 36(3) 5831(2) 33(1) C(6) 2988(1) 224(4) 5358(2) 35(1) C(7) 2349(1) 647(4) 4468(2) 35(1) C(8) 1611(1) -82(4) 4633(2) 35(1) C(9) 352(1) 2125(3) 795(2) 33(1) C(1) 3529(1) 382(4) 7853(2) 41(1) C(11) 427(1) 555(4) 881(2) 48(1) C(12) 4485(1) 2423(5) 8967(2) 51(1) C(13) 4456(1) 4141(4) 82(2) 47(1) C(14) 396(1) 44(4) 7255(2) 39(1) S118
87 Table 42. Bond lengths [Å] and angles [ ] for iris. N(1)-C(6) 1.382(3) N(1)-C(5) 1.388(3) N(1)-C(9) 1.437(3) O(1)-C(1) 1.47(3) O(1)-H(1A).94(4) O(2)-C(2) 1.412(3) O(2)-H(2A).92(4) O(3)-C(5) 1.22(2) O(4)-C(6) 1.2(2) O(5)-C(8) 1.439(2) O(5)-C(3) 1.442(2) C(1)-C(8) 1.515(3) C(1)-C(2) 1.56(3) C(1)-H(2B).97(2) C(2)-C(3) 1.532(3) C(2)-H(1B).96(2) C(3)-C(4) 1.525(3) C(3)-H(3A).98(2) C(4)-C(5) 1.57(3) C(4)-C(7) 1.525(3) C(4)-H(4A).94(2) C(6)-C(7) 1.56(3) C(7)-C(8) 1.542(3) C(7)-H(6A).96(2) C(8)-H(8A).97(2) C(9)-C(14) 1.373(3) C(9)-C(1) 1.376(3) C(1)-C(11) 1.385(3) C(1)-H(7A).97(3) C(11)-C(12) 1.37(4) C(11)-H(11A).95(2) C(12)-C(13) 1.372(4) C(12)-H(12A).96(3) C(13)-C(14) 1.38(3) C(13)-H(13A) 1.1(3) S119
88 C(14)-H(9A).96(2) C(6)-N(1)-C(5) (16) C(6)-N(1)-C(9) 123.6(16) C(5)-N(1)-C(9) 123.2(17) C(1)-O(1)-H(1A) 16(2) C(2)-O(2)-H(2A) 15(2) C(8)-O(5)-C(3) 96.9(15) O(1)-C(1)-C(8) 18.29(18) O(1)-C(1)-C(2) 112.1(18) C(8)-C(1)-C(2) 1.62(17) O(1)-C(1)-H(2B) 111.5(13) C(8)-C(1)-H(2B) 112.2(13) C(2)-C(1)-H(2B) 111.8(14) O(2)-C(2)-C(3) (18) O(2)-C(2)-C(1) (18) C(3)-C(2)-C(1) 11.66(17) O(2)-C(2)-H(1B) 16.8(11) C(3)-C(2)-H(1B) 11.(11) C(1)-C(2)-H(1B) 112.2(11) O(5)-C(3)-C(4) 99.91(16) O(5)-C(3)-C(2) 13.69(17) C(4)-C(3)-C(2) 18.37(17) O(5)-C(3)-H(3A) 19.5(13) C(4)-C(3)-H(3A) 117.2(13) C(2)-C(3)-H(3A) 116.1(12) C(5)-C(4)-C(3) 112.6(17) C(5)-C(4)-C(7) 14.36(16) C(3)-C(4)-C(7) 12.31(17) C(5)-C(4)-H(4A) 11.9(13) C(3)-C(4)-H(4A) 112.3(13) C(7)-C(4)-H(4A) 114.4(13) O(3)-C(5)-N(1) (18) O(3)-C(5)-C(4) (18) N(1)-C(5)-C(4) 18.32(17) O(4)-C(6)-N(1) 124.7(19) O(4)-C(6)-C(7) 127.5(2) S12
89 N(1)-C(6)-C(7) 17.84(17) C(6)-C(7)-C(4) 15.55(17) C(6)-C(7)-C(8) (18) C(4)-C(7)-C(8) 11.2(16) C(6)-C(7)-H(6A) 11.1(12) C(4)-C(7)-H(6A) 117.3(13) C(8)-C(7)-H(6A) 11.2(13) O(5)-C(8)-C(1) 12.46(16) O(5)-C(8)-C(7) 13.11(16) C(1)-C(8)-C(7) 18.7(17) O(5)-C(8)-H(8A) 19.(14) C(1)-C(8)-H(8A) 117.1(13) C(7)-C(8)-H(8A) 115.4(13) C(14)-C(9)-C(1) 121.5(2) C(14)-C(9)-N(1) 119.4(18) C(1)-C(9)-N(1) (19) C(9)-C(1)-C(11) 118.7(2) C(9)-C(1)-H(7A) 118.7(14) C(11)-C(1)-H(7A) 122.5(14) C(12)-C(11)-C(1) 12.2(2) C(12)-C(11)-H(11A) 12.8(14) C(1)-C(11)-H(11A) 119.1(14) C(11)-C(12)-C(13) 12.5(2) C(11)-C(12)-H(12A) 12.3(17) C(13)-C(12)-H(12A) 119.3(17) C(12)-C(13)-C(14) 12.1(2) C(12)-C(13)-H(13A) 118.7(17) C(14)-C(13)-H(13A) 121.1(17) C(9)-C(14)-C(13) 119.(2) C(9)-C(14)-H(9A) 12.7(14) C(13)-C(14)-H(9A) 12.3(14) Symmetry transformations used to generate equivalent atoms: S121
90 Table 43. Anisotropic displacement parameters (Å2x 13) for iris. The anisotropic displacement factor exponent takes the form: -22[ h2 a*2u h k a* b* U12 ] U 11 U 22 U 33 U 23 U 13 U 12 N(1) 29(1) 35(1) 37(1) -1(1) -5(1) 3(1) O(1) 45(1) 56(1) 51(1) -6(1) -9(1) -16(1) O(2) 31(1) 58(1) 54(1) 18(1) -13(1) -4(1) O(3) 42(1) 39(1) 49(1) -6(1) -5(1) 8(1) O(4) 41(1) 43(1) 61(1) -5(1) -3(1) 14(1) O(5) 32(1) 37(1) 32(1) 5(1) -2(1) (1) C(1) 37(1) 52(1) 36(1) -2(1) -1(1) -5(1) C(2) 31(1) 52(1) 4(1) 13(1) -3(1) -6(1) C(3) 29(1) 36(1) 4(1) 5(1) -4(1) 1(1) C(4) 3(1) 35(1) 36(1) 5(1) -1(1) -1(1) C(5) 27(1) 32(1) 4(1) 4(1) (1) -1(1) C(6) 27(1) 37(1) 41(1) 1(1) 1(1) 1(1) C(7) 31(1) 4(1) 34(1) -3(1) -1(1) 2(1) C(8) 36(1) 32(1) 37(1) -2(1) -3(1) 1(1) C(9) 24(1) 39(1) 36(1) (1) (1) 3(1) C(1) 36(1) 41(1) 48(1) 5(1) 2(1) 2(1) C(11) 49(1) 56(2) 4(1) 12(1) (1) 15(1) C(12) 42(1) 68(2) 41(1) -5(1) -9(1) 1(1) C(13) 37(1) 54(2) 48(1) -7(1) -5(1) -3(1) C(14) 35(1) 41(1) 41(1) 2(1) -1(1) -1(1) S122
