SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION Droplet networks with incorporated protein diodes exhibit collective properties Giovanni Maglia 1, Andrew J. Heron 1, William L. Hwang 2, Matthew A. Holden 3, Ellina Mikhailova 1, Qiuhong Li 1, Stephen Cheley 1 and Hagan Bayley 1 1 Department of Chemistry, University of Oxford, Oxford, OX1 3TA, United Kingdom 2 Division of Health Sciences and Technology, Harvard Medical School and Massachusetts Institute of Technology, Boston, MA , USA 3 Department of Chemistry, University of Massachusetts, Amherst, MA 01003, USA nature nanotechnology 1

2 supplementary information METHODS Construction of the gene encoding 7R- HL. The 7R- HL gene was constructed by cassette mutagenesis. Briefly, a re-engineered version of the HL gene pt7- HL-RL2 1, was digested with SacII and SpeI and the resulting small fragment was replaced by three-way ligation with cassette 1: 5 GGAATTCGATTGATACAAAAGAGTATCGGAGTCGG (sense), phosphorylated 5 TAACCGACTCCGATACTCTTTTGTATCAATCGAATTCCGC (antisense) and cassette 2: phosphorylated 5 TTACGGTACCGATTCCGTGGTCGCCTTCGTGGTGATGATA (sense) and 5 CTAGTATCATCACCACGAAGGCGACCACGGAATCGGTACCG (antisense) to yield pt7-r7- HL (pt7-m113r/t115r/t117r/g119r/n121r/n123r/t125r- HL-RL2). The new HL gene was verified by DNA sequencing. Expression, purification and assembly of homoheptameric 7R- HL. Rosetta (DE3) plyss E. coli cells (Merck, UK) were transformed with the pt7-7r- HL plasmid and plated onto LB-agar containing antibiotics (carbenicillin, 50 μg ml -1 ; Carbenicillin Direct, UK; chloramphenicol, 34 μg ml -1 ; Sigma-Aldrich, UK). The expression culture was grown at 37 C in the presence of antibiotics, with shaking at 200 rpm, to an OD 600 of 0.8, at which time IPTG (Calbiochem, UK) was added to 0.5 mm. The temperature was brought to 20 C and the cells were incubated for a further 20 h. The cells were harvested by centrifugation (Avanti J-25 rotor 8000 rpm; Beckman Coulter, USA) for 15 min at 4 C. The pellet was resuspended in lysis buffer (5 ml per g; 10 mm Tris.HCl (ph 8.0), 8 M urea, 1 2 nature nanotechnology

3 supplementary information mm phenylmethylsulfonyl fluoride, 0.1% Triton X-100, 5 mm MgCl 2, 5 mg ml -1 lysozyme, 1 μg ml -1 DNase I, containing one tablet of EDTA-free protease inhibitor (Roche, UK)) and incubated on ice for 30 min. The lysate was disrupted on ice with a sonicator (Soniprep 150; MSE, UK) using 5 pulses (10 khz) of 30 s duration interspersed with cooling intervals of 30 s. After centrifugation the supernatant was filtered through a 0.2 μm syringe filter (Anachem, UK). The filtrate was then loaded onto an SP Sepharose cation exchange column (XK16; GE Healthcare, UK) equilibrated in 10 mm Tris.HCl, 8 M urea (ph 8.0) connected to an ÄKTA Explorer 10XT chromatography system (GE Healthcare, UK) and subjected to a subtractive purification step. At this point, the 7R- HL was a mixture of oligomer and monomer and did not bind to the cation exchange column, while the majority of the low molecular weight contaminants were removed. The flow-through from the column was dialyzed against 100 vol of 10 mm Tris.HCl, 150 mm NaCl (ph 8.0) for 16 h at 4 C. Precipitated protein was removed by centrifugation (10,000 rpm, model J2-21 rotor, Beckman Coulter, USA). After 5-fold concentration (Amicon Ultracell-10k; Fisher Scientific, UK), the sample was again centrifuged as above. SDS was added to the supernatant (to 0.5% w/v), which then was heated at 50 C for 10 min. Heat- and SDS-stable heptamers were isolated by gel filtration on a Superdex /300GL column (GE Healthcare) run with 10 mm Tris.HCl, 150 mm NaCl (ph 8.0). A final purification of the heptamer was performed by gel electrophoresis. [ 35 S]methionine-labeled 7R- HL heptamer was synthesized by coupled transcription and translation (IVTT) in the presence of rabbit erythrocyte nature nanotechnology 3

