A minimal model for hepatic fatty acid balance during fasting: Application to PPAR alpha-deficient mice
|
|
- Liliana Page
- 5 years ago
- Views:
Transcription
1 A mnmal model for hepatc fatty acd balance durng fastng: Applcaton to PPAR alpha-defcent mce Perre Blavy, F. Gondret, Hervé Gullou, S. Lagarrgue, P.G.P. Martn, J. Van Mlgen, Ovdu Radulescu, A. Segel To cte ths verson: Perre Blavy, F. Gondret, Hervé Gullou, S. Lagarrgue, P.G.P. Martn, et al.. A mnmal model for hepatc fatty acd balance durng fastng: Applcaton to PPAR alpha-defcent mce. Journal of Theoretcal Bology, Elsever, 2009, 261 (2), pp.266. < /j.jtb >. <hal > HAL Id: hal Submtted on 25 Jan 2011 HAL s a mult-dscplnary open access archve for the depost and dssemnaton of scentfc research documents, whether they are publshed or not. The documents may come from teachng and research nsttutons n France or abroad, or from publc or prvate research centers. L archve ouverte plurdscplnare HAL, est destnée au dépôt et à la dffuson de documents scentfques de nveau recherche, publés ou non, émanant des établssements d ensegnement et de recherche franças ou étrangers, des laboratores publcs ou prvés.
2 Author s Accepted Manuscrpt A mnmal model for hepatc fatty acd balance durng fastng: Applcaton to PPAR alpha-defcent mce* P. Blavy, F. Gondret, H. Gullou, S. Lagarrgue, P.G.P. Martn, J. van Mlgen, O. Radulescu, A. Segel PII: S (09) DOI: do: /j.jtb Reference: YJTBI To appear n: Journal of Theoretcal Bology Receved date: 21 March 2009 Revsed date: 25 June 2009 Accepted date: 16 July 2009 Cte ths artcle as: P. Blavy, F. Gondret, H. Gullou, S. Lagarrgue, P.G.P. Martn, J. van Mlgen, O. Radulescu and A. Segel, A mnmal model for hepatc fatty acd balance durng fastng: Applcaton to PPAR alpha-defcent mce*, Journal of Theoretcal Bology, do: /j.jtb Ths s a PDF fle of an unedted manuscrpt that has been accepted for publcaton. As a servce to our customers we are provdng ths early verson of the manuscrpt. The manuscrpt wll undergo copyedtng, typesettng, and revew of the resultng galley proof before t s publshed n ts fnal ctable form. Please note that durng the producton process errors may be dscovered whch could affect the content, and all legal dsclamers that apply to the journal pertan.
3 A mnmal model for hepatc fatty acd balance durng fastng: applcaton to PPAR alpha-defcent mce* P. Blavy a,g,f.gondret a, H. Gullou b, S. Lagarrgue c,d,e,p.g.p.martn b, J. van Mlgen a, O. Radulescu h,g,a.segel f,g a INRA, UMR1079 Systèmes d Elevage, Nutrton Anmale et Humane (SENAH), F Sant Glles, France b INRA, UR66 Laboratore de Pharmacologe et Toxcologe, 180 Chemn de Tournefeulle, BP3, F Toulouse cedex 9, France c Agrocampus Ouest, UMR 598 Génétque Anmale, F Rennes, France d INRA, UMR 598 Génétque Anmale, F Rennes, France e IFR 140, GFAS, F Rennes, France f CNRS, UMR 6074 IRISA, Campus de Beauleu, F Rennes, France g INRIA Rennes Bretagne Atlantque, Symbose-project, Campus de Beauleu, F Rennes, France h Unversté de Rennes 1, UMR 6625 IRMAR, Campus de Beauleu, F Rennes, France Abstract The purpose of ths study s to dentfy the herarchy of mportance amongst pathways nvolved n fatty acd (FA) metabolsm and ther regulators n the control of hepatc FA composton. A modelng approach was appled to expermental data obtaned durng fastng n PPARα-knockout (KO) mce and wld-type mce. A step-by-step procedure was used n whch a very smple model was completed by addtonal pathways untl the model ftted correctly the measured quanttes of FA n the lver. The resultng model ncluded FA uptake by the lver, FA oxdaton, elongaton and elongaton and desaturaton of FA, whch were found actve n both genotypes durng fastng. From the model analyss we concluded that PPARα had a strong effect on FA oxdaton. There were no ndcatons that ths effect changes durng the fastng perod, and t was thus consdered to be constant. In PPARα KO mce, FA uptake was dentfed as the man pathway responsble for FA varaton n the lver. The models showed that FA were oxdzed Emal addresses: perre.blavy@rsa.fr (P. Blavy), florence.gondret@rennes.nra.fr (F. Gondret), Herve.Gullou@toulouse.nra.fr (H. Gullou), Sandrne.Lagarrgue@agrocampus-ouest.fr (S. Lagarrgue), Pascal.Martn@toulouse.nra.fr (P.G.P.Martn),jaap.vanmlgen@rennes.nra.fr (J. van Mlgen), ovdu.radulescu@nra.fr (O. Radulescu ), anne.segel@rsa.fr (A. Segel) * Results were partally presented at the JOBIM-2008 meetng held n Llle, France. ** Correspondng Author : IRISA, Campus de Beauleu. F Rennes Cedex FRANCE. Tel.: ; fax: Preprnt submtted to Elsever June 25, 2009
4 at a constant and small rate, whereas elongaton and desaturaton of FA also occurred durng fastng. The latter observaton was rather unexpected, but was confrmed expermentally by the measurement of delta-6-desaturase mrna usng real-tme quanttatve PCR (QPCR). These results confrm that mathematcal models can be a useful tool n dentfyng new bologcal hypotheses and nutrtonal routes n metabolsm. Key words: fatty acd metabolsm, systems bology, fastng, knockout mce, modellng. 1. Introducton Fatty acds (FA) are the man consttuents of lpds n the body and are buldng blocks for glyco- and phospholpds of cell membranes. FA also play an mportant role n energy metabolsm, allowng the storage of energy n a very dense form as trglycerdes, whch can be oxdzed later when energy s needed. The FA can also act as sgnalng molecules and behave as regulators of several transcrpton factors (Duplus et al., 2000). Therefore, they play crucal roles n normal growth and development (e.g., (Uauy et al., 2007)) but also n coronary artery dsease (Sedeln, 1995; Shra, 2004), dyslpdema, hepatc steatoss and other pathologes (Sedeln, 1995; Smopoulos, 1991). The balance between synthess and degradaton of FA s regulated by nutrent supply and the energy needs of the organsm. In humans and mce, the lver plays a central role n the endogenous synthess of FA (Murur and Levelle, 1970). Durng fastng, FA are released from adpose tssue (AT) by lpolyss, and serve as sources of energy n other organs. Crculatng free FA are extensvely taken up by the lver n fastng rodents (Remesy and Demgne, 1983). In the lver, FA can be a source of substrates for the synthess of ketone bodes ketone, whch can be used as fuel by extrahepatc tssues. The synthess, degradaton, and transformaton of FA n hepatc cells are catalyzed by over 300 enzymatc reactons (Kanehsa et al., 2008) nvolved n dstnct pathways (e.g., FA oxdaton and elongaton). These reactons are regulated at the metabolc and genetc levels by varous hormones (e.g., nsuln (Campbell et al., 1992), leptn (Unger et al., 1999)) and nutrents (e.g., poly unsaturated FA (Sessler and Ntamb, 1998)). However, the smple aggregaton of abundant lterature data cannot account for all underlyng nteractons responsble for both FA metabolsm and lpd phenotype. A better and more comprehensve understandng of FA metabolsm s needed to dentfy routes that wll allow for the nutrtonal modulaton of lpd deposton that may help preventng or curng lpd-related dsorders. Therefore, t s crtcal to dentfy the man pathways and regulators nvolved n the control of FA metabolsm. To acheve ths goal, we used a modellng approach. Mathematcal models are powerful tools to combne nformaton usng a common formalsm. Models are frequently used to descrbe, predct and test hypotheses. Dependng on the objectve, models can have dfferent levels of detal, 2
5 rangng from very basc molecular mechansms (e.g., (Fattal and Ben-Shaul, 1993)) to an emprcal black box approach (e.g., (Forns et al., 2002)). Models can be useful to explore and better understand FA metabolsm and ts regulaton wthn a cell, as well as between organs nvolved n lpd metabolsm. To provde a full descrpton of the dynamcs of the system consdered as a homogeneous organ (e.g., (Calvett et al., 2008)) or ncludng the heterogeneous nature of the organ (e.g., spatal models (Chalhoub et al., 2007b)), metabolc reactons are modeled as dfferental equatons or analyzed by convex optmzaton technques such as flux balance analyss. Spatal models typcally use partal dfferental equatons. A contrasted stuaton s necessary to dentfy the key mechansms nvolved n the regulaton of FA metabolsm. In the present study, we consdered the knetcs of FA metabolsm durng fastng n both wld-type and peroxsome prolferator-actvated receptor alpha (PPARα) knockout (KO) mce. Fastng trggers complex adaptve metabolc responses, ncludng a swtch to rely on FA and ketone bodes for ATP synthess ((Leone et al., 1999)) and an ncreased capacty for mtochondral FA oxdaton n tssues wth hgh energy demands (Hashmoto et al., 2000; Leone et al., 1999). The PPARα s consdered as the master regulator of FA homeostass (Desvergne and Wahl, 1999; Leone et al., 1999). A genome-wde transcrptomc approach n mce has recently ponted out the role of PPARα n the lver n the regulaton of FA oxdaton and ketone body producton durng fastng (Sokolovć et al., 2008). Anmals lackng PPARα appear to be unable to ncrease the capacty for cellular FA utlzaton (Leone et al., 1999). Montorng the varaton n FA composton n tssues of wld-type and PPARα KO mce durng fastng provdes a useful expermental data set to understand the regulaton of FA metabolsm and to develop computatonal models descrbng ths metabolsm. To our knowledge, there s only one model (Chalhoub et al., 2007a) focused on lpd metabolsm n the lver durng fastng condtons. Ths detaled mathematcal model was based on dfferental equatons and smulated gluconeogeness durng a 24-h fastng perod n the perfused rat lver. Ths model ncluded key reactons for FA metabolsm such as FA uptake, synthess of trglycerdes, and FA oxdaton. Because of the large number of reactons nvolved, many of these were aggregated n seres. Moreover, ths model dd not ntend to predct the varaton n FA composton n the lver and dd not nclude the genetc regulaton of FA metabolsm. It ntended to predct concentratons and fluxes of ntermedate metaboltes nvolved n FA metabolsm and gluconeogeness n response to changes n varous substrate concentratons n the perfused lver. The am of the present study was to dentfy the most relevant pathways and ther regulators nvolved n hepatc FA metabolsm. Based on expermental data and nformaton from the lterature, a model (based on dfferental equatons) was developed that allows to explan the varaton n FA composton of the mouse lver durng a fed-to-fastng transton. Addtonal expermental measurements (mrna expresson of delta-6-desaturase, a key enzyme of polyunsaturated FA synthess) were carred out to evaluate hypotheses that were formulated followng model analyses. 3