91 Table 44. Hydrogen coordinates ( x 14) and isotropic displacement parameters (Å2x 1 3) for iris. x y z U(eq) H(1B) 134(11) 277(3) 371(16) 22(5) H(2B) 1375(13) -92(4) 29(2) 41(6) H(4A) 2135(12) 46(4) 4165(19) 35(6) H(3A) 848(13) 365(4) 521(18) 37(6) H(11A) 439(13) -63(4) 934(2) 42(6) H(6A) 2547(12) 39(4) 3735(19) 36(6) H(7A) 322(14) -95(4) 768(2) 48(7) H(8A) 1711(13) -229(4) 4936(19) 42(6) H(9A) 3921(13) 523(4) 674(2) 44(6) H(12A) 4828(16) 255(4) 962(2) 64(8) H(13A) 479(17) 552(5) 836(2) 74(9) H(1A) 278(19) -249(6) 293(3) 96(11) H(2A) -22(2) 94(6) 395(3) 12(12) S123
92 Table 45. Torsion angles [ ] for iris. O(1)-C(1)-C(2)-O(2) -13.7(3) C(8)-C(1)-C(2)-O(2) (19) O(1)-C(1)-C(2)-C(3) 18.19(19) C(8)-C(1)-C(2)-C(3) -6.66(19) C(8)-O(5)-C(3)-C(4) (17) C(8)-O(5)-C(3)-C(2) 52.91(17) O(2)-C(2)-C(3)-O(5) 93.5(2) C(1)-C(2)-C(3)-O(5) -28.3(19) O(2)-C(2)-C(3)-C(4) (18) C(1)-C(2)-C(3)-C(4) 77.5(2) O(5)-C(3)-C(4)-C(5) -7.1(2) C(2)-C(3)-C(4)-C(5) (18) O(5)-C(3)-C(4)-C(7) 41.18(19) C(2)-C(3)-C(4)-C(7) -66.9(2) C(6)-N(1)-C(5)-O(3) (19) C(9)-N(1)-C(5)-O(3) -5.3(3) C(6)-N(1)-C(5)-C(4) -4.5(2) C(9)-N(1)-C(5)-C(4) 176.(17) C(3)-C(4)-C(5)-O(3) -6.8(3) C(7)-C(4)-C(5)-O(3) -17.8(2) C(3)-C(4)-C(5)-N(1) (18) C(7)-C(4)-C(5)-N(1) 7.9(2) C(5)-N(1)-C(6)-O(4) 179.2(2) C(9)-N(1)-C(6)-O(4) -1.2(3) C(5)-N(1)-C(6)-C(7) -1.1(2) C(9)-N(1)-C(6)-C(7) 178.4(18) O(4)-C(6)-C(7)-C(4) (2) N(1)-C(6)-C(7)-C(4) 6.1(2) O(4)-C(6)-C(7)-C(8) 76.5(3) N(1)-C(6)-C(7)-C(8) -13.1(2) C(5)-C(4)-C(7)-C(6) -8.3(2) C(3)-C(4)-C(7)-C(6) (17) C(5)-C(4)-C(7)-C(8) 18.94(17) C(3)-C(4)-C(7)-C(8) -7.97(19) C(3)-O(5)-C(8)-C(1) (18) S124
93 C(3)-O(5)-C(8)-C(7) 54.3(17) O(1)-C(1)-C(8)-O(5) -78.(2) C(2)-C(1)-C(8)-O(5) 39.6(19) O(1)-C(1)-C(8)-C(7) (17) C(2)-C(1)-C(8)-C(7) -68.8(2) C(6)-C(7)-C(8)-O(5) 84.3(2) C(4)-C(7)-C(8)-O(5) (19) C(6)-C(7)-C(8)-C(1) (18) C(4)-C(7)-C(8)-C(1) 8.2(2) C(6)-N(1)-C(9)-C(14) 125.6(2) C(5)-N(1)-C(9)-C(14) -54.9(3) C(6)-N(1)-C(9)-C(1) -54.4(3) C(5)-N(1)-C(9)-C(1) 125.1(2) C(14)-C(9)-C(1)-C(11).6(3) N(1)-C(9)-C(1)-C(11) (19) C(9)-C(1)-C(11)-C(12) -.6(3) C(1)-C(11)-C(12)-C(13).1(4) C(11)-C(12)-C(13)-C(14).3(4) C(1)-C(9)-C(14)-C(13) -.2(3) N(1)-C(9)-C(14)-C(13) (19) C(12)-C(13)-C(14)-C(9) -.3(3) Symmetry transformations used to generate equivalent atoms: S125
94 O HO HO Hc 9 8 Hb O 2 Ha 6 O N Showing C8---C7 bonding O C 9 OH H b H C C 6 o Showing C7---C6 bonding C 5 C 8 O H a H b C 2 o S126
Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supplementary Information Oxidative Tandem Annulation of 1 (2 Ethynylaryl)prop 2 en 1 ones Catalyzed
More informationCopper(II) Ionic Liquid Catalyzed Cyclization-Aromatization of. Hydrazones with Dimethyl Acetylenedicarboxylate: A Green Synthesis
Copper(II) Ionic Liquid Catalyzed Cyclization-Aromatization of Hydrazones with Dimethyl Acetylenedicarboxylate: A Green Synthesis of Fully Substituted Pyrazoles Shirin Safaei, Iraj Mohammadpoor-Baltork,*