4 supplementary information membranes as previously described 1. The 7R- HL heptamer purified from E. coli (50 μl; 0.94 mg ml -1 ) was mixed with 2.5 μl of the 35 S-labeled 7R- HL and loaded onto a single lane of an 8% SDS-polyacrylamide gel. After electrophoresis (18 h, 50 V), heptameric 7R- HL was extracted from the gel as detailed previously 1 and stored in aliquots at -80 C. Electrical recordings from planar bilayers and droplet interface bilayers (DIB). In all bilayer recordings, the applied potential refers to the potential of the working electrode. In planar bilayer recordings, HL inserts into the bilayer from the cis chamber, which also contained the electrode connected to the ground. Similarly, in two droplet networks, the protein was placed in the same droplet as the ground electrode. In the three droplet network depicted in Fig. 3, the left droplet contains the working electrode and the right droplet the ground electrode. Depending on the circuit, the protein was placed in the middle and/or in the right droplet. In the full-wave rectification circuit of Fig. 4, droplets 2 and 3 were connected to the triangular input waveform. The output current was measured by placing the working and ground electrodes of a patch-clamp amplifier (Axopatch 200B, Axon Instruments, Foster City, CA) in droplets 4 and 1, respectively. Planar bilayer recordings. A bilayer of 1,2-diphytanoyl-sn-glycero-3- phosphocholine (DPhPC, Avanti Polar Lipids) was formed on an aperture (~100 μm in diameter) in a 25-μm thick polytetrafluoroethylene film (Goodfellow Cambridge Limited, Cat. no. FP301200/10, Huntingdon, UK) that divided a 4 nature nanotechnology

5 supplementary information chamber into cis and trans compartments. The aperture was pretreated with 10 μl of 10% hexadecane (Sigma) in pentane (Sigma). Both compartments contained 0.4 ml of 1 M KCl, 25 mm Tris.HCl, ph 8.0, containing 100 μm EDTA. Droplet interface bilayer recordings. Water droplets (~200 nl; 1 M KCl, 25 mm Tris.HCl, ph 8.0, containing 100 μm EDTA and 0.1 mg ml -1 DPhPC as vesicles) were pipetted into a chamber containing 5 mm DPhPC in hexadecane. Droplet networks were created by gently placing two or more droplets in contact with each other. Typically, a few tens of seconds were sufficient for a bilayer to form spontaneously between the droplets. The droplets were manipulated and electrically accessed with 100 μm-diameter Ag/AgCl electrodes. The signal generator used as input for the full-wave rectifier network was custom made (see Fig. S4 for a diagram of the signal generator). To avoid problems of a common ground with the Axopatch 200B, the signal generator was battery operated and placed inside the Faraday cage containing the droplets. The full wave rectifier built to test the system contained 1N4007 general-purpose semiconductor diodes. REFERENCE 1. Cheley, S., Braha, O., Lu, X., Conlan, S. & Bayley, H. A functional protein pore with a "retro" transmembrane domain. Protein Sci. 8, (1999). nature nanotechnology 5

6 supplementary information Additional figures Figure S1 Current rectification by 7R- HL pores. a, Voltage-step protocol. b, c and d, Selected current traces from individual runs of the protocol for a single 7R- HL channel showing that the channel can close in a single step (b) of a few hundred milliseconds or in a single step with a reopening (c and d) after the application of negative potential. The conditions are as described in Fig nature nanotechnology

7 supplementary information Figure S2 Voltage dependence of the decay constants for the closing of 7R- HL pores under negative applied potential. a and b, First and second exponential decays, respectively. The decay constants at each potential were calculated as described in Fig. 2c from at least four experiments. The error is expressed as the standard error of the mean. nature nanotechnology 7

8 supplementary information Figure S3 Half-wave rectification efficiency of 7R- HL diodes in planar bilayers as a function of a sinusoidal input frequency (±100 mv). The current rectification efficiency is calculated by measuring the ratio of the area under the positive-current half-wave over the area under the negative-current half-wave. The rectification efficiency is optimal at low frequencies (< 0.2 Hz), but as the frequency increases the efficiency of the 7R- HL diode decreases. The red line is a double exponential fit of the data. 8 nature nanotechnology

9 supplementary information Figure S4 Circuit diagram of the battery powered signal generator used for the full-wave rectifier experiments. The circuit is built around a TL062CP Operational Amplifier. R 1 = 0K when using the semiconductor diode bridgerectifier, and R 1 = 22K when applied to the 4-droplet DIB bridge rectifier circuit, with fine adjustment of output voltage achieved by means of the 1K gain variable resistor. nature nanotechnology 9

10 supplementary information Figure S5 Response of the lipid bilayer to an applied sinusoidal input voltage waveform of ±100 mv. The electrical response to the applied voltage waveform is at the bottom. No proteins were included in the planar lipid bilayer. Capacitance, and in particular the decay transients (e.g. such as those in Fig. 3), can play a significant role in our systems when applying higher frequency AC signals. However, when working in the low frequency regime (here < 1 Hz) these effects become negligible. For example, the asymmetric response observed in Fig. 4d at 0.1 Hz is far greater than the symmetric response shown above. 10 nature nanotechnology