Bile salt homeostasis is achieved by the coordinate

Transcription

1 Expression and Localization of Hepatobiliary Transport Proteins in Progressive Familial Intrahepatic Cholestasis Verena Keitel, 1 Martin Burdelski, 2 Ulrich Warskulat, 1 Thomas Kühlkamp, 1 Dietrich Keppler, 3 Dieter Häussinger, 1 and Ralf Kubitz Mutations of the bile salt export pump (BSEP) or the multidrug resistance P-glycoprotein 3 (MDR3) are linked to impaired bile salt homeostasis and lead to progressive familial intrahepatic cholestasis (PFIC)-2 and -3, respectively. The regulation of bile salt transporters in PFIC is not known. Expression of hepatobiliary transporters in livers of ten patients with a PFIC phenotype was studied by quantitative reverse transcription polymerase chain reaction, Western blotting, and immunofluorescence microscopy. PFIC was diagnosed by clinical and laboratory findings. All patients could be assigned to PFIC-2 or PFIC-3 by the use of BSEP- and MDR3-specific antibodies and by MDR3 gene-sequencing. Whereas in all PFIC-2 patients, BSEP immunoreactivity was absent from the canalicular membrane, in three PFIC-3 livers, canalicular MDR3 immunoreactivity was detectable. Serum bile salts were elevated to and to mol/l in PFIC-2 and PFIC-3, respectively. Organic anion transporting polypeptide OATP1B1, OATP1B3, and MRP2 mrna and protein levels were reduced, whereas sodium taurocholate cotransporting polypeptide (NTCP) was only reduced at the protein level, suggesting a posttranscriptional NTCP regulation. Whereas MRP3 mrna and protein were not significantly altered, MRP4 messenger RNA and protein were significantly increased in PFIC. In conclusion, PFIC-2 may be reliably diagnosed by immunofluorescence, whereas the diagnosis of PFIC-3 requires gene-sequencing. Several mechanisms may contribute to elevated plasma bile salts in PFIC: reduced bile salt uptake via NTCP, OATP1B1, and OATP1B3, decreased BSEP-dependent secretion into bile, and increased transport back into plasma by MRP4. Upregulation of MRP4, but not of MRP3, might represent an important escape mechanism for bile salt extrusion in PFIC. Supplementary material for this article can be found on the HEPATOLOGY website ( suppmat/index.html). (HEPATOLOGY 2005;41: ) Abbreviations: OATP, organic anion transporting polypeptide; ABC, adenosine triphosphate binding cassette; NTCP, sodium taurocholate cotransporting polypeptide; BSEP, bile salt export pump; MRP, multidrug resistance associated protein; PFIC, progressive familial intrahepatic cholestasis; BRIC, benign recurrent intrahepatic cholestasis; GT, gamma-glutamyltransferase; MDR, multidrug resistance; HPRT1, hypoxanthine phosphoribosyltransferase 1; mrna, messenger RNA. From the 1 Klinik für Gastroenterologie, Hepatologie und Infektiologie, Heinrich Heine Universität, Düsseldorf, Germany; 2 Pädiatrische Gastroenterologie und Hepatologie, Universitätsklinikum Hamburg-Eppendorf, Germany; and 3 Abteilung Tumorbiochemie, Deutsches Krebsforschungszentrum Heidelberg, Germany. Received November 30, 2004; accepted February 23, Supported by grants of the Sonderforschungsbereich 575 Düsseldorf Experimentelle Hepatologie. Address reprint requests to: R. Kubitz, M.D., Klinik für Gastroenterologie, Hepatologie und Infektiologie, Universität Düsseldorf, Moorenstrasse 5, D Düsseldorf, Germany. kubitz@med.uni-duesseldorf.de; fax: (49) Copyright 2005 by the American Association for the Study of Liver Diseases. Published online in Wiley InterScience ( DOI /hep Potential conflict of interest: Nothing to report. Bile salt homeostasis is achieved by the coordinate action of bile salt transporters. At the sinusoidal membrane the Na -taurocholate cotransporting polypeptide (NTCP, SLC10A1) mediates sodium-dependent bile salt uptake, 1 whereas sodium-independent bile salt uptake is achieved by organic anion transporting polypeptide OATP1B1 (OATP-C/OATP2/SLC21A6) 2,3 and OATP1B3 (OATP8/SLC21A8). 4 At the canalicular membrane, bile salts are actively secreted from hepatocytes by different members of the adenosine triphosphate binding-cassette (ABC) transporter superfamily. Under normal conditions, the bile salt export pump BSEP (ABCB11) mediates the canalicular secretion of taurine- and glycine-conjugated bile salts. 5 Besides the secretion of bile salts by BSEP, the multidrug resistance associated protein 2 (MRP2, cmoat, ABCC2) 6,7 transports bile salts after they have been sulfated or glucuronidated

2 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL Several transporters from the ABCC subfamily are localized at the sinusoidal membrane of hepatocytes, where they mediate efflux of substrates back into blood. 9,10 These ABC-transporters include MRP3 (ABCC3) and MRP4 (ABCC4). 10 MRP3 transports bile salts such as taurocholate, glycocholate, taurochenodeoxycholate-3- sulfate, and taurolithocholate-3-sulfate. 11,13 In Dubin- Johnson patients with defective MRP2, the MRP3 protein is upregulated. 9 Similarly, in rats with Mrp2-deficiency 14 or with obstructive cholestasis, 15 an increased expression of Mrp3 was observed. Mrp3 upregulation was suggested to represent a protective mechanism 16 against toxic effects of certain bile salts. Human MRP4 cotransports monoanionic bile salts together with glutathione, 10 and sulfated bile salts were shown to competitively inhibit transport of estradiol 17-beta-D-glucuronide by MRP4, 17 indicating that more than one possible escape route for bile salts across the sinusoidal membrane may exist. Genetic abnormalities of BSEP are the cause of progressive familial intrahepatic cholestasis type 2 (PFIC- 2). 18 A similar form of cholestasis is observed in patients with mutations of the familial intrahepatic cholestasis (FIC) 1-gene product (ATP8B1), leading to PFIC-1 or the less severe form termed benign recurrent intrahepatic cholestasis 1 (BRIC-1). Both forms of inherited cholestasis, PFIC-1 and -2, are characterized by low gamma-glutamyltransferase ( GT) serum activities. 