More informationZn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor
Supporting Information For Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor Zhaochao Xu,*,, Kyung-Hwa Baek, Ha Na Kim, Jingnan
More informationb = (17) Å c = (18) Å = (4) = (4) = (4) V = (3) Å 3 Data collection Refinement
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (Z)-N-tert-Butyl-2-(4-methoxyanilino)- N 0 -(4-methoxyphenyl)-2-phenylacetimidamide Sue A. Roberts, a * Biswajit
More informationExperimental. Crystal data. C 19 H 19 N 3 O 3 M r = Monoclinic, C2=c a = (3) Å b = (2) Å c = (3) Å = 110.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 A second monoclinic polymorph of 4-(2- hydroxy-4-methoxybenzylideneamino)- 1,5-dimethyl-2-phenyl-1H-pyrazol- 3(2H)-one
More informationExperimental. Crystal data. C 20 H 23 N 4 O 6 PS M r = Monoclinic, P2 1 =n a = (2) Å b = (4) Å c = (2) Å = 117.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Diethyl {(4-methoxyphenyl)[5-(4-nitro- phenyl)-1,3,4-thiadiazol-2-ylamino]- methyl}phosphonate Li-He Yin, Rong
More informationData collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 326 parameters 2 restraints
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-Chloro-N-(2,3-dichlorophenyl)- benzamide B. Thimme Gowda, a * Sabine Foro, b B. P. Sowmya a and Hartmut Fuess
More informationorganic compounds (E)-Ethyl N 0 -(3-hydroxybenzylidene)- hydrazinecarboxylate dihydrate
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (E)-Ethyl N 0 -(3-hydroxybenzylidene)- hydrazinecarboxylate dihydrate Xian-Chao Hu, a,b * Jie Zhang, a Da-Yong
More informationExperimental. Crystal data. C 12 H 20 N 4 O M r = Orthorhombic, P a = (3) Å b = (4) Å c = 14.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 5-[(1R,2R,4R)-2-Methoxy-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl]-1H-tetrazole Jan W. Bats,* Peter Schell and Joachim
More informationX-ray crystallographic analysis of 72 Data collection A colorless prism crystal of C Br 4 having approximate dimensions of mm was
Total synthesis of cortistatins A and J Shuji Yamashita, *,a Kentaro Iso, a Kazuki Kitajima, a Masafumi imuro, a and Masahiro irama *,a, b a Department of Chemistry, Graduate School of Science, Tohoku
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (Benzoato-j 2 O,O 0 )(5,5,7,12,12,14-hexamethyl-1,4,8,11-tetraazacyclotetradecane-j 4 N,N 0,N 00,N 000 )nickel(ii)
More informationHighly efficient hydrazination of conjugated nitroalkenes via imidazole or DMAP mediated Morita-Baylis-Hillman reaction
Experimental Data and ptimization Tables For Highly efficient hydrazination of conjugated nitroalkenes via imidazole or DMAP mediated Morita-Baylis-Hillman reaction M. Dadwal, S. M. Mobin, I... amboothiri
More informationExperimental. Crystal data
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4-Bromo-1-[2,6-dichloro-4-(trifluoromethyl)phenyl]-5-(4-methoxybenzylideneamino)-1H-pyrazole-3-carbonitrile Guohui
More informationExperimental. Crystal data. C 32 H 25 NO 5 M r = Monoclinic, C2=c a = (6) Å b = (2) Å c = (3) Å = 96.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Methyl 9-hydroxy-15-methyl-2-oxo-11- (pyren-1-yl)-10-oxa-15-azatetracyclo- [7.6.0.0 1,12.0 3,8 ]pentadeca-3(8),4,6-
More informationExperimental. Crystal data. C 22 H 26 N 2 O 3 M r = Triclinic, P1 a = (3) Å b = (4) Å c = (4) Å = (6) = 100.
Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 15-Methoxy-14,15-dihydroandranginine Dian-Lei Wang, a Xiang-Hai Cai, b Peng Huang a * and He-Ping Huang a * a School of Pharmacy,
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4-(4-Pyridyl)pyridinium bis(pyridine-2,6- dicarboxylato)chromium(iii) tetrahydrate Janet Soleimannejad,
More informationdata reports 11b-Hydroxymedroxyprogesterone Structure description
11b-Hydroxymedroxyprogesterone ISSN 2414-3146 Sharifah Nurfazilah Wan Yusop, a,b Sadia Sultan, a,b Bohari M. Yamin, c Syed Adnan Ali Shah a,b and Humera Naz a,b * Received 30 May 2016 Accepted 4 July 2016
More information2-Methyl-4-nitro-1-(4-nitrophenyl)-1H-imidazole
University of Wollongong Research Online Australian Institute for Innovative Materials - Papers Australian Institute for Innovative Materials 2007 2-Methyl-4-nitro-1-(4-nitrophenyl)-1H-imidazole Pawel
More informationorganic papers 4-Methylpyridinium bis(pyrocatecholato-j 2 O,O 0 )- borate catechol solvate
organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4-Methylpyridinium bis(pyrocatecholato-j 2 O,O 0 )- borate catechol solvate R. Angharad Baber, Jonathan P. H. Charmant,*
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Chlorido(2-chloronicotinato)triphenylantimony(V) Li Quan, Handong Yin* and Daqi Wang College of Chemistry
More informationThermotropic liquid crystals based on 1,8,9,16-tetrasubstituted tetraphenylenes and their structure-property relationship studies
Supporting Information Thermotropic liquid crystals based on 1,8,9,16-tetrasubstituted tetraphenylenes and their structure-property relationship studies Chun-Kit Hau a, b, c, Stephen Sin-Yin Chui d, Wei
More informationData collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 315 parameters
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N-(2,4,5-Trichlorophenyl)maleamic acid B. Thimme Gowda, a * Miroslav Tokarčík, b Jozef Kožíšek, b K. Shakuntala
More informationTENOFOVIR TABLETS: Final text for addition to The International Pharmacopoeia (June 2010)
June 2010 TENOFOVIR TABLETS: Final text for addition to The International Pharmacopoeia (June 2010) This monograph was adopted at the Forty-fourth WHO Expert Committee on Specifications for Pharmaceutical
More informationExperimental. Crystal data. C 23 H 20 N 2 O 2 M r = Monoclinic, P2 1 =c a = (3) Å b = (1) Å c = (2) Å = 91.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 8-Benzyloxy-2-methyl-3-(2-methylphenyl)quinazolin-4(3H)-one Adel S. El-Azab, a,b Alaa A.-M. Abdel-Aziz, a,c Seik
More informationdata reports cis-cyclohexane-1,3-dicarboxylic acid N,N 0 -(pentane-1,5-diyl)bis(pyridine-4-carboxamide) water (1/1/2) Structure description
ISSN 2414-3146 cis-cyclohexane-1,3-dicarboxylic acid N,N 0 -(pentane-1,5-diyl)bis(pyridine-4-carboxamide) water (1/1/2) Brianna L. Martinez and Robert L. LaDuca* Received 23 September 2017 Accepted 12
More informationExperimental. Crystal data
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N,N 0 -(Biphenyl-2,2 0 -diyl)bis(furan-2- carboxamide) Chin Hui Kee, Noel F. Thomas, Azhar Ariffin, Khalijah Awang
More informationRefinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 385 parameters
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 3a,6a-Bis(ethoxycarbonyl)glycoluril (diethyl 2,5-dioxoperhydroimidazo- [4,5-d]imidazole-3a,6a-dicarboxylate) Yu-Zhou
More informationThis is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail.