6 2. Materals and methods 2.1. Bologcal experments Expermental data Expermental data were obtaned n 8 week-old male wld-type C57BL/6J (WT) and PPARα KO mce (Lee et al., 1995; Costet et al., 1998) over a 72 h fastng perod. Three to 6 mce for each genotype were sacrfced at dfferent tmes ponts (0, 3, 6, 9, 12, 18, 24, 36, 48, 60, 72 h) after the last meal. Before fastng, all anmals were fed ad lbtum a rodent det 2018 from Harlan Teklad (Gannat, France). At each tme pont, anmal body weght was recorded and lver and epddymal Whte Adpose tssue (AT) were dssected, weghed, frozen n lqud ntrogen mmedately after dssecton, and stored at -80 Cuntl analyss. Total lpd content was determned n lver and AT as descrbed prevously (Martn et al., 2007). Proportons of ndvdual FA were determned by gas chromatography analyss of FA methyl esters. The quanttes of each FA (C14:0, C16:0, C16:1ω9, C16:1ω7, C18:0, C18:1ω9, C18:1ω7, C18:2ω6, C18:3ω3, C20:1ω9, C20:3ω6, C20:4ω6, C20:5ω3, C22:6ω3) n the lver and AT were calculated consderng the relatve proportons of FA n total lpds and the mass of lver and AT. Tme-related varatons n FA quantty were analyzed usng the lm() lnear regresson mplemented n R ( Gene expresson Hepatc total RNA was extracted usng Trzol reagent (Invtrogen) accordng to the manufacturer s nstructon. Complementary cdna was syntheszed from 2 μg of total RNA usng random prmers and Superscrpt II (Invtrogen) reverse transcrptase accordng to the manufacturer s nstructons. The mrna levels of Delta6 desaturase (D6D) were measuredby quanttatve real-tme PCR (QPCR) after 0, 24, 48, and 72 h of fastng usng 3 -TCCAGTACCAGATCATCATGA- CAA-5 as forward prmer and 3 -GGTGTAGAAGAAACGCATATAGTAGCTG-5 as reverse prmer. Amplfcatons were performed on an ABI Prsm 7000 Sequence Detecton System (Appled Bosystems, Courtaboeuf, France). The QPCR data were normalzed by TATA-box bndng proten (TBP) expresson levels (TBP-F: ACTTCGTGCAAGAAATGCTGAA, TBP-R: GCAGTTGTC- CGTGGCTCTCT) and analyzed usng the DART-PCR software (Person et al., 2003) Prncples of model development A step-by-step procedure was appled to nclude dfferent metabolc pathways and regulators untl the model ftted the data well and no reasonable mprovement could be obtaned. Due to the absence of at least one complex regulatory system, the PPARα KO mce can be consdered as a relatvely smpler model compared to wldtype mce. Therefore we frst ftted the successve models on data obtaned n PPARα KO mce. In order to allow comparsons between genotypes wthn the same model (or modelng framework), we then extrapolated to wld-type mce 4
7 the values of the parameters that should be common to both genotypes. We consder that the KO mce s just a smpler and easer to study submodel of the wld type model. Ths resulted n a mnmal model of a set of ordnary dfferental equatons descrbng FA metabolsm n the lver(table 1). The man pathways used n our model of FA metabolsm are consstent wth common bochemstry knowledge (Kanehsa et al., 2008; Murray et al., 2006), and nclude (Fg. 1) FA uptake, FA oxdaton n mtochondra and peroxsomes, ketogeness, the trcarboxylc acd cycle (where ATP s produced from acetyl-coa), synthess of malonyl-coa from acetyl-coa, synthess of palmtc acd (C16:0) from malonyl-coa and acetyl-coa, glycolyss to produce acetylcoa from glucose, and elongaton and desaturaton of polyunsaturated FA. Several key regulators of FA metabolsm have been descrbed n the lterature. They nclude PPARα, whch s a transcrpton factor that actvates FA oxdaton (Leone et al., 1999; Desvergne and Wahl, 1999; Lee et al., 1995) and FA elongaton and desaturaton (Wang et al., 2006; Gullou et al., 2002). Other regulators are SREBP1, whch s a transcrpton factor that actvates FA synthess (Horton et al., 2002; Jakobsson et al., 2006) as well as FA elongaton and desaturaton (Matsuzaka et al., 2002) and malonylcoa, whch nhbts FA oxdaton. Because of the expermental condtons and the resultng data n the present study, a decson was made as to whch varables should be ncluded n the model. Metabolc pathways and regulators that were supposed to be nactve or constant durng fastng were not consdered (Fg. 1). Durng the early hours of fastng (3 to 6 h), the level of SREBP1 markedly decreases n the lver (Horton et al., 1998), whch results n a fastng-medated transcrptonal downregulaton of the gene encodng FA synthase (.e., the key enzyme of de novo FA synthess (Shmano et al., 1999; Horton et al., 2002; Km et al., 1998)). Therefore, SREBP1 was assumed to be neglgble n our expermental condtons, and de novo FA synthess was supposed not to occur n our expermental condtons. Hence, the nfluence of SREBP1 on elongaton and desaturaton was not consdered. Moreover, snce malonylcoa s an ntermedate n de novo FA synthess, the malonylcoa-dependent nhbton of mtochondral FA uptake was not consdered. Acetyl-coA s a pvot n ntermedary metabolsm between catabolc and anabolc processes (van Mlgen, 2002). However, because the quantty of acetyl-coa has no drect effect on the FA composton n the lver, there was no need to consder the 3 pathways affectng acetyl-coa (.e., glycolyss, ketogeness and the trcarboxylc acd cycle) Model descrpton Choce of varables In the varous models we consdered, we ncluded all measured metaboltes, except those nvolved n ntermedate metabolsm (.e. molecules partcpatng n a consdered reacton that are nether a product nor a substrate). Therefore, when the elongaton and desaturaton pathway was added, we ncluded the sum of Sω3 = C20:5ω3 + C22:6ω3 andsω6 = C20:3ω6 + C20:4ω6 and not 5
8 the ndvdual quanttes of C20:5ω3 and C20:3ω6, whch were consdered as ntermedates. Indvdual quanttes of other FA were ncluded n the model. The quantty of PPARα was not explctly ncluded as a varable n the model. However, the dfference n numercal values of model parameters between wld-type and PPARα mce represent the effect of PPARα Fluxes Lver uptake. Uptake of FA n the lver from the blood was dffcult to assess n the experments. Durng fastng, free FA are released from AT by lpolyss and serve as energy sources for other organs ncludng the lver. We consdered that the observed varaton n FA composton n AT would reflect the FA uptake by the lver. Input fluxes of ndvdual FA n lver (Φ n )werethusconsderedtobe proportonal to FA released from AT by lpolyss durng fastng. The parameter K In represents the proportonalty factor relatng FA release from AT to FA uptake by the lver. The K In was supposed to be the same for all FA. Durng fastng, FA are released at a tme-constant rate from AT that dffers between FA. To evaluate ths rate, a lnear regresson for each FA n AT (X AT )was performed as X AT = a tme + ntercept.theslope(a ) of ths relaton was then used to estmate FA uptake by the lver: Φ n = K In a. (1) Oxdaton. The reacton flux for total oxdaton (Φ Ox )oftheth FA n the lver (X L ) durng fed-to-fast transton was expressed as a Mchaels-Menten equaton n smplfed form, usng a constant parameter representng the oxdaton rate (k ox ) and a relatve affnty parameter for each FA (b ): X L = k b ox Φ Ox j XL j b j wth b =1. (2) We hypotheszed that the quanttes of FA were not lmtng for the reacton. Ths assumpton was supported by the fact that the sum of FA n the lver ncreased from 0 to 72 h snce the onset of fastng (Table 2). The FA do not always undergo complete oxdaton resultng n acetyl-coa and ATP. Consequently, shorter-chan FA ntermedates may be generated, whch can accumulate n the lver. We consdered ncomplete oxdaton of a FA as the reacton producng a FA that s two carbons shorter than the orgnal FA. Therefore, the total oxdaton flux Φ Ox was separated nto 2 fluxes representng ether complete (Φ CompleteOx ) or ncomplete (Φ IncompleteOx )oxdaton fluxes: = s Φ Ox (3) Φ CompleteOx Φ IncompleteOx =(1 s ) Φ Ox, (4) where s represents the proporton of complete oxdaton of the total oxdaton. In the models consdered (Table 1), we had to choose between three hypotheses : the th FA s only oxdzed completely (s = 1), the th FA s only partally 6
9 oxdzed leadng to the generaton of a two carbons shorter FA (s = 0), or the th FA s both partally and totally oxdzed (s ]0; 1[). These hypotheses wll be tested gong from the smplest (s = 1) to the most complcated hypothess (s ]0; 1[) n a step-by-step procedure (secton 2.3.3). As wll be shown later, the thrd hypothess was not necessary to obtan a correct ft of the model to the data. Elongaton and desaturaton. Unsaturated FA consst of monounsaturated and polyunsaturated FA. Based on the locaton of the last double bound, polyunsaturated FA are classfed as ω3 orω6. Wthn each class, FA can be transformed through elongaton and desaturaton reactons (Fg. 2). The enzyme D6D has been consdered a rate-lmtng enzyme (Cho et al., 1999) of the FA elongaton/desaturaton pathway, whch concde wth the observaton that hepatc quanttes of C18:2ω6 and C18:3ω3 ncreased from 0 to 72 h of fastng (Table 2). Because D6D s common to ω3 andω6 desaturaton pathways, C18:2ω6 and C18:3ω3 are n competton for ths enzyme. Elongaton and desaturaton fluxes (Φ Desat C18:2ω6 and ΦDesat C18:3ω3 ) of C18:2ω6 and C18:3ω3 were ncluded n the rate of elongaton and desaturaton (k desat ), and the relatve affnty of D6D for the th FA (d ) can be gven as: C18 : 3ω3 d C18:3ω3 C18:3ω3 = k desat (5) C18 : 3ω3 d C18:3ω3 + C18 : 2ω6 d C18:2ω6 Φ Desat Φ Desat C18:2ω6 d C18:2ω6 C18:2ω6 = k desat C18:3ω3 d C18:3ω3+C18:2ω6 d C18:2ω6 wth d =1. (6) Choosng the optmal level of detal by a step-by-step procedure A step-by-step procedure was appled untl the model ncluded just enough detal to ft the change n FA quanttes over tme. Step 1: We started wth a model ncludng only one flux (.e., uptake of FA from AT by the lver). Step 2: We estmated model parameters from the expermental data (see the parameter estmaton method below). Step 3: If a parameter set was found allowng a close ft of model predctons to the observed data, the model (and ts parameters) was accepted and the procedure ended (see the fttng crteron below). If not, model output was analyzed, and addtonal pathways and regulators were ncluded. The selecton of pathways and regulatons was based on model behavor and bologcal knowledge. We then went back to step 2. Parameters estmaton. An ntal guess of parameter estmates was found by a lnear approxmaton of the model under the assumpton that j FA XL j b j s constant. Ths sum was evaluated by replacng X L j by the mean of observed value for the jth FA. Parameters were then estmated usng the Nelder 7