19 In contrast, mutations of the multidrug resistance P-glycoprotein 3 (MDR3), which acts as a phospholipid flippase, 20 lead to a third form of severe cholestasis during childhood (PFIC-3), characterized by high GT levels. 21 Increased GT levels are attributed to a low phosphatidylcholine concentration in bile, which normally protects the biliary epithelium from bile salt toxicity. 22 Human studies should help to better understand the pathophysiology of human cholestatic conditions as a prerequisite for a more directed treatment. Therefore, this study investigated naturally occurring knock-outs in humans. We were interested in how the impairment of a single transporter affects other transport systems, and we aimed to identify changes in transporter expression that may account for increased bile salt levels observed in PFIC. Materials and Methods Antibodies. A rabbit polyclonal antibody (K168) was raised against a 15 amino acid oligopeptide containing amino acids 688 to 702 from the linker region of human BSEP, which comprise only 3 and 2 identical amino acids of the corresponding sequences of human MDR1 and MDR3, respectively, the two most related proteins. The rabbit anti-human BSEP K165 antibody was raised against the N-terminus and purified as described recently. 23 The anti-human antibodies against MRP2 (EAG5), MRP4 (SNG), OATP1B1 (ESL), and OATP1B3 (SKT) were raised in rabbits. 4,6,10 The rabbit anti-human NTCP antibody (K9) was donated by Drs. B. Stieger and P. Meier (Kantonsspital, Zürich, Switzerland). 24 The mouse monoclonal antibodies M2III6 and M2I4, P3II26, and M3II9 against human MRP2, MDR3, and MRP3, respectively, were from Alexis (Grünberg, Germany). Sampling of Liver Tissues. Small liver pieces from 10 children with inherited cholestatic liver diseases were collected between 1994 and 2003 when children underwent Table 1. Clinical and Laboratory Parameters of PFIC Patients Clinical Parameters Laboratory Parameters Diagnosis Patients Onset of Symptoms Age at LTx BS (<8 M) GT (<25 U/l) Bilirubin (<1 mg/dl) MDR3-Mutation MDR3- IF BSEP- IF PFIC Type C1 F.A. 4m 3y5m None detected 2 C2 A.A. 3m 2y5m None detected 2 C3 S.H. 3m 3y3m None detected 2 C4 M.D. 6m 10y7m None detected 2 C5 T.A. 6m 4y2m A 3 G/T175A Heterozygous 2 C6 M.D. 4m 7y9m G 3 T/S346I 3 C7 S.F. birth 8y7m G 3 T/8346I* 3 C8 K.Y. 6m 3y10m C 3 A/A953D 3 C9 K.B. 4m 3y8m del 3 C10 B.D. 7y 11y4m None detected 3 NOTE. Data of 10 patients with a PFIC phenotype are presented. Abbreviations: LTx, liver transplantation; BS, plasma bile salt concentrations; GT, -glutamyltransferase (normal values in brackets; values were obtained at the time of liver transplantation); IF, immunofluorescence; y, years; m, months. *Patient described in Jacquemin et al. 39 Patient described in De Vree et al. 21

3 1162 KEITEL ET AL. HEPATOLOGY, May 2005 Table 2. Clinical and Laboratory Data and Histology of Control Group II Sample Diagnosis Age Sex GPT (<23 U/L) GT (<18 U/L) Bilirubin (<1.1 mg/dl) Histology ( Fibrosis) 1 AIH 66 M C2 abuse 56 F I 3 HBV 26 F II 4 C2 abuse 61 F I 5 Elevated TA 33 M NASH 63 M II NOTE. Histology revealed no (0), minimal (I ), or mild (II ) fibrosis. Abbreviations: AIH, autoimmune hepatitis; C2, alcohol; HBV, hepatitis B virus infection; TA, transaminases; NASH, nonalcoholic steatohepatitis; ALT, alanine amino transferase; GT, -glutamyltransferase (normal values in brackets). liver transplantation. Laboratory parameters were determined shortly before transplantation. All children were treated with ursodeoxycholic acid at the time of transplantation. Liver samples were kept at 70 C. They were partly cut by cryosectioning and partly homogenized for protein or RNA preparation. One PFIC-2 sample (C4) was not suitable for RNA extraction, and another PFIC-2 sample (C1) was too small for Western blotting. Serological and clinical parameters of the patients are summarized in Table 1. A first control group (control I) was established from organ donors when such livers were not completely used for transplantation. Liver pieces were snap-frozen in liquid nitrogen and stored at 70 C. A second group of controls (control II) was collected from six patients (with normal bilirubin levels) who had a liver needle biopsy for diagnostic reasons. The liver diseases of these patients are summarized in Table 2. All patients had given their written consent, and studies on excess material were approved by the local ethics committee. Samples were snap-frozen in liquid nitrogen and were subjected to RNA preparation, when liver histology showed no, minimal, or mild fibrosis. Sequence Analysis of MDR3. Sequencing of MDR3 (Genbank accession NM_000443) was performed at the genomic level by the use of DNA from lymphocytes and specific primers, which enclosed all exons and exon/intron boundaries of MDR3. For primer sequences, please refer to the supplemental data file. Quantitative Reverse Transcription Polymerase Chain Reaction. Total RNA was isolated using the RNA extraction kit (Qiagen, Hilden, Germany), and complementary DNA was obtained with the first strand complementary DNA synthesis kit (Roche, Mannheim, Germany). The levels of gene expression were measured by real-time SYBR Green PCR with the Gene Amp 5700 Sequence Detection System (Applied Biosystems, Foster City, CA) according to the manufacturer s instructions. Primers for transporter and housekeeping genes are summarized in Table 3. For each gene, the number of cycles was determined until fluorescence reached a threshold value within the exponential increase in fluorescence. Data were produced in triplicates for each gene. Mean values of cycle numbers of each transporter gene were subtracted from the mean of cycle numbers of the housekeeping gene (HPRT1) for the respective patient s sample. This value taken to the power of 2 is the mrna expression of a gene in relation to HRPT1 expression, termed relative mrna unit (RRU) of the respective gene. Table 3. RT-PCR Primers Used in This Study Gene Protein Forward Primer Reverse Primer ABCB1 MDR1, P-gp ggcaaagaastaaagcgactgaa gcccaggtgtgctcgg ABCB4 MDR3 ttggtgcatatctcattgtgaatg gaataacatctctgaagcgcatatgt ABCB11 BSEP, SPGP actagatgaagccacttctgcctta tgcaccgtcttttcactttctgt ABCC1 MRP1 ctcctgcagcagagaggtcttt caagccggcgtctttgg ABCC2 MRP2, cmrp, cmoat ggacagtgacaaggtaatggtcc tgccgcactctataatcttccc ABCC3 MRP3 tctgtcctggctggagtcg tccgttgagtggaatcagca ABCC4 MRP4 ccctttaaggagcacacgga tacctcttgtaaggcattccacagt SLC10A1 NTCP catgtttgccatgacaccactc aaaggcatcagggaggaggt SLCO1B1, SLC21A6 OATP1B1, OATP2 tgaaatcacttgcactgggttt ctcctagtgctcgtataaccattgagt SLCO1B3, SLC21A8 OATP1B3, OATP8 ttccctctaatctgcgaaagc aggtcaaggttaggccgg OATP1A2, SLC21A3 OATP1A2, OATP-A cagttcttgggctgtgcga ctggagcatcaaggaacagtc SLCO2B1, SLC21A9 OATP2B1, OATP-B attggacggctttaaccctgt tgtattccacacgagtgctgg HPRT1 HPRT1 gctttccttggtcaggcagt gcttgcgaccttgaccatct NOTE. Nucleotide sequences of the forward and reverse primers, which were used for quantitative RT-PCR measurements.