This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail. Author(s): Salorinne, Kirsi; Tero, Tiia-Riikka; Lahtinen, Tanja Title:
More informationExperimental. Crystal data
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Bis[8-ethyl-5-oxo-2-(piperazin-4-ium-1- yl)-5,8-dihydropyrido[2,3-d]pyrimidine- 6-carboxylic acid] 2,5-dicarboxybenzene-1,4-dicarboxylate
More information2. Experimental Crystal data
data reports ISSN 2056-9890 Crystal structure of (tert-butyldimethylsilyl)triphenylgermane, Ph 3 Ge-SiMe 2 (t-bu) Kirill V. Zaitsev, a Galina S. Zaitseva, a Sergey S. Karlov a * and Alexander A. Korlyukov
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 catena-poly[{di-l-isonicotinato-bis- [diaquaisonicotinatoeuropium(iii)]}-l- isonicotinato-[diisonicotinatocopper(ii)]-
More informationHigh-Throughput Analysis of Oligonucleotides using Automated Electrospray Ionization Mass Spectrometry
High-Throughput Analysis of Oligonucleotides using Automated Electrospray Ionization Mass Spectrometry Mark E. Hail 1, Brian Elliott 2, Kerry Nugent 3, Jeffrey L. Whitney 1, and David J. Detlefsen 1 1
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Bis{3-amino-1-carbamothioyl-5-[(2-{[(5- methyl-1h-imidazol-3-ium-4-yl)methyl]- sulfanyl}ethyl)amino]-1h-1,2,4-triazol-4-
More information= (3) = (3) = (4) V = (4) Å 3 Z =2. Data collection. Refinement
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 = 95.181 (3) = 112.830 (3) = 106.243 (4) V = 948.7 (4) Å 3 Z =2 Mo K radiation = 0.07 mm 1 T = 298 (2) K 0.41
More informationExperimental. Crystal data. C 20 H 26 O 4 M r = Orthorhombic, P a = (1) Å b = (2) Å c = 13.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Redetermination and absolute configuration of 6-hydroxysalvinolone Hoong-Kun Fun, a * Ching Kheng Quah a and Suchada
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Diaquabis{4-[(pyridin-2-yl)methylideneamino]benzenesulfonato-j 2 N,N 0 }- nickel(ii) tetrahydrate Chao-Zhu
More informationAeris. Precision Engineered Core- Shell Particles for Ultra-High Resolution BioSeparations. Aeris PEPTIDE. Aeris WIDEPORE
Aeris Precision Engineered Core- Shell Particles for Ultra-High Resolution BioSeparations Aeris is a specialized line of reversed phase core-shell UHPLC columns, built exclusively for the ultra-high performance
More informationExperimental. Crystal data. C 23 H 34 O 4 M r = Orthorhombic, P a = (6) Å b = (4) Å c = 18.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 3b-Acetoxy-19-hydroxy-D 5 -pregnen-20- one Aike Meier zu Greffen, Darius P. Kranz, Jörg-M. Neudörfl and Hans-Günther
More informationSulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms
Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli
More information2. Experimental Crystal data
data reports Metal-organic coordination complexes of N,N 0 -bis(salicylidene)ethylenediamine (salen) Schiff-base derivatives have been studied extensively within the fields of homogeneous catalysis (Wezenberg
More informationaddenda and errata 5,17-Di-tert-butyl-25,27-dihydroxycalix[4]arene. Erratum
addenda and errata Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 5,17-Di-tert-butyl-25,27-dihydroxycalix[4]arene. Erratum Jeffrey C. Bryan,* Richard A. Sachleben and Agathe Urvoas
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-(2-Pyridyl)pyridinium bis(pyridine-2,6- dicarboxylato-j 3 O,N,O 0 )aluminate(iii) trihydrate Janet Soleimannejad,
More informationSupporting Information to Sulfate templated assembly of neutral receptors in aqueous DMSO orthogonal versus biplane structures
Supporting Information to Sulfate templated assembly of neutral receptors in aqueous DMS orthogonal versus biplane structures Krzysztof Bąk, Michał J. Chmielewski,* 1. Synthesis and characterisation of
More informationb = (10) Å c = (3) Å V = (3) Å 3 Z =4 Data collection Refinement
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N-(Fluoren-9-ylmethoxycarbonyl)-Laspartic acid 4-tert-butyl ester Kazuhiko Yamada, a * Daisuke Hashizume b and
More informationZ =2 Mo K radiation = 0.11 mm 1. Data collection. Refinement
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N 0 -[(E)-4-Benzyloxy-2-hydroxybenzylidene]-4-nitrobenzohydrazide monohydrate Bibitha Joseph, a M. Sithambaresan
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 catena-poly[[bis[aqua(1,10-phenanthroline)lead(ii)]-bis(l 3-2-hydroxy-5-sulfonatobenzoato)] acetic acid
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Di-l 2 -acetato-1:2j 2 O:O 0 ;2:3j 2 O:O 0 -bis- (N,N 0 -dimethylformamide)-1jo,3jobis{l 2-2,2 0 -[propane-1,3-diylbis(iminomethylene)]diphenolato-1j
More informationSupporting Information
Supporting Information A Regioselective Ring-Expansion of Isatins with In-situ Generated α-aryldiazomethanes; Direct Access to Viridicatin Alkaloids Yellaiah Tangella,, Kesari Lakshmi Manasa,, Namballa