10 and Mead optmsaton (Nelder and Mead, 1965) mplemented n R optm procedure, by mnmzng the sum of squared devatons between observed data and predcted values. Goodness of ft. Fttng qualty was estmated usng the coeffcent of varaton of the mean squared predcton error (cvmspe) (Tedesch, 2006; Bbby, 1977). The mean squared predcton error measures the dstance between observed and predcted values, and can be decomposed n central error (CE), regresson error (RE), and dsturbance error (DE). The CE descrbes the contrbuton of dstance between mean values of observed and predcted data. The RE descrbes how the slope of the lnear regresson between predcted and observed data dffers from one. The DE s the remanng error. The cvmspe was used to standardze the results, so that dfferent FA could be compared. Models resultng n a low cvmspe combned wth an mportant contrbuton of DE are preferred and we consdered results acceptable f DE > 25% (an arbtrarly chosen value). 3. Results and dscusson In both mouse genotypes, FA quanttes n the lver were generally greater after a 72 h fastng perod compared wth the fed state (Table 2). For only three FA, there was no dfference n the quantty of FA between 0 and 72 h. Ths concerned C20:4ω6 n wld-type mce and C20:4ω6 and C20:5ω3 npparα KO mce. There are ndcatons n the lterature showng that FA can accumulate n the lver durng fastng n both PPARα KO and wld-type mce usng Sudan Black stanng of lpds (Lee et al., 2004) or Ol Red O stanng of neutral lpds (Hashmoto et al., 2000). The ampltudes of fastng-nduced FA accumulatons observed n the present study are consstent wth a prevous study of wld-type and PPARalpha knockout mce under the fed and starved (72h) condtons (see (Lee et al., 2004)). Ths lkely reflects the major role played by the lver durng fastng to cope wth the metabolsm of FA comng from adpose tssue lpolyss. The quanttes of most FA ncreased more markedely n PPARα KO lvers compared to wld-type controls (Table 2). As shown below, ths lkely results from the mpared hepatc FA beta-oxdaton n PPARα KO mce. Saturated and especally monounsaturated FA were most strongly ncreased than polyunsaturated FA n both genotypes. Only C20:5w3 and C22:6w3 ncreased more strongly n wld-typethannpparα KO lvers durng fastng (Table 2) Model structure Accordng to the step-by-step procedure, three successve models were bult, dfferng n degree of complexty. Model 1 ncluded only FA uptake, whereas model 2 ncluded both FA uptake and FA oxdaton. Model 3 was smlar to model 2 but also ncluded elongaton and desaturaton of FA. The equatons used for these models are gven n Table 1. These models are shown n Fgure 3. 8
11 For each model, the values of the parameters were frst estmated n the smpler PPARα KO mce model. The parameter values were then extrapolated to wld-type mce. When the model wth extrapolated parameter values dd not ft to the data for wld-type mce, then new parameter values were estmated from wld-type data (Table 3) Model 1: accumulaton of FA by the lver Ths model ncluded uptake of FA by the lver proportonal to AT efflux. The proportonalty constant was assumed to be the same for all FA. Ths constant was evaluated n PPARα KO mce and then extrapolated to wld-type mce Durng fastng, FA release from AT dffers between genotypes Fatty acd composton n mouse lver (Table 2) and AT (Table 4) n the fed state was dfferent n PPARα KO mce than n wld-type mce. The FA quanttes (except for C20:5ω3 and C22:6ω3) were generaly greater n the lver and lower (except for C18:2ω6 and C18:3ω3) n AT of KO mce compared wth the wld-type mce. The varaton n FA quanttes n AT durng fastng could be descrbed by lnear functons of tme, as shown by the hgh correlaton coeffcents n Table 4. The regresson slopes (Table 4) were lower n PPARα KO mce than n WT anmals, suggestng that lpolyss from AT was less actve durng fastng n the absence of PPARα. A lesser reducton n epddymal fat pad weghts n KO mce compared wth wld-type has been observed by others (Lee et al., 2004), suggestng that moblzaton of fat depots s delayed durng starvaton n mce that lack PPARα. Ths potental effect of PPARα on adpose tssue lpolyss durng fastng contrasts wth ts low expresson n ths tssue (Bookout et al., 2006). However, t has been shown that despte a low expresson level PPARα regulates glycerol knase (GyK) n whte adpose tssue (Mazzucotell et al., 2007). Interestngly, PPARα KO mce exhbt a hgher basal AT Gyk expresson compared to wld-type mce (Mazzucotell et al., 2007). Snce GyK s nvolved n FA recyclng, ts actvty may contrbute to counteract the effect of lpolyss n PPARα KO AT. On the other hand, PPARα-dependent regulatons n other tssues expressng PPARα could have ndrect effects on AT through nterorgan communcatons. For example, t has been proposed that PPARα may regulate specfc genes n the bran whch could could result n ncreased Glut4 expresson n the AT (Knauf et al., 2006). In ths study, hgh Glut4 expresson was proposed to ncrease glucose clearance n the adpose tssue of PPARα KO mce thus contrbutng to ther hypoglycema durng fastng. Increased glucose nput n adpose tssue of fasted PPARα KO mce may also contrbute to counteract the effects of lpolyss on AT lpd content by stmulatng napproprately FA synthess. 9
12 Durng fastng, FA hepatc nput flux s assumed to be proportonal to the FA release from AT Durng fastng, FA released by lpolyss n AT serve as an energy source for other organs, ncludng the lver. The free FA uptake by the lver has been descrbed by others as a lnear functon of the total free FA concentraton n blood (Berk and Stump, 1999), untl saturaton of the uptake system (Sorrentno and Berk, 1993). In the absence of nformaton n our experments on the free FA flux n blood (.e., FA concencentratons and blood flow), we assumed that hepatc nput flux of FA was proportonal to the FA release from AT durng fastng, usng a same K In proportonalty constant for all FA and both genotypes FA uptake s the major phenomenon nvolved n the varaton of FA n PPARα KO mce, but not n wld-type mce where oxdaton s mportant too The cvmspe estmates (Table 5) showed that the sum of all FA and all ndvdual FA quanttes except C16:1ω7, C16:1ω9, C22:6ω3, and C18:3ω3were correctly ftted n PPARα KO mce. By contrast, n wld-type mce nether the sum nor the ndvdual FA are correctly ftted. Ths result was antcpated for wld-type mce, as durng fastng, lver FA oxdaton s known to be more actve n wld-type mce than n PPARα ones (Le May et al., 2000). Therefore, uptake of FA was the major phenomenon nvolved n the varaton of hepatc FA durng fastng n PPARα KO mce, but not n wld-type mce Hepatc FA nput can be modeled as a smple proportonal functon of FA varaton n AT The good fttng of most FA n PPARα KO mce confrmed that hepatc FA nput can be modeled as a smple proportonal functon of FA varaton n AT. Ths also suggests that FA uptake s the man pathway responsble for varaton n hepatc FA composton n PPARα KO mce durng the fed-to-fastng transton. It also suggests that selectve mportaton of FA was neglgble C16:1ω7 has a specfc two tmes dynamc. The quantty of C16:1ω7 was poorly ftted n PPARα KO mce and was overestmated from 50 to 72 h (Fg. 5).The knetcs of C16:1w7 hepatc accumulaton seems to follow a specfc tme pattern wth accumulaton from 0 to 50 h, to reman constant thereafter. Ths pattern cannot be explaned by mportaton or specfc oxdaton, whch should have occurred at a constant rate durng the fed-to-fastng transton. Recently, t was shown that C16:1ω7can act as an AT-derved sgnal and has, unlke other FA, a systemc metabolc effect (Cao et al., 2008). It s possble that C16:1ω7 has a very specfc metabolc fate and not only targets the lver but also other tssues such as muscle. Ths hypothess remans to be explored further expermentally, and the lack-of-ft for C16:1ω7 was therefore not further addressed n our model. 10
13 The bad fttng of C16:1ω9 and C22:6ω3 n PPARα KO mce s unlkely to be explaned by a specfc FA uptake The poor fttng of the quanttes of C16:1ω9 and C22:6ω3 n the lver of PPARα KO mce can be explaned by specfc hgher rates of uptake or by reactons that produce these FA from other FA. Cellular uptake of FA as well as ntracellular transport of FA s medated through smple dffuson, facltated dffuson, or carrer-medated transport (Berk and Stump, 1999). It has been shown (Okar et al., 2008) that cytosolc acyl-carrer bndng proten (ACBP) has a hgher affnty for C14-C22 FA than for medum chan FA (C8-C12). To our knowledge, selectve regulaton of long-chan FA uptake has not yet been descrbed. When we calculate the selectve uptake for C16:1ω9, and C22:6ω3 requred to ft the data, t appears that these values should have been 2 to 12 tmes greater than the common rate determned for the other FA. Therefore, we assumed that transformatons between FA leadng to the producton of C16:1ω9 and C22:6ω3 would be a more lkely scenaro to explan the accumulaton of these FA n the lver, rather than the selectve uptake The bad fttng of C16:1ω9 npparα KO mce s lkely explaned by ncomplete oxdaton of C18:1ω9 C16:1ω9 can be produced by oxdaton from C18:1ω9 (Fg.2). InPPARα KO mce, the proporton of C16:1ω9 n the lver s very small (1.7% of total lver FA at 72 h of fastng), compared wth that of C18:1ω9 (26% of total hepatc FA at 72 h). Therefore, ncluson of the ncomplete oxdaton of C18:1ω9 nto C16:1ω9 mght ft the latter FA, wthout reducng the qualty of ft for C18:1ω9 (ths reacton wll be ncluded n model 2) The bad fttng of C22:6ω3 npparα KO mce s lkely explaned by elongaton/desaturaton of C18:3ω3 C22:6ω3 was underestmated n PPARα KO mce and can only be produced by elongaton and desaturaton (Fg. 2) from C18:3ω3, whch was overestmated. Therefore, t seems plausble that the absence of the elongaton/desaturaton pathway n model 1 s the cause of the observed lacks-of-ft. These reactons wll be added n model 3 (secton 3.4) Buldng the next model Model 2 wll nclude ncomplete oxdaton of C18:1ω9 to C16:1ω9nPPARα KO mce, and complete oxdaton of all FA n wld-type mce Model 2: accumulaton and (complete or partal) oxdaton of FA by the lver Ths model ncluded both FA uptake (see model 1 n secton 3.2) and FA oxdaton n the lver of both genotypes. 11