4 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL Immunofluorescence and Confocal Laser Scanning Microscopy. Immunofluorescence of tissue sections was performed as recently described. 23 The primary antibodies were diluted as follows: EAG5 at 1:150; SNG, M2III6, M2I4, P3II26, K168, and K165 at 1:25; K9 at 1:200; M3II9 at 1:10; ESL and SKT at 1:100. Fluorescein or Cyanin 3 conjugated secondary antibodies (Jackson Immuno Research Laboratories, West Grove, PA) were diluted 1:100 and 1:500, respectively. Immunostained liver-samples were analyzed on a Zeiss LSM 510 META confocal system mounted on an Axioscope 100 M inverted microscope (Zeiss, Oberkochen, Germany). To compare the immunofluorescence intensity of different livers, instrument settings were constant along the complete series of livers. Western Blot Analysis and Densitometry. For Western blot analysis, human liver pieces were homogenized in hypotonic buffer (0.1 mmol/l EDTA, 0.5 mmol/ sodium phosphate, ph 7.0) supplemented with protease inhibitors using a tight-fitting potter (glas/teflon, 10 strokes, 1,000 rpm). After centrifugation ( g, 1 hour, 4 C), pellets were resuspended in hypotonic buffer. These crude membrane fractions were frozen and stored at 20 C. Protein concentrations were measured in triplicates by the Advanced Protein Assay (Cytoskeleton, Denver, CO). Equal amounts of proteins were separated by SDS-PAGE and blotted on nitrocellulose membranes. Proteins were detected by specific antibodies and by the use of the enhanced chemiluminescence detection kit (Amersham-Pharmacia, Freiburg, Germany). Densitometry was performed with a Kodak Image Station 440 CF and the Kodak 1D 3.5 Software. Statistics. Values from reverse transcription polymerase chain reaction and densitometric analysis are given as means standard deviations. The Mann-Whitney U test (Wilcoxon test) was used for statistical analysis, with a P value less than.05 considered statistically significant. Results Diagnosis of Low- and High- GT PFIC. Diagnosis of progressive familial intrahepatic cholestasis was based on clinical and laboratory parameters. Onset of symptoms of cholestasis was observed within the first 6 months of life in nine of ten patients (Table 1). Progression toward liver cirrhosis necessitating liver transplantation was observed at years of age (Table 1). According to serum GT activities, children were grouped into low- and high- GT cholestasis. Six children (C1, C2, C4, C5, C6, and C10) had normal or near normal GT activities, and 4 children (C3, C7, C8, and C9) had elevated GT activities (Table 1). BSEP expression and localization in PFIC livers were investigated using the K165 and K168 antibodies, which were directed against different epitopes of human BSEP. K168 but not its pre-immune serum resulted in a typical canalicular staining pattern. The canalicular immunoreactivity could be blocked by the peptide used for antibody generation, confirming the specificity of K168 (see images from the supplemental data file at the HEPATOLOGY website: Canalicular BSEP expression was considered negative, when both BSEP antibodies did not show any canalicular immunoreactivity despite a canalicular expression pattern of MRP2. In four of six patients with low- GT cholestasis (C1, C2, C4, and C5), no canalicular BSEP immunoreactivity was detected, suggesting impaired BSEP protein synthesis or targeting in line with a PFIC-2 phenotype (Fig. 1). In a fifth patient with high- GT cholestasis (C3), BSEP immunoreactivity was absent despite clear MRP2 staining (Fig. 1). Therefore, this patient was also diagnosed as PFIC-2. In line with this diagnosis, no MDR3 mutation was detected by sequencing, and canalicular immunoreactivity to the MDR3 antibody was present in this patient as in all other PFIC-2 patients (Fig. 2). BSEP mrna expression was (n 4) relative mrna units (in the following termed RRU ; see Materials and Methods) in PFIC-2 livers and RRU (n 5) in PFIC-3 livers (concerning PFIC-3 diagnosis: see later discussion). The mrna values were insignificantly lower or similar to the values of control group I ( RRU, n 3) or control group II ( RRU, n 6), respectively (Table 4). In three of four patients with high- GT cholestasis, MDR3 gene-sequencing showed 3 different homozygous mutations listed in Table 1. A fourth child (C6) carried a disease-causing MDR3 mutation 25 despite normal GT. Interestingly, this child had the same mutation as child C7 with 10-fold increased GT activities (Table 1). Patient C10, who had normal serum GT activities, displayed clear BSEP immunoreactivity (Fig. 1) but no canalicular MDR3 immunoreactivity (Fig. 2). Although no MDR3 mutation was detectable by sequencing in this patient, he was diagnosed as PFIC-3 on the basis of the immunofluorescence pattern. Despite homozygous mutations in the MDR3 gene, canalicular localization of MDR3 could be detected in 3 of these 5 livers (C6, C7, C8; Fig. 2). Two different mutations were found in the three patients with detectable canalicular MDR3 immunoreactivity (S346I and A953D). In all PFIC-3 livers, BSEP immunoreactivity showed a canalicular distribution and colocalized with other canalicular proteins such as MRP2 (Fig. 1).