More informationExperimental. Crystal data. C 26 H 34 F 2 N 6 S M r = Monoclinic, P2 1 =n a = (11) Å b = (6) Å c = (14) Å = 92.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 3-(Adamantan-1-yl)-4-[(E)-(2,6-difluoro- benzylidene)amino]-1-[(4-ethylpiperazin- 1-yl)methyl]-4,5-dihydro-1H-1,2,4-triazole-5-thione
More informationExperimental. Crystal data. C 24 H 25 NOSi M r = Monoclinic, P2 1 =c a = (3) Å b = (19) Å c = (6) Å = 124.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N-[(9H-Fluoren-9-ylidene)(2-methoxyphenyl)methyl]-1,1,1-trimethylsilanamine Zhong-Yuan Li, Peng Wang and Xia Chen*
More informationLimonin isolated from the seeds of Citrus limetta (Indian sweet lemon)
Limonin isolated from the seeds of Citrus limetta (Indian sweet lemon) ISSN 2414-3146 A. K. Bauri, a Sabine Foro b and Quynh Nguyen Do Nhu c * Received 18 January 2016 Accepted 27 January 2016 Edited by
More informationA 3D Porous Metal-Organic Framework Exhibiting Selective. Adsorption of Water over Organic Solvents
Supporting Information for A 3D Porous Metal-Organic Framework Exhibiting Selective Adsorption of Water over Organic Solvents Jin-Zhong Gu, Long Jiang, Wen-Guan Lu, Hong-Cai Zhou, and Tong-Bu Lu* Table
More informationExperimental. Crystal data. C 25 H 16 Cl 2 O 4 C 2 H 6 O M r = Tetragonal, I4 a = (5) Å c = (2) Å V = 4676.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 1,8-Bis(4-chlorobenzoyl)-7-methoxynaphthalen-2-ol ethanol monosolvate Ryosuke Mitsui, a Atsushi Nagasawa, a Keiichi
More informationIntroduction to the Oligo HTCS Systems. Novatia, LLC
Introduction to the Oligo HTCS Systems Novatia, LLC What is the Oligo HTCS and what can it do? Automated ESI/MS system that can analyze up to 14 oligonucleotide samples/day (>3/day with twin autosampler)
More informationExperimental. Crystal data. C 24 H 19 N 3 O M r = Monoclinic, C2=c a = (2) Å b = (4) Å c = (12) Å = 113.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 3,5-Diphenyl-1-(quinolin-2-yl)-4,5- dihydro-1h-pyrazol-5-ol Muhd. Hidayat bin Najib, a Ai Ling Tan, a David J.
More informationExperimental. Crystal data
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 1-(4-Methylphenylsulfonyl)-2-{[3-methyl- 4-(2,2,2-trifluoroethoxy)pyridin-2-yl]- methylsulfanyl}-1h-1,3-benzimidazole
More informationorganic compounds N-Cinnamoyl-L-phenylalanine methyl ester Related literature References Experimental
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N-Cinnamoyl-L-phenylalanine methyl ester Laurent F. Bornaghi, Sally-Ann Poulsen, Peter C. Healy and Alan R. White*
More informationAnalysis of Uncomplexed and Copper-complexed Methanobactin with UV/Visible Spectrophotometry, Mass Spectrometry and NMR Spectrometry
Analysis of Uncomplexed and Copper-complexed Methanobactin with UV/Visible Spectrophotometry, Mass Spectrometry and NMR Spectrometry Lee Behling, Alan DiSpirito, Scott Hartsel, Larry Masterson, Gianluigi
More informationMulticomponent Self-Assembly of a Pentanuclear Ir-Zn Heterometal-Organic Polyhedron for Carbon Dioxide Fixation and Sulfite Sequestration
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Multicomponent Self-Assembly of a Pentanuclear Ir-Zn Heterometal-Organic Polyhedron for Carbon
More informationExperimental. Crystal data. C 26 H 36 O 7 M r = Orthorhombic, P a = (2) Å b = (3) Å c = (3) Å.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 1,3,7-Trideacetylkhivorin Experimental Crystal data C 26 H 36 O 7 M r = 460.55 Orthorhombic, P2 1 2 1 2 1 a =
More informationyl}-3-oxo-1,2,5-thiadiazolidin-2-ide 1,1-dioxide: a potential inhibitor of the enzyme protein tyrosine phosphatase 1B (PTP1B)
journals.iucr.org/e Crystal structure of 5-{4 -[(2-{2-[2-(2-ammonioethoxy)ethoxy]ethoxy}ethyl)carbamoyl]-4-methoxy-[1,1 -biphenyl]-3- yl}-3-oxo-1,2,5-thiadiazolidin-2-ide 1,1-dioxide: a potential inhibitor
More informationTenofovir disoproxil fumarate (Tenofoviri disoproxili fumaras)
C 19 H 30 N 5 O 10 P. C 4 H 4 O 4 Relative molecular mass. 635.5. Chemical names. bis(1-methylethyl) 5-{[(1R)-2-(6-amino-9H-purin-9-yl)-1-methylethoxy]methyl}-5-oxo-2,4,6,8-tetraoxa-5-λ 5 - phosphanonanedioate
More informationSupplementary Figures
Supplementary Figures Absorption 4 3 2 1 Intensity Energy U(R) relaxation ~~~ ~~~~~~ 2 3 4 1 S S 1 2 3 4 1 Fluoescence 4 3 2 1 Intensity H-aggregation ~~~~ J-aggregation Absorption Emission Vibrational
More informationSelf-organization of dipyridylcalix[4]pyrrole into a supramolecular cage for dicarboxylates
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Self-organization of dipyridylcalix[4]pyrrole into a supramolecular
More informationCHAPTER-6 IDENTIFICATION, AND CHARACTERISATION OF DEGRADATION IMPURITY IN VALSARTAN TABLETS
129 CHAPTER-6 IDENTIFICATION, AND CHARACTERISATION OF DEGRADATION IMPURITY IN VALSARTAN TABLETS 130 6.1. Introduction Valsartan is an orally active specific angiotensin II blocker effective in lowering
More informationMinutes Figure S1. HPLC separation of nucleosides from LC/ESI-MS analysis of a total enzymatic Trp
100 A % Relative Abundance m m Ø acp 5 m Øm 5 m m 7 m s * 6 ia m * 0 5 10 15 0 5 0 5 40 Minutes Figure S1. HPL separation of nucleosides from L/ESI-MS analysis of a total enzymatic digest of mt trna. V
More informationA pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state
A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state Mingguang Pan, Min Xue* Department of Chemistry, Zhejiang University, Hangzhou 310027, P. R. China Fax:
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Dichlorido(4,4 0 -di-tert-butyl-2,2 0 -bipyridine-j 2 N,N 0 )palladium(ii) dimethyl sulfoxide monosolvate
More informationDetermination of taurine in energy drinks by high-performance liquid chromatography
Determination of taurine in energy drinks by high-performance liquid chromatography Brad McConn Department of Chemistry, Concordia College, 901 8 th St S, Moorhead, MN 56562 Abstract The concentration
More informationSupporting Information
Supporting Information Cyclic Peptidyl Inhibitors against Human Peptidyl-Prolyl Isomerase Pin1 Tao Liu, Yu Liu, Hung-Ying Kao, *,, and Dehua Pei Table of Contents: Table S1. Structures of amino acid building
More informationorganic papers Elaidic acid (trans-9-octadecenoic acid)
organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Elaidic acid (trans-9-octadecenoic acid) John Nicolson Low, a * Charlie Scrimgeour b and Peter Horton c a Department
More informationExperimental. Crystal data. C 22 H 32 O 4 M r = Triclinic, P1 a = (1) Å b = (1) Å c = (1) Å = (1) = 79.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Methyl 3,5-bis(cyclohexylmethoxy)- benzoate Peter W. R. Corfield,* Michele L. Paccagnini and Amy M. Balija Department
More informationZ =4 Mo K radiation = 0.10 mm 1. Data collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 N,N 0,N 00 -Triphenylguanidinium 5-nitro- 2,4-dioxo-1,2,3,4-tetrahydropyrimidin-1- ide P. S. Pereira Silva, S.
More informationData collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 283 parameters
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Dimethylammonium 3-carboxybenzoate Tausif Siddiqui, Vandavasi Koteswara Rao, Matthias Zeller and Sherri R. Lovelace-Cameron*
More informationresearch communications Crystal structure of nitrido[5,10,15,20-tetrakis(4- methylphenyl)porphyrinato]manganese(v)
research communications Crystal structure of nitrido[5,10,15,20-tetrakis(4- methylphenyl)porphyrinato]manganese(v) ISSN 1600-5368 Mason R. Shields, a Ilia A. Guzei b * and James G. Goll a Received 29 July
More informationMetabion GmbH, Germany
Metabion GmbH, Germany CUSTOM OLIGO NUCLEOTIDE SYNTHESIS DNA Single Tube Format (price per base) Scale Standard Yield OPC Purified Yield HPLC Purified Yield (µmol) Rs (OD 260 ) Rs (OD 260 ) Rs (OD 260
More informationDirect ortho-c H Functionalization of Aromatic Alcohols Masked by Acetone Oxime Ether via exo-palladacycle
Direct ortho-c H Functionalization of Aromatic Alcohols Masked by Acetone Oxime Ether via exo-palladacycle Kun Guo, Xiaolan Chen, Mingyu Guan, and Yingsheng Zhao* Key Laboratory of Organic Synthesis of
More informationdimethylformamide monosolvate
research communications ISSN 2056-9890 Crystal structure of N-[6-amino-5-(benzo[d]thiazol- 2-yl)-3-cyano-4-methylsulfanyl-2-oxo-1,2-dihydropyridin-1-yl]-4-methylbenzenesulfonamide dimethylformamide monosolvate
More informationMonoclinic, P2 1 =n a = (9) Å b = (8) Å c = (11) Å = (1) V = (2) Å 3. Data collection.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-[2-(4-Bromophenyl)hydrazinylidene]- 1,3-diphenylpropane-1,3-dione Carlos Bustos, a Luis Alvarez-Thon, b * Juan-Guillermo
More informationRefinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 405 parameters 12 restraints
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4-Nitrophenyl a-l-rhamnopyranoside hemihydrate 1 Jianbo Zhang, a * Jie Fu, a Xuan Chen, a Yijun Gu b and Jie Tang
More informationMass-Based Purification of Natural Product Impurities Using an Agilent 1260 Infinity II Preparative LC/MSD System
Application Note Food Testing and Agriculture Mass-Based Purification of Natural Product Impurities Using an Agilent 126 Infinity II Preparative LC/MSD System Authors Florian Rieck and Jörg Hippler Agilent
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang
More informationSupporting Information
Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,
More informationGuajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava.
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Chuang-Jun Li, Jie Ma, Hua Sun, Dan Zhang, and Dong-Ming Zhang* State Key Laboratory
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Diaqua[(1R,2S,4R,8R,9S,11R)-2,9-dimethyl-1,4,8,11-tetraazacyclotetradecane]nickel(II) dichloride dihydrate
More informationData collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 225 parameters
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Dicyclohexylammonium 2-methoxybenzoate Nenad Judaš a * and Tomislav Portada b Data collection Oxford Diffraction
More informationSupporting Information. 58 Pages. 6 Figures 4 Tables
Light-Source-Dependent Effects of Main Water Constituents on Photodegradation of Phenicol Antibiotics: Mechanism and Kinetics Linke Ge, Jingwen Chen, * Xianliang Qiao, Jing Lin, Xiyun Cai Key Laboratory
More informationSUPPLEMENTAL DATA. Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase
SUPPLEMENTAL DATA Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase William E. Boeglin & Alan R. Brash Fig. S1 SP-HPLC separation
More informationmetal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 b = 19.1695 (15) Å c = 16.6178 (14) Å = 90.786 (6) V = 2077.4 (3) Å 3 Z =4 Mo K radiation = 1.34 mm 1 T
More informationExperimental. Crystal data. C 26 H 30 N 2 M r = Triclinic, P1 a = (3) Å b = (4) Å c = (5) Å = (2) = 77.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (E)-N-[2-(Benzyliminomethyl)phenyl]- 2,6-diisopropylaniline Yi-Chang Liu, a Chia-Her Lin, a Hsiao-Li Chen b and
More informationIJPAR Vol.3 Issue 4 Oct-Dec-2014 Journal Home page:
IJPAR Vol.3 Issue 4 Oct-Dec-2014 Journal Home page: ISSN: 2320-2831 Research article Open Access Method development and validation of tenofovir disoproxil fumerate and emtricitabine in combined tablet
More informationNaoya Takahashi, Keiya Hirota and Yoshitaka Saga* Supplementary material
Supplementary material Facile transformation of the five-membered exocyclic E-ring in 13 2 -demethoxycarbonyl chlorophyll derivatives by molecular oxygen with titanium oxide in the dark Naoya Takahashi,
More informationChallenges in Artemisinin
Challenges in Artemisinin Analysis Bhupinder P S Khambay and Aditi Gulati Kamtech Technologies Ltd Artemisinin Conference 2010 12 th -14 th October 2010 in Antananarivo, Madagascar Outline of Presentation
More informationSUPPLEMENTARY DATA. Materials and Methods
SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters
More informationExperimental. Crystal data. C 30 H 48 ClN 3 O M r = Orthorhombic, P a = (2) Å b = (3) Å c = 26.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 3b-Chloro-6-[2-(2-cyanoacetyl)hydrazin- 1-ylidene]-5a-cholestane Samina Khan Yusufzai, a Hasnah Osman, a Aisyah
More informationUltra High Performance Liquid Chromatograph. Nexera X2 C196-E079
Ultra High Performance Liquid Chromatograph Nexera X2 C196-E79 Maximizing the Potential of UHPLC/HPLC Analyses Intelligence Intelligent data solutions, including a new i -PDeA peak calculation method for
More informationSynthesis of Sequence-Controlled Acrylate Oligomers. via Consecutive RAFT Monomers Additions
Supporting Information Synthesis of Sequence-Controlled Acrylate ligomers via Consecutive RAFT Monomers Additions Joke Vandenbergh a, Gunther Reekmans, b Peter Adriaensens b and Thomas Junkers a * a Polymer
More informationThermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
More informationGlycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
More informationRebaudioside a From Multiple Gene Donors Expressed in Yarrowia Lipolytica
Residue Monograph prepared by the meeting of the Joint FAO/WHO Expert Committee on Food Additives (JECFA), 82 nd meeting 2016 Rebaudioside a From Multiple Gene Donors Expressed in Yarrowia Lipolytica This
More information