14 Both PPARα KO and wld-type mce have an actve oxdaton durng fastng but wth much hgher rates n wld-type mce In PPARα KO mce, only the partal oxdaton of C18:1ω9 was consdered (b C18:1ω9 = 1 whereas b = 0 for the other FA). Ths oxdaton was consdered to be ncomplete, and produced C16:1ω9, whch was modeled as s C18:1ω9 =0. As antcpated, the Dsturbance error (DE) of C16:1ω9 was greater for model 2 (87%, Table 6) than from model 1 (8%, Table 5).Comparatvely, the DE for C18:1ω9 dd not decrease notably (from 44 to 36%, Tables 5 and 6). In wld-type mce, the complete oxdaton of all FA was requred to obtan a better ft of the model, as shown by the ncrease of the DE for most of the FA (Tables 5 and 6). The estmated rate of oxdaton of C18:1ω9 npparα KO mce was only 1% of that estmated n wld-type mce durng a 72 h fastng perod, confrmng that wld-type mce had a much hgher hepatc FA oxdaton compared to PPARα KO mce. Fastng s thought to nduce a rse of hepatc lpds sensed by PPARα that, n turn, stmulates the expresson of oxdatve genes (Kersten et al., 1999). Studes usng PPARα KO mce have provded evdence that the absence of functonal PPARα decreases basal levels of β-oxdaton of C16:0 n PPARα KO mce, but nduces no dfference n the metabolsm of C24:0 compared wth wld-type mce (Aoyama et al., 1998). The hepatc expresson of most oxdatve genes was not nduced by fastng n PPARα KO mce (Leone et al., 1999). Fnally, betahydroxybutyrate (.e., an mportant ketone product of lver FA oxdaton) n PPARα KO mce s 14% of that n wld-type mce fasted for 24 h (Kersten et al., 1999). Consdered together, the ntroducton of a small oxdaton rate for PPARα KO mce durng fastng s not nconsstent wth the lterature results ndcated above. It should be kept n mnd that ths opton wll lkely underestmate the oxdaton rate, because a model wth a hgher FA uptake rate and a hgher oxdaton rate would produce smlar results. Furthermore, t s possble that oxdaton of FA other than C18:1ω9 also occurred n PPARα KO mce durng fastng. However, ths was not consdered because results from model 1 suggested that these oxdaton rates are small. Introducng addtonal oxdaton reactons was not necessary to obtan reasonable model predctons (Table 2). In wld-type mce, the smplest hypothess of complete oxdaton (s = 1) of FA was suffcent to model the FA content n the lver. Therefore, a step-bystep procedure dd not nclude the use of more refned hypotheses by combnng complete and ncomplete oxdaton. The calculated affnty coeffcents for the varous FA regardng oxdaton are gven n Table 3 and the cvmspe values are n Table 6. The accuracy of the model was generally good, except for C20:5ω3 and C22:6ω3, whch have DE proportons smaller than 25%. It s known that FA are oxdzed n peroxsomes or mtochondra at dfferent rates accordng to chan length and degree of unsaturaton (Mahler et al., 1953; Frtz, 1959; Shndo and Hashmoto, 1978; Mannaerts et al., 1979; Hltunen et al., 1986). To our knowledge, the relatve rates of oxdaton of FA are unknown. Even though FA may be oxdzed at dfferent rates, the model ftted the expermental data 12
15 well wthout the need for a tme-dependent regulaton of oxdaton durng the fed-to-fastng transton. Ths suggests that the PPARα-dependent nducton of FA oxdaton durng fastng s ether small compared to ts consttutve effect, or that t saturates relatvely quckly durng fastng. The saturaton hypothess may be tested n a specfc study focusng on the frst 10 to 20 h of fastng by evaluatng the expresson of genes and enzymes nvolved n the oxdaton of FA Buldng the next model Model 2 only ncluded FA uptake and oxdaton n the lver, but many of the short-comngs of model 1 could be resolved by ncludng the oxdaton of FA. As dscussed for model 1, the poor qualty of ft for C22:6ω3 cannot be resolved by oxdaton and the results for ths FA were not better n model 2 than they were n model 1 (Table 6). As ndcated above, C22:6ω3 can only be produced by elongaton and desaturaton (Fg. 2) from C18:3ω3.Thus, to buld model 3 we added the elongaton and desaturaton pathway to model 2. In wld-type mce, the oxdaton rate had to be estmated agan to account for the use of C18:3ω3 by both oxdaton and elongaton and desaturaton Model 3: accumulaton, oxdaton, and desaturaton and elongaton of FA by the lver Essental FA metabolsm nvolves the desaturaton and elongaton to synthesze very long-chan polyunsaturated FA from C18:3ω3 and C18:2ω6. Because delta-6 desaturase (D6D) s common to ω3 andω6 desaturaton pathways, C18:2ω6 and C18:3ω3 are n competton for ths rate-lmtng enzyme (Fg. 2) Elongaton and desaturaton process s actve durng fastng n both genotypes For both genotypes model 3 (FA uptake, oxdaton and elongaton/desaturaton) ftted the observed accumulaton of C22:6ω3 better (Table 7) than model 2 (Table 6). Ths suggests that elongaton and desaturaton of C18:3ω3 to C22:6ω3 are actve n both genotypes durng fastng. The need to nclude an actve elongaton and desaturaton pathway n the lver of mce under fastng condtons n PPARα KO mce s surprsng. The rate of desaturaton and elongaton s generally consdered to be lmted by D6D (Cho et al., 1999), whch s transcrptonally-actvated by SREBP1 (Matsuzaka et al., 2002). The nuclear form of SREBP-1 n the lver of mce has a very low, barely detectable level after 6 h of fastng (Horton et al., 1998). A second transcrptonal actvator of D6D s PPARα (Matsuzaka et al., 2002). Consderng that PPARα was nvaldated n PPARα KO mce, and that SREBP- 1 s nhbted by fastng (Horton et al., 1998), transcrpton and actvty of D6D should have rapdly decreased durng the frst hours of fastng n PPARα KO lvers. 13
16 Expermental valdaton: mrna expresson of D6D s stable durng the frst 24h of fastng To support at least n part the results of our model, mrna levels of D6D were montored by real-tme quanttatve PCR n the lver of mce after 0, 24, 48, and 72 h of fastng. As shown n Fg. 4, D6D mrna levels remaned constant durng the frst 24 h of fastng n the two genotypes. D6D mrna levels sgnfcantly decreased at 72h and 48h n wld-type and PPARα KO lvers respectvely. Therefore, D6D expresson seems to be regulated n a tme-dependent manner durng fastng and ts regulaton partally depends on PPARα expresson only after 24h. Ths result s consstent wth the need to ncorporate the desaturaton/elongaton pathway n our model for both genotypes to correctly ft the FA data. Addtonally, these data suggest that the mechansms by whch D6D mrna expresson s regulated durng fastng nvolve other molecular players than the known major regulators PPARα and SREBP1. These unknown regulators reman to be dentfed but could respond to several hormonal or metabolc sgnals that are modulated durng fastng, possbly dfferentally between wld-type and PPARα KO mce. Several hormones have been shown to reduce D6D expresson or actvty n the lver (for a revew see (Brenner, 2003)) ncludng glucagon and glucocortcods whch are ncreased durng fastng. However, to our knowledge, the accurate knetcs of these hormonal changes have not yet been descrbed n wld-type and PPARα knockout mce. Hence, t s dffcult to predct whether such hormonal sgnal may dfferentally nfluence D6D expresson between these two genotypes. On the other hand, several metabolc parameters dffer between fasted wld-type and PPARα KO mce. For nstance, the latter exhbt hypoglycema and reduced metabolc rates durng fastng (Kersten et al., 1999) n addton to mpared FA oxdaton (Le May et al., 2000). In the lver, glucose and FA (Gullou et al., 2008) may nfluence the transcrpton of enzymes nvolved n FA metabolsm. Changes n glucose, FA or other metaboltes that may nfluence the dfferental expresson of D6D reported here remans to be nvestgated. 4. Concluson A smple model ncludng fatty acds uptake, oxdaton and elongaton/desaturaton was able to predct correctly the varaton of most fatty acds n the lver of both PPARα KO and wld-type mce. Ths model ncluded parameter estmates n adpose tssue and lver to explan the change n fatty acd content n the lver durng fastng. Expermental measurements n dfferent organs obtaned n the same anmals and under the same expermental condtons are strongly needed n the future to predct the dynamcs of fatty acds n a gven organ. The presence of a basal oxdaton n both PPARα KO and wld-type mce wth a rate that depended on the genotype but not on the tme of fastng shows that PPARα has a consttutonal effect on oxdaton but lttle or no tme-dependent effects. The presence of an actve elongaton and desaturaton n both genotypes was surprsng n the lver of fastng mce. It confrms and strengthens earler results 14
17 (Nakamura and Nara, 2003) suggestng that the unsaturated fatty acds content n tssues s mantaned wthn physologcal ranges by feedback regulaton of synthetc pathways. The regulaton of desaturases by PPARα s dfferent from the man role of PPARα n nducng oxdaton (Nakamura and Nara, 2003) and cannot be explaned by the dfferental behavor of varous desaturases such as delta-6- desaturase and stearoyl-coenzyme A desaturase (Radulescu et al., 2006). Our results suggest that mechansms other than PPARα actvaton are lkely to contrbute to the regulaton of delta-6-desaturase actvty durng fastng. In the future, the model could be used to desgn specfc experments amng at a better understandng of lpd metabolsm as regulated by the nutrtonal status. The same set of equatons could be used n other tssues such as muscle, n other anmal speces, to predct nter-speces varablty n lpd metabolsm or n anmals fed dets wth dfferent FA compostons. 15
18 References Aoyama, T., Peters, J., Irtan, N., Nakajma, T., Furhata, K., Hashmoto, T., Gonzalez, F., Altered Consttutve Expresson of Fatty Acd-metabolzng Enzymes n Mce Lackng the Peroxsome Prolferator-actvated Receptor α (PPARα). Journal of Bologcal Chemstry 273 (10), Berk, P., Stump, D., Mechansms of cellular uptake of long chan free fatty acds. Molecular and Cellular Bochemstry 192 (1), Bbby, J., Predctons and mproved estmaton n lnear models. J. Wley & Sons, Chchester. Bookout, A., Jeong, Y., Downes, M., Yu, R., Evans, R., Mangelsdorf, D., Anatomcal proflng of nuclear receptor expresson reveals a herarchcal transcrptonal network. Cell 126 (4), Brenner, R., Hormonal modulaton of delta6 and delta5 desaturases: case of dabetes. Prostaglandns Leukot Essent Fatty Acds 68 (2), Calvett, D., Kuceyesk, A., Somersalo, E., A mathematcal model of lver metabolsm: from steady state to dynamc. In: Journal of Physcs: Conference Seres. Vol. 124 (1). Insttute of Physcs Publshng, p Campbell, P., Carlson, M., Hll, J., Nurjhan, N., Regulaton of free fatty acd metabolsm by nsuln n humans: role of lpolyss and reesterfcaton. Amercan Journal of Physology- Endocrnology And Metabolsm 263 (6), Cao, H., Gerhold, K., Mayers, J., West, M., Watkns, S., Hotamslgl, G., Identfcaton of a Lpokne, a Lpd Hormone Lnkng Adpose Tssue to Systemc Metabolsm. Cell 134 (6), Chalhoub, E., Hanson, R., Belovch, J., 2007a. A Computer Model of Gluconeogeness and Lpd Metabolsm n the Perfused Lver. Amercan Journal of Physology- Endocrnology And Metabolsm, Chalhoub, E., Xe, L., Balasubramanan, V., Km, J., Belovch, J., 2007b. A Dstrbuted Model of Carbohydrate Transport and Metabolsm n the Lver durng Rest and Hgh-Intensty Exercse. Annals of Bomedcal Engneerng 35 (3), Cho, H., Nakamura, M., Clarke, S., Clonng, expresson, and nutrtonal regulaton of the mammalan Δ-6 desaturase. Journal of Bologcal Chemstry 274 (1), Costet, P., Legendre, C., More, J., Edgar, A., Galter, P., Pneau, T., Peroxsome Prolferator-actvated Receptor α-isoform Defcency Leads to Progressve Dyslpdema wth Sexually Dmorphc Obesty and Steatoss. Journal of Bologcal Chemstry 273 (45), Desvergne, B., Wahl, W., Peroxsome Prolferator-Actvated Receptors: Nuclear Control of Metabolsm 1. Endocrne Revews 20 (5), Duplus, E., Gloran, M., Forest, C., Fatty Acd Regulaton of Gene Transcrpton. Journal of Bologcal Chemstry 275 (40), Fattal, D., Ben-Shaul, A., A molecular model for lpd-proten nteracton n membranes: the role of hydrophobc msmatch. Bophyscal Journal 65 (5), Forns, X., Ampurdanes, S., Llovet, J., Aponte, J., Qunto, L., Martnez-Bauer, E., Bruguera, M., Sanchez-Tapas, J., Rodes, J., Identfcaton of chronc hepatts C patents wthout hepatc fbross by a smple predctve model. Hepatology 36 (4),
19 Frtz, I., Acton of carntne on long chan fatty acd oxdaton by lver. Amercan Journal of Physology 197 (2), Gullou, H., Martn, P., Jan, S., D Andrea, S., Roulet, A., Cathelne, D., Roux, V., Pneau, T., Legrand, P., Comparatve effect of fenofbrate on hepatc desaturases n wld-type and peroxsome prolferator-actvated receptor alpha-defcent mce. Lpds 37 (10), Gullou, H., Martn, P., Pneau, T., Transcrptonal regulaton of hepatc fatty acd metabolsm. Subcell Bochem. 49, Hashmoto, T., Cook, W., Q, C., Yeldand, A., Reddy, J., Rao, M., Defect n peroxsome prolferator-actvated receptor α-nducble fatty acd oxdaton determnes the severty of hepatc steatoss n response to fastng. Journal of Bologcal Chemstry 275 (37), Hltunen, J., Kark, T., Hassnen, I., Osmundsen, H., Beta Oxdaton of Polyunsaturated Fatty Acds by Rat Lver Peroxsomes A role for 2,4-denoyl-coenzyme A redyctase n peroxsomal beta-oxdaton. Journal of Bologcal Chemstry 261 (35), Horton, J., Bashmakov, Y., Shmomura, I., Shmano, H., Regulaton of sterol regulatory element bndng protens n lvers of fasted and refed mce. Proceedngs of the Natonal Academy of Scences 95 (11), Horton, J., Goldsten, J., Brown, M., SREBPs: actvators of the complete program of cholesterol and fatty acd synthess n the lver. Journal of Clncal Investgaton 109 (9), Jakobsson, A., Westerberg, R., Jacobsson, A., Fatty acd elongases n mammals: Ther regulaton and roles n metabolsm. Progress n Lpd Research 45 (3), Kanehsa, M., Arak, M., Goto, S., Hattor, M., Hrakawa, M., Itoh, M., Katayama, T., Kawashma, S., Okuda, S., Tokmatsu, T., Yamansh, Y., KEGG for lnkng genomes to lfe and the envronment. Nuclec Acds Res. 36, D480-D484. Kersten, S., Seydoux, J., Peters, J., Gonzalez, F., Desvergne, B., Wahl, W., Peroxsome prolferator actvated receptor α medates the adaptve response to fastng. Journal of Clncal Investgaton 103 (11), Km, J., Sarraf, P., Wrght, M., Yao, K., Mueller, E., Solanes, G., Lowell, B., Spegelman, B., Nutrtonal and nsuln regulaton of fatty acd synthetase and leptn gene expresson through ADD1/SREBP1. Journal of Clncal Investgaton 101 (1), 1. Knauf, C., Reusset, J., Foretz, M., Can, P., Uldry, M., Hosokawa, M., Martnez, E., Brngart, M., Waget, A., Kersten, S., Desvergne, B., Gremlch, S., Wahl, W., Seydoux, J., Delzenne, N., Thorens, B., Burceln, R., Peroxsome prolferator-actvated receptor-alpha-null mce have ncreased whte adpose tssue glucose utlzaton, glut4, and fat mass: Role n lver and bran. Endocrnology 147 (9), Le May, C., Pneau, T., Bgot, K., Kohl, C., Grard, J., Pégorer, J., Reduced hepatc fatty acd oxdaton n fastng pparalpha null mce s due to mpared mtochondral hydroxymethylglutaryl-coa synthase gene expresson. FEBS Lett. 475 (3), Lee, S., Chan, W., Lo, C., Wan, D., Tsang, D., Cheung, W., Requrement of PPARalpha n mantanng phospholpd and trglycerde homeostass durng energy deprvaton. The Journal of Lpd Research, M Lee, S., Pneau, T., Drago, J., Lee, E., Owens, J., Kroetz, D., Fernandez-Salguero, P., Westphal, H., Gonzalez, F., Targeted dsrupton of the alpha soform of the peroxsome prolferator-actvated receptor gene n mce results n abolshment of the pleotropc effects of peroxsome prolferators. Molecular and Cellular Bology 15 (6),
20 Leone, T., Wenhemer, C., Kelly, D., A crtcal role for the peroxsome prolferatoractvated receptor α (PPARα) n the cellular fastng response: The PPARα-null mouse as a model of fatty acd oxdaton dsorders. Proceedngs of the Natonal Academy of Scences 96 (13), Mahler, H., Wakl, S., Bock, R., Studes on fatty acd oxdaton I. Enzymtc actvaton of fatty acds. Journal of Bologcal Chemstry 204 (1), Mannaerts, G., Debeer, L., Thomas, J., De Schepper, P., Mtochondral and peroxsomal fatty acd oxdaton n lver homogenates and solated hepatocytes from control and clofbrate-treated rats. Journal of Bologcal Chemstry 254 (11), Martn, P., Gullou, H., Lasserre, F., Dï 1 jean, S., Lan, A., Pascuss, J., Sancrstobal, M., 2 Legrand, P., Besse, P., Pneau, T., Novel aspects of PPARalpha-medated regulaton of lpd and xenobotc metabolsm revealed through a nutrgenomc study. Hepatology 45 (3), Matsuzaka, T., Shmano, H., Yahag, N., Amemya-Kudo, M., Yoshkawa, T., Hasty, A., Tamura, Y., Osuga, J., Okazak, H., Izuka, Y., et al., Dual regulaton of mouse Δ5-and Δ6-desaturase gene expresson by SREBP-1 and PPARα. The Journal of Lpd Research 43 (1), Mazzucotell, A., Vguere, N., Traby, C., Anncotte, J., Maral, A., Klmcakova, E., Lepn, E., Delmar, P., Dejean, S., Taverner, G., Lefort, C., Hdalgo, J., Pneau, T., Fajas, L., Clément, K., Langn, D., The transcrptonal coactvator peroxsome prolferator actvated receptor (ppar)gamma coactvator-1 alpha and the nuclear receptor ppar alpha control the expresson of glycerol knase and metabolsm genes ndependently of ppar gamma actvaton n human whte adpocytes. Dabetes 56 (10), Murur, K., Levelle, G., In vtro fatty acd synthess and enzyme actvty n lver and adpose tssue of the mouse. Internatonal Journal of Bochemstry 1, Murray, R., Granner, D., Rodwell, V., Harper s Illustrated Bochemstry, 27th Edton. The McGraw-Hll Companes. Nakamura, M., Nara, T., Essental fatty acd synthess and ts regulaton n mammals. Prostaglandns, Leukotrenes & Essental Fatty Acds 68 (2), Nelder, J., Mead, R., A Smplex Method for Functon Mnmzaton. The Computer Journal 7 (4), 308. Okar, S., Ahtalansaar, T., Huotar, A., Kehne, K., Folsch, U., Wolffram, S., Janne, J., Alhonen, L., Herzg, K., Effect of medum and long chan fatty acd det on PPARs and SREBP-1 expresson and glucose homeostass n ACBP overexpressng transgenc rats. Acta Physologca. Person, S., Butler, J., Foster, R., Expermental valdaton of novel and conventonal approaches to quanttatve real-tme PCR data analyss. Nuclec Acds Research 31 (14), e73. Radulescu, O., Lagarrgue, S., Segel, A., Veber, P., Le Borgne, M., Topology and statc response of nteracton networks n molecular bology. Journal of the Royal Socety Interface 3 (6), Remesy, C., Demgne, C., Changes n avalablty of glucogenc and ketogenc substrates and lver metabolsm n fed or starved rats. Ann Nutr Metab 27 (1), Sedeln, K., Fatty acd composton of adpose tssue n humans. Implcatons for the detary fat-serum cholesterol-chd ssue. Progress n Lpd Research 34 (3),
Physical Model for the Evolution of the Genetic Code
Physcal Model for the Evoluton of the Genetc Code Tatsuro Yamashta Osamu Narkyo Department of Physcs, Kyushu Unversty, Fukuoka 8-856, Japan Abstract We propose a physcal model to descrbe the mechansms
More informationThe Influence of the Isomerization Reactions on the Soybean Oil Hydrogenation Process
Unversty of Belgrade From the SelectedWorks of Zeljko D Cupc 2000 The Influence of the Isomerzaton Reactons on the Soybean Ol Hydrogenaton Process Zeljko D Cupc, Insttute of Chemstry, Technology and Metallurgy
More informationMetabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-coa effects
Metabolc control of mtochondral propertes by adenne nucleotde translocator determnes palmtoyl-coa effects Implcatons for a mechansm lnkng obesty and type 2 dabetes Jolta Capate 1,5, Stephan J. L. Bakker
More informationAppendix for. Institutions and Behavior: Experimental Evidence on the Effects of Democracy
Appendx for Insttutons and Behavor: Expermental Evdence on the Effects of Democrac 1. Instructons 1.1 Orgnal sessons Welcome You are about to partcpate n a stud on decson-makng, and ou wll be pad for our
More informationTIME RESPONSE OF JEJUNAL SUCRASE AND MALTASE ACTIVITY TO A HIGH SUCROSE DIET IN NORMAL MAN
GASTROEKTEROLOGY Copyrght 1969 by The Wllams & Wlkns Co. Vol. 56, No.3 Prnted n U.S.A. TIME RESPONSE OF JEJUNAL SUCRASE AND MALTASE ACTIVITY TO A HIGH SUCROSE DIET IN NORMAL MAN NORTON S. RoSENSWEIG, M.D.,
More informationPrediction of Total Pressure Drop in Stenotic Coronary Arteries with Their Geometric Parameters
Tenth Internatonal Conference on Computatonal Flud Dynamcs (ICCFD10), Barcelona, Span, July 9-13, 2018 ICCFD10-227 Predcton of Total Pressure Drop n Stenotc Coronary Arteres wth Ther Geometrc Parameters
More information(From the Gastroenterology Division, Cornell University Medical College, New York 10021)
ROLE OF HEPATIC ANION-BINDING PROTEIN IN BROMSULPHTHALEIN CONJUGATION* BY N. KAPLOWITZ, I. W. PERC -ROBB,~ ANn N. B. JAVITT (From the Gastroenterology Dvson, Cornell Unversty Medcal College, New York 10021)
More informationParameter Estimates of a Random Regression Test Day Model for First Three Lactation Somatic Cell Scores
Parameter Estmates of a Random Regresson Test Day Model for Frst Three actaton Somatc Cell Scores Z. u, F. Renhardt and R. Reents Unted Datasystems for Anmal Producton (VIT), Hedeweg 1, D-27280 Verden,
More informationInvestigation of zinc oxide thin film by spectroscopic ellipsometry
VNU Journal of Scence, Mathematcs - Physcs 24 (2008) 16-23 Investgaton of znc oxde thn flm by spectroscopc ellpsometry Nguyen Nang Dnh 1, Tran Quang Trung 2, Le Khac Bnh 2, Nguyen Dang Khoa 2, Vo Th Ma
More informationProject title: Mathematical Models of Fish Populations in Marine Reserves
Applcaton for Fundng (Malaspna Research Fund) Date: November 0, 2005 Project ttle: Mathematcal Models of Fsh Populatons n Marne Reserves Dr. Lev V. Idels Unversty College Professor Mathematcs Department
More informationUsing the Perpendicular Distance to the Nearest Fracture as a Proxy for Conventional Fracture Spacing Measures
Usng the Perpendcular Dstance to the Nearest Fracture as a Proxy for Conventonal Fracture Spacng Measures Erc B. Nven and Clayton V. Deutsch Dscrete fracture network smulaton ams to reproduce dstrbutons
More informationEffects of Estrogen Contamination on Human Cells: Modeling and Prediction Based on Michaelis-Menten Kinetics 1
J. Water Resource and Protecton, 009,, 6- do:0.6/warp.009.500 Publshed Onlne ovember 009 (http://www.scrp.org/ournal/warp) Effects of Estrogen Contamnaton on Human Cells: Modelng and Predcton Based on
More informationRENAL FUNCTION AND ACE INHIBITORS IN RENAL ARTERY STENOSISA/adbon et al. 651
Downloaded from http://ahajournals.org by on January, 209 RENAL FUNCTION AND INHIBITORS IN RENAL ARTERY STENOSISA/adbon et al. 65 Downloaded from http://ahajournals.org by on January, 209 Patents and Methods
More informationTracing the molecular basis of transcriptional dynamics in noisy data by using an experiment-based mathematical model
Publshed onlne 3 December 204 Nuclec Acds Research, 205, Vol. 43, No. 53 6 do: 0.093/nar/gku272 Tracng the molecular bass of transcrptonal dynamcs n nosy data by usng an experment-based mathematcal model
More informationModeling Multi Layer Feed-forward Neural. Network Model on the Influence of Hypertension. and Diabetes Mellitus on Family History of
Appled Mathematcal Scences, Vol. 7, 2013, no. 41, 2047-2053 HIKARI Ltd, www.m-hkar.com Modelng Mult Layer Feed-forward Neural Network Model on the Influence of Hypertenson and Dabetes Melltus on Famly
More informationPrice linkages in value chains: methodology
Prce lnkages n value chans: methodology Prof. Trond Bjorndal, CEMARE. Unversty of Portsmouth, UK. and Prof. José Fernández-Polanco Unversty of Cantabra, Span. FAO INFOSAMAK Tangers, Morocco 14 March 2012
More informationJoint Modelling Approaches in diabetes research. Francisco Gude Clinical Epidemiology Unit, Hospital Clínico Universitario de Santiago
Jont Modellng Approaches n dabetes research Clncal Epdemology Unt, Hosptal Clínco Unverstaro de Santago Outlne 1 Dabetes 2 Our research 3 Some applcatons Dabetes melltus Is a serous lfe-long health condton
More informationComp. Biochem. PhysioL Vol. 83B, No. 1, pp , /86 $ LIPOLYSIS POST MORTEM IN NORTH ATLANTIC KRILL
Comp. Bochem. PhysoL Vol. 83B, No. 1, pp. 51-55, 1986 35-491/86 $3.+. Prnted n Great Brtan 1986 Pergamon Press Ltd LIPOLYSIS POST MORTEM IN NORTH ATLANTIC KRILL OLAV SAETHER, 1 TROND E. ELLINGSEN 2 and
More informationOptimal Planning of Charging Station for Phased Electric Vehicle *
Energy and Power Engneerng, 2013, 5, 1393-1397 do:10.4236/epe.2013.54b264 Publshed Onlne July 2013 (http://www.scrp.org/ournal/epe) Optmal Plannng of Chargng Staton for Phased Electrc Vehcle * Yang Gao,
More informationBiology 30 Take Home Quiz
Bology 30 Take Home Quz 1) Glucose levels n the blood are rased by the hormone and lowered by the hormone. a) nsuln glucagon b) glucagon nsuln c) nsuln calctonn d) calctonn nsuln 2) A fat soluble hormone
More informationEVALUATION OF BULK MODULUS AND RING DIAMETER OF SOME TELLURITE GLASS SYSTEMS
Chalcogende Letters Vol. 12, No. 2, February 2015, p. 67-74 EVALUATION OF BULK MODULUS AND RING DIAMETER OF SOME TELLURITE GLASS SYSTEMS R. EL-MALLAWANY a*, M.S. GAAFAR b, N. VEERAIAH c a Physcs Dept.,
More informationRichard Williams Notre Dame Sociology Meetings of the European Survey Research Association Ljubljana,
Rchard Wllams Notre Dame Socology rwllam@nd.edu http://www.nd.edu/~rwllam Meetngs of the European Survey Research Assocaton Ljubljana, Slovena July 19, 2013 Comparng Logt and Probt Coeffcents across groups
More informationPotential role of the CD38/cADPR signaling pathway as an underlying mechanism of the effects of medetomidine on insulin and glucose homeostasis
Veternary Anaesthesa and Analgesa, 2013, 40, 512 516 do:10.1111/vaa.12039 SHORT COMMUNICATION Potental role of the CD38/cADPR sgnalng pathway as an underlyng mechansm of the effects of medetomdne on nsuln
More informationA Mathematical Model of the Cerebellar-Olivary System II: Motor Adaptation Through Systematic Disruption of Climbing Fiber Equilibrium
Journal of Computatonal Neuroscence 5, 71 90 (1998) c 1998 Kluwer Academc Publshers. Manufactured n The Netherlands. A Mathematcal Model of the Cerebellar-Olvary System II: Motor Adaptaton Through Systematc
More informationInternational Journal of Emerging Technologies in Computational and Applied Sciences (IJETCAS)
Internatonal Assocaton of Scentfc Innovaton and Research (IASIR (An Assocaton Unfyng the Scences, Engneerng, and Appled Research Internatonal Journal of Emergng Technologes n Computatonal and Appled Scences
More informationEstimation for Pavement Performance Curve based on Kyoto Model : A Case Study for Highway in the State of Sao Paulo
Estmaton for Pavement Performance Curve based on Kyoto Model : A Case Study for Kazuya AOKI, PASCO CORPORATION, Yokohama, JAPAN, Emal : kakzo603@pasco.co.jp Octávo de Souza Campos, Publc Servces Regulatory
More informationCopy Number Variation Methods and Data
Copy Number Varaton Methods and Data Copy number varaton (CNV) Reference Sequence ACCTGCAATGAT TAAGCCCGGG TTGCAACGTTAGGCA Populaton ACCTGCAATGAT TAAGCCCGGG TTGCAACGTTAGGCA ACCTGCAATGAT TTGCAACGTTAGGCA
More informationModeling the Survival of Retrospective Clinical Data from Prostate Cancer Patients in Komfo Anokye Teaching Hospital, Ghana
Internatonal Journal of Appled Scence and Technology Vol. 5, No. 6; December 2015 Modelng the Survval of Retrospectve Clncal Data from Prostate Cancer Patents n Komfo Anokye Teachng Hosptal, Ghana Asedu-Addo,
More informationBIS (Winter 2007) Midterm #2 (February 27) Instructor: Abel Student ID # ANSWER KEY
Instructor: Abel Student ID # ANSWER KEY Undergraduate Student Completng Incomplete Open Enrollment Student Graduate Student Pls., check approprate box below. Ths exam conssts of 6 questons. A maxmum of
More informationrespiration metabolic pathways redox reactions mitochondria chapter 13-14
metabolc pathways respraton chapter 3-4 metabolsm metabolc pathways usually n specfc locaton convert substrates to end products va ntermedates anabolc catabolc redox reactons mtochondra oxdaton-reducton
More information310 Int'l Conf. Par. and Dist. Proc. Tech. and Appl. PDPTA'16
310 Int'l Conf. Par. and Dst. Proc. Tech. and Appl. PDPTA'16 Akra Sasatan and Hrosh Ish Graduate School of Informaton and Telecommuncaton Engneerng, Toka Unversty, Mnato, Tokyo, Japan Abstract The end-to-end
More informationARTICLE IN PRESS Neuropsychologia xxx (2010) xxx xxx
Neuropsychologa xxx (200) xxx xxx Contents lsts avalable at ScenceDrect Neuropsychologa journal homepage: www.elsever.com/locate/neuropsychologa Storage and bndng of object features n vsual workng memory
More informationGlutamate acting on NMDA receptors stimulates neurite outgrowth from'cerebellar granule cells
Volume 223, number 1, 143-147 FEB 05216 October 1987 Glutamate actng on NMDA receptors stmulates neurte outgrowth from'cerebellar granule cells Ian A. Pearce, Martn A. Cambray-Deakn and Robert D. Burgoyne
More informationFigure S1. 1g tumors (weeks) ikras. Lean Obese. Lean Obese 25 KPC
Fgure S 5 Tme to develop g tumors (weeks) 5 5 Tme to develop g tumors (weeks) 5 5 KRS KPC Fgure S. Effect of obesty on tumor ntaton. Tme to develop tumors of about g n KPC and KRS mce fed low or hgh-fat
More informationHYPEIIGLTCAEMIA AS A MENDELIAN P~ECESSIVE CHAI~ACTEP~ IN MICE.
HYPEGLTCAEMA AS A MENDELAN P~ECESSVE CHA~ACTEP~ N MCE. BY P. J. CAM~CDGE, M.D. (LEND.), 32 Nottngham Place, Ma~'y~ebone, London, W, 1, AND H. A. H. {OWAZD, B.So. (Lol, m.). h'~ the course of an nvestgaton
More informationSurvival Rate of Patients of Ovarian Cancer: Rough Set Approach
Internatonal OEN ACCESS Journal Of Modern Engneerng esearch (IJME) Survval ate of atents of Ovaran Cancer: ough Set Approach Kamn Agrawal 1, ragat Jan 1 Department of Appled Mathematcs, IET, Indore, Inda
More informationImportance of Atrial Compliance in Cardiac Performance
Importance of Atral Complance n Cardac Performance By Hroyuk Suga ABSTRACT Effects of changes n atral complance on cardac performance were analyzed usng a crculatory analog model. The atrum was assumed
More informationA Linear Regression Model to Detect User Emotion for Touch Input Interactive Systems
2015 Internatonal Conference on Affectve Computng and Intellgent Interacton (ACII) A Lnear Regresson Model to Detect User Emoton for Touch Input Interactve Systems Samt Bhattacharya Dept of Computer Scence
More informationEssential Fatty Acid Requirements for Term and Preterm Infants
Lpds n Modern Nutrton, edted by M. Horsberger and U. Bracco. Nestld Nutrton, Vevey/Raven Press, New York 987. Essental Fatty Acd Requrements for Term and Preterm Infants Zv Fredman Department of Pedatrcs,
More informationA-UNIFAC Modeling of Binary and Multicomponent Phase Equilibria of Fatty Esters+Water+Methanol+Glycerol
-UNIFC Modelng of Bnary and Multcomponent Phase Equlbra of Fatty Esters+Water+Methanol+Glycerol N. Garrdo a, O. Ferrera b, R. Lugo c, J.-C. de Hemptnne c, M. E. Macedo a, S.B. Bottn d,* a Department of
More informationEconomic crisis and follow-up of the conditions that define metabolic syndrome in a cohort of Catalonia,
Economc crss and follow-up of the condtons that defne metabolc syndrome n a cohort of Catalona, 2005-2012 Laa Maynou 1,2,3, Joan Gl 4, Gabrel Coll-de-Tuero 5,2, Ton Mora 6, Carme Saurna 1,2, Anton Scras
More informationComputing and Using Reputations for Internet Ratings
Computng and Usng Reputatons for Internet Ratngs Mao Chen Department of Computer Scence Prnceton Unversty Prnceton, J 8 (69)-8-797 maoch@cs.prnceton.edu Jaswnder Pal Sngh Department of Computer Scence
More informationTHIS IS AN OFFICIAL NH DHHS HEALTH ALERT
THIS IS AN OFFICIAL NH DHHS HEALTH ALERT Dstrbuted by the NH Health Alert Network Health.Alert@dhhs.nh.gov August 26, 2016 1430 EDT (2:30 PM EDT) NH-HAN 20160826 Recommendatons for Accurate Dagnoss of
More informationA review of glucose transport in the lens
A revew of glucose transport n the lens John W. Patterson T The transport of glucose nto the lens s revewed aganst a background of data on glucose transport n muscle and the red blood cell. In muscle,
More informationSTAGE-STRUCTURED POPULATION DYNAMICS OF AEDES AEGYPTI
Internatonal Conference Mathematcal and Computatonal Bology 211 Internatonal Journal of Modern Physcs: Conference Seres Vol. 9 (212) 364 372 World Scentfc Publshng Company DOI: 1.1142/S21194512543 STAGE-STRUCTURED
More informationrespiration mitochondria mitochondria metabolic pathways chapter 13-14
respraton chapter 3-4 mtochondra shape hghly varable can fuse or splt structure outer membrane nner membrane crstae ntermembrane space mtochondral matrx free rbosomes respratory enzymes mtochondra reproducton
More informationStudy and Comparison of Various Techniques of Image Edge Detection
Gureet Sngh et al Int. Journal of Engneerng Research Applcatons RESEARCH ARTICLE OPEN ACCESS Study Comparson of Varous Technques of Image Edge Detecton Gureet Sngh*, Er. Harnder sngh** *(Department of
More informationCONSTRUCTION OF STOCHASTIC MODEL FOR TIME TO DENGUE VIRUS TRANSMISSION WITH EXPONENTIAL DISTRIBUTION
Internatonal Journal of Pure and Appled Mathematcal Scences. ISSN 97-988 Volume, Number (7), pp. 3- Research Inda Publcatons http://www.rpublcaton.com ONSTRUTION OF STOHASTI MODEL FOR TIME TO DENGUE VIRUS
More informationReconstruction of gene regulatory network of colon cancer using information theoretic approach
Reconstructon of gene regulatory network of colon cancer usng nformaton theoretc approach Khald Raza #1, Rafat Parveen * # Department of Computer Scence Jama Mlla Islama (Central Unverst, New Delh-11005,
More informationMonte Carlo Analysis of a Subcutaneous Absorption Insulin Glargine Model: Variability in Plasma Insulin Concentrations
2012 2nd Internatonal Conference on Bomedcal Engneerng and Technology IPCBEE vol. 34 (2012) (2012) IACSIT Press, Sngapore Monte Carlo Analyss of a Subcutaneous Absorpton Insuln Glargne Model: Varablty
More informationDiabetologia 9 Springer-Verlag1996
Dabetologa (1996) 39:758-765 Dabetologa 9 Sprnger-Verlag1996 Orgnals Long-term and rapd regulaton of ob mrna levels n adpose tssue from normal (Sprague Dawley rats) and obese (db/db mce, fa/fa rats) rodents
More informationKinetic modelling of phospholipid synthesis in Plasmodium knowlesi unravels crucial steps and relative importance of multiple pathways
Sen et al. BMC Systems Bology 2013, 7:123 RESEARCH ARTICLE Open Access Knetc modellng of phospholpd synthess n Plasmodum knowles unravels crucal steps and relatve mportance of multple pathways Partho Sen
More information[ ] + [3] i 1 1. is the density of the vegetable oil, R is the universal gas constant, T r. is the reduced temperature, and F c
Densty and Vscosty of Vegetable Ols C.M. Rodenbush a, F.H. Hseh b, and D.S. Vswanath a, * Departments of a Chemcal Engneerng and b Bologcal and Agrcultural Engneerng, Unversty of Mssour-Columba, Columba,
More informationEpendymal cells Cilia on one surface Movement of material or fluid over surface of the cell
2004 Bology GA 1: Wrtten examnaton 1 SPECIFIC INFMATION Secton A Multple-choce Ths table ndcates the approxmate percentage of students choosng each dstractor. The correct answer s the shaded alternatve.
More informationChapter 20. Aggregation and calibration. Betina Dimaranan, Thomas Hertel, Robert McDougall
Chapter 20 Aggregaton and calbraton Betna Dmaranan, Thomas Hertel, Robert McDougall In the prevous chapter we dscussed how the fnal verson 3 GTAP data base was assembled. Ths data base s extremely large.
More informationMultiscale modelling of tumour growth induced by circadian rhythm disruption in epithelial tissue 1
Multscale modellng of tumour growth nduced by crcadan rhythm dsrupton n epthelal tssue 1 D. A. Bratsun D. V. Merkurev A. P. Zakharov L. M. Psmen Abstract We propose a multscale chemo-mechancal model of
More informationIMPROVING THE EFFICIENCY OF BIOMARKER IDENTIFICATION USING BIOLOGICAL KNOWLEDGE
IMPROVING THE EFFICIENCY OF BIOMARKER IDENTIFICATION USING BIOLOGICAL KNOWLEDGE JOHN H. PHAN The Wallace H. Coulter Department of Bomedcal Engneerng, Georga Insttute of Technology, 313 Ferst Drve Atlanta,
More informationUsing Past Queries for Resource Selection in Distributed Information Retrieval
Purdue Unversty Purdue e-pubs Department of Computer Scence Techncal Reports Department of Computer Scence 2011 Usng Past Queres for Resource Selecton n Dstrbuted Informaton Retreval Sulleyman Cetntas
More informationrespiration mitochondria mitochondria metabolic pathways chapter DRP1 ER tubule
respraton chapter 3-4 mtochondra shape hghly varable can fuse or splt structure outer membrane nner membrane crstae ntermembrane space mtochondral matrx free rbosomes respratory enzymes endosymbont or
More informationIntegration of sensory information within touch and across modalities
Integraton of sensory nformaton wthn touch and across modaltes Marc O. Ernst, Jean-Perre Brescan, Knut Drewng & Henrch H. Bülthoff Max Planck Insttute for Bologcal Cybernetcs 72076 Tübngen, Germany marc.ernst@tuebngen.mpg.de
More informationEvasion of tumours from the control of the immune system: consequences of brief encounters
Al-Tameem et al. Bology Drect 22, 7:3 RESEARCH Open Access Evason of tumours from the control of the mmune system: consequences of bref encounters Mohannad Al-Tameem, Mark Chaplan * and Alberto d Onofro
More informationN-back Training Task Performance: Analysis and Model
N-back Tranng Task Performance: Analyss and Model J. Isaah Harbson (jharb@umd.edu) Center for Advanced Study of Language and Department of Psychology, Unversty of Maryland 7005 52 nd Avenue, College Park,
More informationBIS (Winter 2007) Midterm #1 (February 1)
Instructor: Abel Student ID # Pls., check approprate box below. Undergraduate Student Completng Incomplete Open Enrollment Student Graduate Student Ths exam conssts of 6 questons. A maxmum of 100 ponts
More informationA MIXTURE OF EXPERTS FOR CATARACT DIAGNOSIS IN HOSPITAL SCREENING DATA
Journal of Theoretcal and Appled Informaton Technology 2005 ongong JATIT & LLS ISSN: 1992-8645 www.jatt.org E-ISSN: 1817-3195 A MIXTURE OF EXPERTS FOR CATARACT DIAGNOSIS IN HOSPITAL SCREENING DATA 1 SUNGMIN
More informationSynthesis of Glycerol Carbonate from Glycerol, a By-Product of Biodiesel Production
INTERNATIONAL JOURNAL OF CHEMICAL REACTOR ENGINEERING Volume 7 009 Artcle A87 Synthess of Glycerol Carbonate from Glycerol, a By-Product of Bodesel Producton Zsanett Herseczk Tamás Varga Gyula Marton Unversty
More informationConcentration of teicoplanin in the serum of adults with end stage chronic renal failure undergoing treatment for infection
Journal of Antmcrobal Chemotherapy (1996) 37, 117-121 Concentraton of tecoplann n the serum of adults wth end stage chronc renal falure undergong treatment for nfecton A. MercateUo'*, K. Jaber*, D. Hfflare-Buys*,
More informationA SIMULATION STUDY OF MECHANISM OF POSTFLIGHT ORTHOSTATIC INTOLERANCE
Proceedngs 3rd Annual Conference IEEE/EMBS Oct.5-8, 001, Istanbul, TURKEY A SIMULATION STUDY OF MECHANISM OF POSTFLIGHT ORTHOSTATIC INTOLERANCE W. Y HAO 1, J. BAI 1, W. Y. ZHANG, X. Y. WU 3 L. F. ZHANG
More informationMathematical model of fish schooling behaviour in a set-net
ICES Journal of Marne Scence, 61: 114e13 (004) do:10.1016/j.cesjms.004.07.009 Mathematcal model of fsh schoolng behavour n a set-net Tsutomu Takag, Yutaka Mortom, Jyun Iwata, Hrosh Nakamne, and Nobuo Sannomya
More informationINITIAL ANALYSIS OF AWS-OBSERVED TEMPERATURE
INITIAL ANALYSIS OF AWS-OBSERVED TEMPERATURE Wang Yng, Lu Xaonng, Ren Zhhua, Natonal Meteorologcal Informaton Center, Bejng, Chna Tel.:+86 684755, E-mal:cdcsjk@cma.gov.cn Abstract From, n Chna meteorologcal
More informationSparse Representation of HCP Grayordinate Data Reveals. Novel Functional Architecture of Cerebral Cortex
1 Sparse Representaton of HCP Grayordnate Data Reveals Novel Functonal Archtecture of Cerebral Cortex X Jang 1, Xang L 1, Jngle Lv 2,1, Tuo Zhang 2,1, Shu Zhang 1, Le Guo 2, Tanmng Lu 1* 1 Cortcal Archtecture
More informationAn Approach to Discover Dependencies between Service Operations*
36 JOURNAL OF SOFTWARE VOL. 3 NO. 9 DECEMBER 2008 An Approach to Dscover Dependences between Servce Operatons* Shuyng Yan Research Center for Grd and Servce Computng Insttute of Computng Technology Chnese
More informationTHE NATURAL HISTORY AND THE EFFECT OF PIVMECILLINAM IN LOWER URINARY TRACT INFECTION.
MET9401 SE 10May 2000 Page 13 of 154 2 SYNOPSS MET9401 SE THE NATURAL HSTORY AND THE EFFECT OF PVMECLLNAM N LOWER URNARY TRACT NFECTON. L A study of the natural hstory and the treatment effect wth pvmecllnam
More informationLymphoma Cancer Classification Using Genetic Programming with SNR Features
Lymphoma Cancer Classfcaton Usng Genetc Programmng wth SNR Features Jn-Hyuk Hong and Sung-Bae Cho Dept. of Computer Scence, Yonse Unversty, 134 Shnchon-dong, Sudaemoon-ku, Seoul 120-749, Korea hjnh@candy.yonse.ac.kr,
More informationEffects of Micro-Electrical Stimulation on Regulation of Behavior of Electro-Active Stem Cells
Orgnal Artcle J. of Bosystems Eng. 38():113-10. (013. 6) http://dx.do.org/10.5307/jbe.013.38..113 Journal of Bosystems Engneerng eissn : 34-186 pissn : 1738-166 Effects of Mcro-Electrcal Stmulaton on Regulaton
More informationDS May 31,2012 Commissioner, Development. Services Department SPA June 7,2012
. h,oshawa o Report To: From: Subject: Development Servces Commttee Item: Date of Report: DS-12-189 May 31,2012 Commssoner, Development Fle: Date of Meetng: Servces Department SPA-2010-09 June 7,2012 Applcaton
More informationMuscle Activating Force Detection Using Surface Electromyography
Muscle force, F v (v m ) (Fracton of maxmum sometrc force) Muscle force, F l (l m ) (Fracton of maxmum sometrc force) Muscle Actvatng Force Detecton Usng Surface Electromyography Saran KEERATIHATTAYAKORN
More information. 1B ii. Downloaded from ijem.sbmu.ac.ir at 15: on Sunday November 11th
( ) 3 1 ( (1 : (3 e-mal: r.alzadeh@lam.ac.r : :. ( ) / ± / ( ) / ± /. ( ) / ± /... / :. P< / (P= / ) (P= / ) (P= / ) :. (P= / ). : 97/3/0 : 97/3/7 : 97/1/0 : 4... 1B. 1. 3. - Peroxsome Prolferator-Actvated
More informationALMALAUREA WORKING PAPERS no. 9
Snce 1994 Inter-Unversty Consortum Connectng Unverstes, the Labour Market and Professonals AlmaLaurea Workng Papers ISSN 2239-9453 ALMALAUREA WORKING PAPERS no. 9 September 211 Propensty Score Methods
More informationRainbow trout survival and capture probabilities in the upper Rangitikei River, New Zealand
Ranbow trout survval and capture probabltes n the upper Rangtke Rver, New Zealand Rchard J Barker Department of Mathematcs and Statstcs Unversty of Otago P.O. Box 56 Dunedn, New Zealand Peter H Taylor
More informationA POROUS MEDIA APPROACH TOWARDS A DYNAMIC MECHANISTIC MODEL OF DRUG ELIMINATION BY THE LIVER. A Thesis Submitted to the
A POROUS MEDIA APPROAH TOWARDS A DYNAMI MEHANISTI MODEL OF DRUG ELIMINATION BY THE LIVER A Thess Submtted to the ollege of Graduate Studes and Research n Partal Fulfllment of the Requrements for the Degree
More informationUnobserved Heterogeneity and the Statistical Analysis of Highway Accident Data
Unobserved Heterogenety and the Statstcal Analyss of Hghway Accdent Data Fred L. Mannerng Professor of Cvl and Envronmental Engneerng Courtesy Department of Economcs Unversty of South Florda 4202 E. Fowler
More informationWHO S ASSESSMENT OF HEALTH CARE INDUSTRY PERFORMANCE: RATING THE RANKINGS
WHO S ASSESSMENT OF HEALTH CARE INDUSTRY PERFORMANCE: RATING THE RANKINGS ELLIOTT PARKER and JEANNE WENDEL * Department of Economcs, Unversty of Nevada, Reno, NV, USA SUMMARY Ths paper examnes the econometrc
More informationStatistical Analysis on Infectious Diseases in Dubai, UAE
Internatonal Journal of Preventve Medcne Research Vol. 1, No. 4, 015, pp. 60-66 http://www.ascence.org/journal/jpmr Statstcal Analyss on Infectous Dseases 1995-013 n Duba, UAE Khams F. G. 1, Hussan H.
More informationISOBARIC VAPOR-LIQUID EQUILIBRIUM FOR THE BINARY MIXTURE OF ETHANOL (1) + 1-HEXANOL (2) AT 100 kpa
ISOBARIC VAPOR-LIQUID EQUILIBRIUM FOR THE BINARY MIXTURE OF ETHANOL (1) + 1-HEXANOL (2) AT 100 Pa Dhon Hartanto 1), Asall Mustan 2), Bayu Trwbowo 1), Aula Septan Muta 1) 1) Department of Chemcal Engneerng,
More informationLength of Hospital Stay After Acute Myocardial Infarction in the Myocardial Infarction Triage and Intervention (MITI) Project Registry
JACC Vol. 28, No. 2 287 CLINICAL STUDIES MYOCARDIAL INFARCTION Length of Hosptal Stay After Acute Myocardal Infarcton n the Myocardal Infarcton Trage and Interventon (MITI) Project Regstry NATHAN R. EVERY,
More informationNHS Outcomes Framework
NHS Outcomes Framework Doman 1 Preventng people from dyng prematurely Indcator Specfcatons Verson: 1.21 Date: May 2018 Author: Clncal Indcators Team NHS Outcomes Framework: Doman 1 Preventng people from
More informationWhat Determines Attitude Improvements? Does Religiosity Help?
Internatonal Journal of Busness and Socal Scence Vol. 4 No. 9; August 2013 What Determnes Atttude Improvements? Does Relgosty Help? Madhu S. Mohanty Calforna State Unversty-Los Angeles Los Angeles, 5151
More informationIncorrect Beliefs. Overconfidence. Types of Overconfidence. Outline. Overprecision 4/22/2015. Econ 1820: Behavioral Economics Mark Dean Spring 2015
Incorrect Belefs Overconfdence Econ 1820: Behavoral Economcs Mark Dean Sprng 2015 In objectve EU we assumed that everyone agreed on what the probabltes of dfferent events were In subjectve expected utlty
More informationLateral Transfer Data Report. Principal Investigator: Andrea Baptiste, MA, OT, CIE Co-Investigator: Kay Steadman, MA, OTR, CHSP. Executive Summary:
Samar tmed c ali ndus t r esi nc 55Fl em ngdr ve, Un t#9 Cambr dge, ON. N1T2A9 T el. 18886582206 Ema l. nf o@s amar t r ol l boar d. c om www. s amar t r ol l boar d. c om Lateral Transfer Data Report
More informationHeart Rate Variability Analysis Diagnosing Atrial Fibrillation
X-ray PIV Measurements of Velocty Feld of Blood Flows Volume 5, umber 2: 46-52, October 2007 Internatonal Journal of Vascular Bomedcal Engneerng Heart Rate Varablty Analyss Dagnosng Atral Fbrllaton Jnho
More informationThe Limits of Individual Identification from Sample Allele Frequencies: Theory and Statistical Analysis
The Lmts of Indvdual Identfcaton from Sample Allele Frequences: Theory and Statstcal Analyss Peter M. Vsscher 1 *, Wllam G. Hll 2 1 Queensland Insttute of Medcal Research, Brsbane, Australa, 2 Insttute
More informationDrug Prescription Behavior and Decision Support Systems
Drug Prescrpton Behavor and Decson Support Systems ABSTRACT Adverse drug events plague the outcomes of health care servces. In ths research, we propose a clncal learnng model that ncorporates the use of
More informationMaize Varieties Combination Model of Multi-factor. and Implement
Maze Varetes Combnaton Model of Mult-factor and Implement LIN YANG,XIAODONG ZHANG,SHAOMING LI Department of Geographc Informaton Scence Chna Agrcultural Unversty No. 17 Tsnghua East Road, Bejng 100083
More informationNew Twist on Low Carb vs. Low Fat for Weight Loss BOTH appropriate, but not for everyone
New Twst on Low vs. Low for Weght Loss BOTH approprate, but not for everyone Sponsored by the Unversty of Arzona College of Medcne at the Arzona Health Scences Center Chrstopher Gardner, PhD Stanford Preventon
More informationAiloxan-Induced Alteration of Insulin Release, Rubidium Efflux and Glucose Metabolism in Rat Islets Stimulated by Various Secretagogues
Dabetologa 16, 253-260 (1979) Dabetologa 9 by Sprnger-Verlag 1979 Aloxan-Induced Alteraton of Insuln Release, Rubdum fflux and Glucose Metabolsm n Rat Islets Stmulated by Varous Secretagogues J. C. Henqun,
More informationEXAMINATION OF THE DENSITY OF SEMEN AND ANALYSIS OF SPERM CELL MOVEMENT. 1. INTRODUCTION
JOURNAL OF MEDICAL INFORMATICS & TECHNOLOGIES Vol.3/00, ISSN 64-6037 Łukasz WITKOWSKI * mage enhancement, mage analyss, semen, sperm cell, cell moblty EXAMINATION OF THE DENSITY OF SEMEN AND ANALYSIS OF
More informationEstimation of Relative Survival Based on Cancer Registry Data
Revew of Bonformatcs and Bometrcs (RBB) Volume 2 Issue 4, December 203 www.sepub.org/rbb Estmaton of Relatve Based on Cancer Regstry Data Olaf Schoffer *, Ante Nedostate 2, Stefane J. Klug,2 Cancer Epdemology,
More informationEffect of Tumor Necrosis Factor on Acetyl-Coenzyme A Carboxylase Gene Expression and Preadipocyte Differentiation
Effect of Tumor Necross Factor on AcetylCoenzyme A Carboxylase Gene Expresson and Preadpocyte Dfferentaton Mchael E. Pape and KHan Km Department of Bochemstry Purdue Unversty West Lafayette, Indana 47907
More informationENRICHING PROCESS OF ICE-CREAM RECOMMENDATION USING COMBINATORIAL RANKING OF AHP AND MONTE CARLO AHP
ENRICHING PROCESS OF ICE-CREAM RECOMMENDATION USING COMBINATORIAL RANKING OF AHP AND MONTE CARLO AHP 1 AKASH RAMESHWAR LADDHA, 2 RAHUL RAGHVENDRA JOSHI, 3 Dr.PEETI MULAY 1 M.Tech, Department of Computer
More informationDesign of PSO Based Robust Blood Glucose Control in Diabetic Patients
Control n Dabetc Patents Assst. Prof. Dr. Control and Systems Engneerng Department, Unversty of Technology, Baghdad-Iraq hazem..al@uotechnology.edu.q Receved: /6/3 Accepted: //3 Abstract In ths paper,
More information