5 1164 KEITEL ET AL. HEPATOLOGY, May 2005 Fig. 1. BSEP expression in PFIC-2 and PFIC-3 livers. PFIC liver sections were stained with the BSEP antibody K165 (red) and the MRP2 antibody M2III6 (green). Livers C1, C2, C3, C4, and C5 displayed no BSEP immunoreactivity despite a canalicular MRP2 staining pattern and were therefore diagnosed as PFIC-2. Livers C6, C7, C8, C9, and C10 were diagnosed as PFIC-3 due to MDR3 gene-mutations or absence of MDR3 expression. They showed colocalization of BSEP and MRP2 similar to control livers (representative control liver in upper panel, K168 BSEP antibody). Bars 10 m. The scattered red dots, which were observed in some PFIC-2 livers, were almost indistinguishable from autofluorescence observed in several livers. Therefore, it cannot be excluded that BSEP formed intracellular deposits in PFIC-2. BSEP, bile salt export pump; PFIC, progressive familial intrahepatic cholestasis; MRP, multidrug resistance associated protein; MDR, multidrug resistance. MDR3 mrna was detected in all PFIC-2 and PFIC-3 livers and was increased compared with controls (Table 4). MDR3 protein amounts were quite variable in PFIC-2 and PFIC-3 livers and showed no clear trend. MDR3 protein was detected in PFIC-3 livers C6, C7, and C8 (Fig. 2B), in line with the immunofluorescence data. Expression of Other Transporter Proteins in PFIC-2 and PFIC-3. NTCP mrna levels in PFIC livers were not significantly different from those of control groups I and II (Table 4). Interestingly, Western blot analysis showed a significant reduction of NTCP protein by approximately 50% in both PFIC-2 and PFIC-3 livers (Fig. 3B, Table 5). Accordingly, reduced NTCP immunoreactivity was observed in PFIC-2 and -3 (Fig. 3A). MRP3 transports conjugated monoanionic bile salts and was suggested to play a role in bile salt homeostasis

6 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL Fig. 2. MDR3 expression in PFIC-2 and PFIC-3 livers. (A) PFIC liver slices were stained with the MDR3 antibody P3II26 (red) and the MRP2 antibody M2III6 (green). PFIC-2 livers C1, C2, C3, C4, and C5 showed colocalization of MDR3 and MRP2. Livers C6, C7, and C8 showed a clear canalicular staining pattern of MDR3 despite a MDR3 mutation (Table 1). Livers C9 and C10 displayed no canalicular MDR3 but MRP2 staining. Bars 10 m. (B) Western blot analysis of MDR3 in PFIC and controls. MDR, multidrug resistance; PFIC, progressive familial intrahepatic cholestasis; MRP, multidrug resistance associated protein. under cholestatic conditions. 11,13 Relative MRP3 mrna levels were RRU in PFIC-2 and RRU in PFIC-3 livers, respectively. They were not significantly different from controls (control I: RRU; control II: RRU). Protein expression of MRP3 was unaltered in PFIC-2 and -3 livers and was RDU in control I and in PFIC-2 and in PFIC-3 livers, respectively (Fig. 4B). In all

7 1166 KEITEL ET AL. HEPATOLOGY, May 2005 Table 4. mrna Expression of Hepatobiliary Transporters in PFIC Livers PFIC-2 PFIC-3 Control I Control II (n 4) (n 5) (n 3) (n 6) Mean SD Mean SD Mean SD Mean SD BSEP MDR ** MRP MDR ** NTCP OATP1B ** ** OATP1B ** OATP2B n.d. OATP1A n.d. MRP */** MRP # MRP ** */** NOTE. Relative mrna levels of transporters were measured in PFIC-2 and PFIC-3 livers and compared to controls. mrna levels of individual genes are expressed as x-fold copies compared to the patient s individual HPRT-mRNA-level. Abbreviation: n.d., not determined. *Significantly different from control I (P.05); **significantly different from control II (P.05); #MRP3 mrna of C10 was an outlier (70.3 RRU) which was not included, otherwise mean MRP3 expression in PFIC-3 was RRU. livers examined, MRP3 was localized at the basolateral membrane of hepatocytes (Fig. 4A). MRP4 is also localized at the sinusoidal membrane of hepatocytes. Recently human MRP4 has been shown to transport bile salts together with glutathione. 10 In control livers, relative MRP4 mrna expression was RRU (control I) and RRU (control II). Relative MRP4 mrna levels were significantly elevated in PFIC-3 ( RRU) and in PFIC-2 ( RRU) livers compared with control group II, but the increase in MRP4 mrna levels did not reach significance in PFIC-2 when compared with control I (Table 3). MRP4 protein expression was increased 5- and 10-fold in PFIC-2 and PFIC-3 livers, respectively, compared with control livers (Table 5). MRP4 expression was more variable in the PFIC-2 livers examined here (Fig. 4B). Immunofluorescence microscopy confirmed the basolateral localization of MRP4 in both control and diseased livers (Fig. 4A). MRP2 transports mono- and bisglucuronosyl bilirubin and certain conjugated bile salts into bile. 26 MRP2 mrna levels appeared lower in PFIC livers (Table 3), but the differences did not reach significance because of considerable variation in MRP2 mrna and protein levels (Fig. 4B). MRP2 protein was detected in all control and diseased livers at the canalicular membrane (Figs. 1 and 2). The mrna expression of OATP1B1, the counterpart of MRP2 in terms of bilirubin glucuronide transport, 3 was significantly reduced in PFIC-2 and -3 compared with control II (Table 4) but was almost unchanged in PFIC-3 livers when compared with control I. Immunofluorescence staining of OATP1B1 at the sinusoidal membrane was notably reduced in diseased livers (Fig. 5A). Protein levels were significantly reduced in PFIC livers (Table 5). Expression of OATP1B1 mrna was 40 to 60 times higher than OATP1B3 mrna and 20 to 40 times higher than OATP2B1 mrna expression. OATP1B3 mrna expression in diseased livers was lowered, whereas OATP2B1 was almost unaltered in PFIC livers compared with controls. Western blot analysis of OATP1B3 clearly showed a reduced expression of OATP1B3 in PFIC-2 and -3 livers (Table 5, Fig. 5B). In accordance with the Western blot data, OATP1B3 was reduced in most and hardly detectable in some PFIC livers as detected by immunofluorescence (Fig. 5A). Discussion This study investigates the expression of hepatobiliary transporters in livers of children with PFIC. 19,27 PFIC livers are of interest because they represent human gene knock-outs and because results from animal studies are not entirely valid for humans. For example, Bsep knockout mice develop only mild liver disease in contrast to humans. 28 Other examples of species differences regarding bile salt homeostasis are the different suppression of Cyp7A1, Cyp27A1, and Cyp8B1 by bile salts in human hepatocytes compared with rodent hepatocytes, 29 a differential regulation of Cyp7A1 by L R, 30 and marked species differences in the binding of bile salts to farnesoid X receptor. 31 Our results suggest that PFIC-2 can be diagnosed on the basis of absent canalicular BSEP immunoreactivity (Table 1). This is in line with previous reports 32,33 suggesting that immunofluorescence staining might be a

8 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL BSEP mutations were recently identified to cause a second form of benign recurrent intrahepatic cholestasis (BRIC-2). 36 However, BSEP localization in BRIC-2 patients was not investigated in that study. Impaired processing or targeting of mutated BSEP might be the cause of absent BSEP from the canaliculi in these patients. Defective BSEP targeting as an important mechanism underlying PFIC-2 was reported recently: 5 of 7 mutations prevented rat Bsep from trafficking to the apical membrane. 37 Similarly, increased intracellular degradation and reduced canalicular targeting of mouse Bsep carrying the common D482G mutation was demonstrated recently. 38 MDR3 immunofluorescence is of limited value in the diagnosis of PFIC-3, as shown by the association of disease-causing MDR3 mutations and normal canalicular MDR3 localization. The mutation S346I was detected in 2 children (C6 and C7). Normal canalicular MDR3 localization associated with this mutation was already reported for child C7. 39 A second MDR3 mutation (A953D, C8) identified in this study has not been described so far. Similar to S346I, a canalicular staining pattern of MDR3 was observed in this patient. Additional PFIC-3 causing MDR3 mutations, which do not prevent MDR3 targeting to the canaliculi, include T424A and V425M. 22,39 Preserved expression and targeting suggest that these MDR3 mutations cause decreased transporter activity. One mutation found in patient C9 led to a 7 base pair deletion, resulting in a premature stop-codon, and was recently described. 21 In line with an early truncation of the protein, no canalicular immunoreactivity was detected in the liver of this child. It is of note, however, that the MDR3 mrna level was not significantly lowered in this patient compared with controls. The mutation A555G Fig. 3. NTCP expression in PFIC-2 and PFIC-3 livers. (A) NTCP was localized in the basolateral membrane of both control and PFIC livers. Reduced immunoreactivity to the anti-ntcp antibody was observed for most PFIC livers compared with controls. Bars 10 m. (B) NTPC expression is reduced in PFIC livers as shown by Western blot analysis. Images from the remaining patients are included in the supplemental data file. NTCP, sodium taurocholate cotransporting polypeptide; PFIC, progressive familial intrahepatic cholestasis. valuable diagnostic tool for PFIC Although our children with a low- GT cholestasis having a PFIC-1 genotype was not ruled out, this seems unlikely, because BSEP expression and its canalicular localization were reported to be unaltered in PFIC-1 disease. 35 Milder forms of Table 5. Protein Expression of Hepatobiliary Transporters in PFIC Livers PFIC-2 PFIC-3 Control I (n 4) (n 5) (n 3) Mean SD Mean SD Mean SD MDR MRP * NTCP * * OATP1B * * OATP1B * * MRP MRP * NOTE. Relative protein expression was quantified by Western blot analysis and densitometry. Values were calculated to be x-fold as compared with the protein expression of control liver Con1 (from control group I), which was set to 1.0. *Significantly different from control I with P.05. A shift of OATP1B1 to a lower molecular weight was observed in control patient Con1 (Fig. 5B); therefore, densitometry was normalized to Con2.

9 1168 KEITEL ET AL. HEPATOLOGY, May 2005 Fig. 4. Expression of MRP isoforms in PFIC-2 and PFIC-3 livers. (A) MRP3 and MRP4 were costained in PFIC or control livers. Immunoreactivity to MRP3 was similar in control and in PFIC livers. Basolateral MRP3 was found over the entire sinusoid without evident zonal distribution. In contrast to MRP3, MRP4 displayed a stronger immunofluorescence signal in PFIC livers as compared with controls. Bars 10 m. (B) Western blot analysis of MRP2, MRP3, and MRP4 in PFIC livers. Whereas MRP3 protein showed no evident differences in control and diseased livers, MRP4 was upregulated in most PFIC livers. MRP2 expression was diminished in approximately half of the livers. Images from the remaining patients are included in the supplemental data file. MRP, multidrug resistance associated protein; PFIC, progressive familial intrahepatic cholestasis. (PFIC-2 patient C5) results in an amino acid change in codon 175 from threonine to alanine. It has not been described so far in PFIC-3 patients, 21 patients with MDR3-associated cholelithiasis, 40 or patients with intrahepatic cholestasis of pregnancy, 25 all of which are linked to MDR3 mutations. 22 The pathophysiological relevance of this mutation remains to be determined; however, based on the absence of canalicular BSEP immunoreactivity, BSEP deficiency is likely the more relevant alteration in this patient. Taken together, PFIC-3 cannot be diagnosed on the basis of MDR3 immunofluorescence as suggested for PFIC-2 34 but requires gene-sequencing or single nucleotide polymorphism analysis. Our results further suggest that GT levels are of limited specificity in the diagnosis of the PFIC subtype. For example patient C3 could only be diagnosed as PFIC-2 on the basis of absent BSEP immunoreactivity despite elevated GT. In contrast, patient C6 had a homozygous MDR3 mutation and almost normal GT, whereas patient C7 with the same mutation had 10-fold increased GT levels. Conversely, in patient C10, MDR3 was not detectable in the canaliculi or on Western blots, but he had normal GT levels.

10 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL Fig. 5. OATP1B1 and OATP1B3 expression in PFIC-2 and PFIC-3 livers. (A) OATP1B1 immunoreactivity in liver sections of PFIC patients was noticeably reduced compared with controls (identical settings were used for all pictured. Representative pictures are shown; PFIC-3 patients with [C7] or without [C9] canalicular MDR3 expression). OATP1B3 immunoreactivity was reduced in PFIC livers compared with controls. In some PFIC livers such as C4, intracellular OATP1B3 was increased at the expense of membrane-bound OATP1B3. (B) OATP1B3 protein expression is reduced in most PFIC patients. Similarly, OATP1B1 protein was lower in PFIC patients compared with controls. Of note, the molecular mass of OATP1B1 was diminished in Con1 (designated as OATP1B1*), which was not observed in any other control or PFIC patient. The reason for this shift in molecular mass is not known. A representative loading control (GAPDH) is shown. Images from the remaining patients are included in the supplemental data file. OATP, organic anion transporting polypeptide; PFIC, progressive familial intrahepatic cholestasis; MDR, multidrug resistance.

11 1170 KEITEL ET AL. HEPATOLOGY, May 2005 In this study, 2 control groups were established. One control group consisted of liver samples of organ donors. The second control group was composed of liver biopsy specimens from adult patients with different liver diseases. This approach taking mildly diseased livers as controls was already used in other studies of human cholestatic conditions Despite the limitations and small sample sizes, some clear differences were detectable between PFIC livers and controls. Serum concentrations of primary bile salts are elevated in PFIC-2 and PFIC-3 compared with healthy individuals. Bile salt concentrations in bile of PFIC-3 patients are normal, which might be explained by preserved canalicular BSEP expression as demonstrated in this study. Elevated bile salt concentrations in the blood of PFIC-3 patients consequently must be attributable to other mechanisms than BSEP downregulation and might include impaired sinusoidal uptake of bile salts or increased efflux back into blood. Both possibilities are supported by our data: Downregulation of the NTCP protein occurred on a posttranscriptional level in PFIC-2 and -3 livers and might explain the decreased bile acid uptake. In individual patients, an apparently low correlation between Western blot and immunofluorescence data was observed. This might be attributable to the general difficulties in protein quantification from microscopic images. For example, sinusoidal transporters distribute over a large area, and small or moderate changes in their amount cannot be recognized by eye. Furthermore, even within a single tissue section, staining quality can vary considerably, and transporter density in livers with cirrhosis may be heterogeneous. However, immunofluorescence data complement Western blot analysis, in that they give information about the subcellular transporter localization. The main transporters from the OATP family involved in bile salt uptake were also downregulated in PFIC-livers. Reduction of OATP1B3 and OATP1B1 mrna was more pronounced in PFIC-2 compared with PFIC-3 livers, whereas mrna levels of OATP2B1, which is not involved in bile salt transport, was hardly changed. It might be speculated that absence of a functionally active BSEP protein from the canalicular membrane of hepatocytes in PFIC-2 causes a stronger accumulation of bile salts compared with PFIC-3 hepatocytes, making a reduction of bile salt uptake even more essential. Downregulation of NTCP, OATP1B1, and OATP1B3 was similarly observed in advanced stages of primary biliary cirrhosis. 43,44 The subcellular distribution of hepatobiliary transporters is of major significance for overall bile formation. The intracellular occurrence of transporter proteins as observed in PFIC livers (e.g., Fig. 3 for NTCP or Fig. 5A, patient C4, for OATP1B3) or in control livers (e.g., Fig. 2, patient Con1 for MDR3 and MRP2 or Fig. 3 for NTCP) indicates that transporter localization needs to be considered to better understand the pathophysiology of cholestatic syndromes. However, dynamic models (such as cell lines, primary hepatocytes, or perfused animal livers) are required to investigate this complex matter. An increased reflux of bile salts from hepatocytes into plasma might further contribute to increased plasma bile salt concentrations in PFIC patients: In animal models, Mrp3 was found to be upregulated in certain cholestatic and icteric conditions to maintain bile salt or bilirubin glucuronide homeostasis. 11,15,45 In humans, MRP3 expression is increased in patients with Dubin-Johnsonsyndrome 9 to compensate for reduced MRP2 activity at the canalicular membrane. Despite the role of MRP3 under these conditions, no changes of MRP3 mrna or protein were observed in this study. In line with the Western blot data, immunoreactivity to MRP3 was indistinguishable in liver sections of PFIC and control patients (Fig. 4A). The data suggest that upregulation of MRP3 does not play a major role as an escape route for bile salts in PFIC patients, which is in line with the lower affinity for conjugated bile salts of human MRP3 compared with rat Mrp3. 13 Similar to our findings, MRP3 was not upregulated in patients with advanced primary biliary cirrhosis. 43 In contrast to MRP3, MRP4 is strongly upregulated at the mrna and at the protein level in PFIC. This upregulation was most pronounced in PFIC-3 livers. Assuming that MRP4 may compete for bile salts with BSEP, 46 the high MRP4 expression may partly explain the elevated plasma bile salt concentrations in PFIC-3 patients despite normal bile salt concentrations in bile as mentioned previously. The mechanism underlying MRP4 upregulation in PFIC patients remains elusive. The increase in MRP4 protein might represent an adaptive response to increased bile salts, as reported recently in obstructive cholestasis in rat 47 or in farnesoid X receptor knock-out mice with cholestasis due to severely reduced BSEP expression. 48 All children of this study received tauroursodeoxycholate medication, and it was shown recently that tauroursodeoxycholate administration upregulates Mrp4/MRP4 in mice 49 and in human livers. 50 Therefore, tauroursodeoxycholate treatment may in part explain the increased MRP4 expression in our study. In all instances, increased bile salts (due to cholestasis or due to oral administration) seem to be associated with increased MRP4. In line with this conclusion, Mrp4 expression further increased, when farnesoid X receptor knockout mice received bile salts orally. 48 Interestingly, Mrp3 was hardly affected in these cholestatic animals, 48 which is in good agreement with our results.

12 HEPATOLOGY, Vol. 41, No. 5, 2005 KEITEL ET AL In conclusion, upregulation of MRP4 in human liver disease likely represents a major escape route for bile salts. Together with the concerted downregulation of sinusoidal bile acid uptake transporter, MRP4 is likely to protect hepatocytes from toxic intracellular bile salt concentrations in cholestasis. Acknowledgment: is acknowledged. References Technical assistance by A. Knoke 1. Hagenbuch B, Stieger B, Foguet M, Lubbert H, Meier PJ. Functional expression cloning and characterization of the hepatocyte Na /bile acid cotransport system. Proc Natl Acad Sci USA1991;88: Abe T, Kakyo M, Tokui T, Nakagomi R, Nishio T, Nakai D, et al. Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 1999;274: Cui Y, König J, Leier I, Buchholz U, Keppler D. Hepatic uptake of bilirubin and its conjugates by the human organic anion transporter SLC21A6. J Biol Chem 2001; 276: König J, Cui Y, Nies AT, Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 2000;275: Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, et al. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998;273: Büchler M, König J, Brom M, Kartenbeck J, Spring H, Horie T, et al. cdna cloning of the hepatocyte canalicular isoform of the multidrug resistance protein, cmrp, reveals a novel conjugate export pump deficient in hyperbilirubinemic mutant rats. J Biol Chem 1996;271: Paulusma CC, Bosma PJ, Zaman GJ, Bakker CT, Otter M, Scheffer GL, et al. Congenital jaundice in rats with a mutation in a multidrug resistanceassociated protein gene. Science 1996;271: Akita H, Suzuki H, Ito K, Kinoshita S, Sato N, Takikawa H, et al. Characterization of bile acid transport mediated by multidrug resistance associated protein 2 and bile salt export pump. Biochim Biophys Acta 2001; 1511: König J, Rost D, Cui Y, Keppler D. Characterization of the human multidrug resistance protein isoform MRP3 localized to the basolateral hepatocyte membrane. HEPATOLOGY 1999;29: Rius M, Nies AT, Hummel-Eisenbeiss J, Jedlitschky G, Keppler D. Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane. HEPATOLOGY 2003;38: Hirohashi T, Suzuki H, Takikawa H, Sugiyama Y. ATP-dependent transport of bile salts by rat multidrug resistance-associated protein 3 (Mrp3). J Biol Chem 2000;275: Kiuchi Y, Suzuki H, Hirohashi T, Tyson CA, Sugiyama Y. cdna cloning and inducible expression of human multidrug resistance associated protein 3 (MRP3). FEBS Lett 1998;433: Zelcer N, Saeki T, Bot I, Kuil A, Borst P. Transport of bile acids in multidrug-resistance-protein 3-overexpressing cells co-transfected with the ileal Na -dependent bile-acid transporter. Biochem J 2003;369: Hirohashi T, Suzuki H, Ito K, Ogawa K, Kume K, Shimizu T, et al. Hepatic expression of multidrug resistance-associated protein-like proteins maintained in eisai hyperbilirubinemic rats. Mol Pharmacol 1998;53: Donner MG, Keppler D. Up-regulation of basolateral multidrug resistance protein 3 (Mrp3) in cholestatic rat liver. HEPATOLOGY 2001;34: Bohan A, Chen WS, Denson LA, Held MA, Boyer JL. Tumor necrosis factor alpha-dependent up-regulation of Lrh-1 and Mrp3(Abcc3) reduces liver injury in obstructive cholestasis. J Biol Chem 2003;278: Zelcer N, Reid G, Wielinga P, Kuil A, van dh, I, Schuetz JD, et al. Steroid and bile acid conjugates are substrates of human multidrug-resistance protein (MRP) 4 (ATP-binding cassette C4). Biochem J 2003;371: Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998;20: Whitington PF, Freese DK, Alonso EM, Schwarzenberg SJ, Sharp HL. Clinical and biochemical findings in progressive familial intrahepatic cholestasis. J Pediatr Gastroenterol Nutr 1994;18: van Helvoort A, Smith AJ, Sprong H, Fritzsche I, Schinkel AH, Borst P, et al. MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycoprotein specifically translocates phosphatidylcholine. Cell 1996;87: De Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci USA1998;95: Jacquemin E. Role of multidrug resistance 3 deficiency in pediatric and adult liver disease: one gene for three diseases. Semin Liver Dis 2001;21: Kubitz R, Sütfels G, Kühlkamp T, Kölling R, Häussinger D. Trafficking of the bile salt export pump from the Golgi to the canalicular membrane is regulated by the p38 MAP Kinase. Gastroenterology 2004;126: Kullak-Ublick GA, Glasa J, Boker C, Oswald M, Grutzner U, Hagenbuch B, et al. Chlorambucil-taurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas. Gastroenterology 1997; 113: Jacquemin E, Cresteil D, Manouvrier S, Boute O, Hadchouel M. Heterozygous non-sense mutation of the MDR3 gene in familial intrahepatic cholestasis of pregnancy. Lancet 1999;353: Kamisako T, Leier I, Cui Y, Konig J, Buchholz U, Hummel-Eisenbeiss J, et al. Transport of monoglucuronosyl and bisglucuronosyl bilirubin by recombinant human and rat multidrug resistance protein 2. HEPATOLOGY 1999;30: Bull LN, Carlton VE, Stricker NL, Baharloo S, DeYoung JA, Freimer NB, et al. Genetic and morphological findings in progressive familial intrahepatic cholestasis (Byler disease [PFIC-1] and Byler syndrome): evidence for heterogeneity. HEPATOLOGY 1997;26: Wang R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ, et al. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad SciUSA2001;98: Ellis E, Axelson M, Abrahamsson A, Eggertsen G, Thorne A, Nowak G, et al. Feedback regulation of bile acid synthesis in primary human hepatocytes: evidence that CDCA is the strongest inhibitor. HEPATOLOGY 2003; 38: Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA. Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 2003;17: Cui J, Heard TS, Yu J, Lo JL, Huang L, Li Y, et al. The amino acid residues asparagine 354 and isoleucine 372 of human farnesoid X receptor confer the receptor with high sensitivity to chenodeoxycholate. J Biol Chem 2002;277: Jansen PL, Strautnieks SS, Jacquemin E, Hadchouel M, Sokal EM, Hooiveld GJ, et al. Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis. Gastroenterology 1999;117: Jansen PL, Sturm E. Genetic cholestasis, causes and consequences for hepatobiliary transport. Liver Int 2003; 23: Thompson R, Strautnieks S. BSEP: function and role in progressive familial intrahepatic cholestasis. Semin Liver Dis 2001;21: Knisely AS, Meier Y, Stieger B, Portmann BC, Rayner AC, Strautnieks S, et al. Immunohistochemically recognized bile salt export protein is unremarkably expressed at the canaliculus in persons with ATP8B1 disease [Abstract]. HEPATOLOGY 2003;38(Suppl 1):390A. 36. van Mil SW, Van Der Woerd WL, Van Der BG, Sturm E, Jansen PL, Bull LN, et al. Benign recurrent intrahepatic cholestasis type 2 is caused by mutations in ABCB11. Gastroenterology 2004;127:

13 1172 KEITEL ET AL. HEPATOLOGY, May Wang L, Soroka CJ, Boyer JL. The role of bile salt export pump mutations in progressive familial intrahepatic cholestasis type II. J Clin Invest 2002; 110: Plass JR, Mol O, Heegsma J, Geuken M, de Bruin J, Elling G, et al. A progressive familial intrahepatic cholestasis type 2 mutation causes an unstable, temperature-sensitive bile salt export pump. J Hepatol 2004;40: Jacquemin E, De Vree JM, Cresteil D, Sokal EM, Sturm E, Dumont M, et al. The wide spectrum of multidrug resistance 3 deficiency: from neonatal cholestasis to cirrhosis of adulthood. Gastroenterology 2001;120: Rosmorduc O, Hermelin B, Boelle PY, Parc R, Taboury J, Poupon R. ABCB4 gene mutation-associated cholelithiasis in adults. Gastroenterology 2003;125: Zollner G, Fickert P, Zenz R, Fuchsbichler A, Stumptner C, Kenner L, et al. Hepatobiliary transporter expression in percutaneous liver biopsies of patients with cholestatic liver diseases. HEPATOLOGY 2001;33: Oswald M, Kullak-Ublick GA, Paumgartner G, Beuers U. Expression of hepatic transporters OATP-C and MRP2 in primary sclerosing cholangitis. Liver 2001;21: Kojima H, Nies AT, König J, Hagmann W, Spring H, Uemura M, et al. Changes in the expression and localization of hepatocellular transporters and radixin in primary biliary cirrhosis. J Hepatol 2003;39: Zollner G, Fickert P, Silbert D, Fuchsbichler A, Marschall HU, Zatloukal K, et al. Adaptive changes in hepatobiliary transporter expression in primary biliary cirrhosis. J Hepatol 2003;38: Donner MG, Warskulat U, Saha N, Haussinger D. Enhanced expression of basolateral multidrug resistance protein isoforms Mrp3 and Mrp5 in rat liver by LPS. Biol Chem 2004;385: Häussinger D, Kubitz R, Reinehr R, Bode JG, Schliess F. Molecular aspects of medicine: from experimental to clinical hepatology. Mol Aspects Med 2004; 25: Denk GU, Soroka CJ, Takeyama Y, Chen WS, Schuetz JD, Boyer JL. Multidrug resistance-associated protein 4 is up-regulated in liver but down-regulated in kidney in obstructive cholestasis in the rat. J Hepatol 2004;40: Schuetz EG, Strom S, Yasuda K, Lecureur V, Assem M, Brimer C, et al. Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone receptors, transporters, and cytochrome P450. J Biol Chem 2001;276: Trauner M, Fickert P, Wagner M, Zollner G. Adaptive hepatobiliary transporter regulation by ursodeoxycholic acid. In: Paumgartner G, Keppler D, Leuschner U, Stiehl A, eds. Bile Acid Biology and Its Therapeutic Implications. Berlin: Springer, 2005: Marschall HU, Wagner M, Zollner G, Fickert P, Gumhold J, Silbert D, et al. Comprehensive study of the effects of rifampicin and ursodeoxycholic acid on genes and proteins involved in regulation, transport and detoxification of biliary compounds in gallstone patients. In: Paumgartner G, Keppler D, Leuschner U, Stiehl A, eds. Bile Acid Biology and Its Therapeutic Implications. Berlin: Springer, 2005: