Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX
|
|
- Oswald Underwood
- 5 years ago
- Views:
Transcription
1 Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX Ingemar Björkhem, Marjan Shafaati, Ulla Andersson, Ute Panzenboeck, Magnus Hansson, Shoshana Shpitzen, Vardiella Meiner, Wolfgang Slatter, Eran Leitersdorf
2 CYP27A1 CYP27A1 CYP27A1 Namn Efternamn 17 juli
3 CYP27A1 CYP27A1 Namn Efternamn 17 juli
4 Cerebrotendinous Xanthomatosis (CTX) CTX is caused by mutations in the CYP27A1 gene. The clinical picture includes xanthomas of the brain, skin, and tendons. The xanthomas in the brain may cause neurological disturbances (ataxia) and early dementia Biochemically the patients have markedly reduced levels of 27- hydroxycholesterol in the circulation, normal or low cholesterol levels, increased levels of cholestanol, markedly increased levels of abnormal 25-hydroxylated C27-bile alcohols Namn Efternamn 17 juli
5 Lack of CYP27A1 activity in humans leads to cerebrotendinous xanthomatosis Namn Efternamn 17 juli
6 The sterol 27-hydroxylase is antiatherogenic Namn Efternamn 17 juli
7 Treatment of CTX with chenodeoxycholic acid is effective, even xanthomas in the brain may reduced in size This means that the lack of CYP27A1 mediated flux of 27-oxygenated metabolites of cholesterol can not be the key mechanism behind the formation of xanthomas A mouse model with a disrupted Cyp27 gene does not develop xanthomas. In contrast to patients with CTX, Cyp27-/- mice do not have increased levels of cholestanol Namn Efternamn 17 juli
8 OH T HO 14 C H HO 14 C Rat T/ 14 C = 1.25 T/ 14 C = 1.02 Healthy man T/ 14 C = 1.74 T/ 14 C = 1.25 CTX- patient T/ 14 C = 1.54 T/ 14 C = 0.35 Namn Efternamn 4 april Skrede, S., Björkhem, I., et al J.Clin.Invest. 75 (1985) S Namn Efternamn 17 juli
9 HO O OH OH O O OH HO H Bile Acids Cholestanol Namn Efternamn 417 april juli
10 Comparison CTX with Cyp27-/- mice TX-patients 19-50x x 17-24x x 5-9x yp27 -/- mice 4.4x 1.8x Namn Efternamn 17 juli
11 Inhibition of CYP7A1 by bile acids in the normal situation Feed-back inhibition Bile acids Namn Efternamn 17 juli
12 Metabolic consequences of a defective CYP27A1 enzyme Bile acids Namn Efternamn 17 juli
13 Metabolic consequences of a defective CYP27A1 enzyme Namn Efternamn 17 juli
14 Metabolic consequences of a defective CYP27A1 enzyme Namn Efternamn 17 juli
15 Cholesterol Cholestanol 7-alpha-OH-4-cholesten-3-one Namn Efternamn 17 juli
16 Blood brain barrier model experiments pbcecs on filter insert apical ( blood ) 7αOH-Cholestenone Cholesterol 7αOH-Cholesterol Cholestanol 27OH-Cholesterol 15 basolateral ( brain ) % Transfer of Steroid (Mean +/- SD; n=3) Time (h) Namn Efternamn 17 juli
17 Production of Cholestanol from 7α-hydroxy-4-cholesten-3-one 0,45 Cholestanol/Cholesterol 0,30 0,15 Neuroblastoma Astrocytoma Microglia 0, Time hour Namn Efternamn 17 juli
18 O OH O OH O O HO H Namn Efternamn 17 juli
19 27-hydroxylation O OH 27-hydroxylation O OH 27-hydroxylation O 27-hydroxylation O 27-hydroxylation HO H Namn Efternamn 17 juli
20 27-hydroxylation O OH 27-hydroxylation O OH 27-hydroxylation O 27-hydroxylation O 27-hydroxylation HO H Namn Efternamn 17 juli
21 Why is the accumulation of cholestanol accompanied by accumulation of cholesterol? Cholestanol is less effective as a HMG CoA reductase inhibitor than cholesterol. Dilution of the cholesterol pool with cholestanol may thus increase cholesterol synthesis. There may be some direct conversion of cholestanol into cholesterol, due to a relatively low substrate specificity of the lathosterol 5alpha reductase There may be an upregulation of cholesterol synthesis caused by 7 alpha hydroxy-4-cholesten-3-one Namn Efternamn 17 juli
22 Incubation of Astrocytes with 7-alpha-hydroxy-4- cholesten-3-one 0,35 0,3 Cholestanol/Cholesterol Lathosterol/Cholesterol 0,25 Ratio 0,2 0,15 0,1 0, ug 0,5 ug 1 ug 2 ug 4 ug 8 ug 7-alpha-hydroxy-4-cholesten-3-one Namn Efternamn 17 juli
23 Incubation of MDM with 7-alpha-hydroxy-4-cholesten-3-one. Effects on mrna levels of key genes husrebp1c hsrebp2 h-hmgcoar HuACAT Control 0,5ug/mL 1ug/mL 2ug/mL 0,1 7-alpha hydroxy-4-cholesten-3-one Namn Efternamn 17 juli
24 Conclusions Accumulation of cholestanol in patients with CTX is likely to be of critical importance for the formation of xanthomas Most probably this accumulation is a consequence of the marked accumulation of 7 alpha hydroxylated bile acid intermediates which are precursors for cholestanol Namn Efternamn 17 juli
25 One of the bile acid intermediates, 7 alpha hydroxy-4- cholesten-3-one passes the blood-brain barrier very efficiently and is converted into cholestanol in the brain It seems likely that also the accumulation of cholesterol in the brain xanthomas is secondary to the flux of 7 alpha hydroxy-4- cholesten-3-one into the brain Namn Efternamn 17 juli
26 SREBP regulation of cholesterol synthesis N C N Golgi S2P SCAP Mature SREBP S1P N C SCAP Insig Sterols N N ER Activates transcription Nucleus Namn Efternamn 17 juli
27 Sterol structure and effect on HMG CoA reductase in mouse Namn Efternamn 17 juli
28 Accessory systems that may be affected in the CTX patient Substrate transport Electron transport StarD5? Cholesterol Adrenodoxin? Adrenodoxin reductase? CYP27A1 e - Mitochondria Namn Efternamn 17 juli
29 [ 2 H 6 ]7α-hydroxy-4-cholesten-3-one m/z 388 Detector response [ 2 H 6 ]cholestanol m/z 466 [ 2 H 6 ]4-cholesten-3-one m/z 390 Time Namn Efternamn 17 juli
30 Testing the hypothesis that the increased accumulation of cholestanol in the brain of patients with CTX is due to a flux of 7alpha-hydroxy-4-cholesten-3-one into the brain Daily intraperitoneal injections of 7alpha-hydroxy-4-cholesten-3-one, 200 ug, in a wild type mice and a Cyp27-/- mice for 10 weeks % Cholestanol of total sterol fraction Liver Brain Cyp27 -/- mouse 1 11 Cyp27 +/+ mouse 1 2 Untreated Cyp27+/+ 1 1 Namn Efternamn 17 juli
31 Incubation of MDM with Cholestanol 25 Lathosterol x 100 Cholestanol 20 Ratio ug 2 ug 5 ug 10 ug 20 ug Cholestanol Namn Efternamn 17 juli
32 Production of 4-cholesten-3-one from 7α-hydroxy-4- cholesten-3-one 0,15 4-cholesten-3- one/cholesterol 0,10 0,05 Neuroblastoma Astrocytoma Microglia 0, Time hour Namn Efternamn 17 juli
33 Increase in plasma levels of intermediates in cholestanol synthesis in patients with CTX 19-50x x 17-24x x 5-9x Björkhem et al. Hepatology 7 (1987) Namn Efternamn 17 juli
34 CYP27A1 is a widely expressed mitochondrial enzyme It belongs to the cytochrome p450 enzyme family. CYP27A1 is expressed in most tissues. In the liver it has an important role for bile acid synthesis. Requires NADPH, O 2, adrenodoxin, and adrenodoxin reductase for enzymatic activity. Transfer of substrate into the mitochondria may be a limiting factor for enzymatic activity. Namn Efternamn 17 juli
35 0.08 Cholestanol:Cholesterol α-Hydroxy-4-cholesten-3-one Added to Medium (µg/ml) Namn Efternamn 17 juli
36 Incubation of Astrocytes with Cholestanol 0,600 0,500 latho x 100/Cholesterol Cholestanol/Cholesterol 0,400 Ratio 0,300 0,200 0,100 0, ug 20ug 40ug Cholestanol Namn Efternamn 17 juli
STUDIES ON STEROL 27-HYDROXYLASE (CYP27A1)
From the Department of Laboratory Medicine Division of Clinical Chemistry Karolinska Institutet Karolinska University Hospital, Huddinge S-141 86 Stockholm, Sweden STUDIES ON STEROL 27-HYDROXYLASE (CYP27A1)
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationThematic Review Series: Genetics of Human Lipid Diseases. Genetic connections between neurological disorders and
thematic review Thematic Review Series: Genetics of Human Lipid Diseases Genetic connections between neurological disorders and cholesterol metabolism Ingemar Björkhem, 1, * Valerio Leoni, and Steve Meaney
More informationGenetic Connections Between Neurological Disorders and Cholesterol Metabolism
Dublin Institute of Technology ARROW@DIT Articles School of Biological Sciences 2010-01-01 Genetic Connections Between Neurological Disorders and Cholesterol Metabolism Ingemar Bjorkhem Karolinska Institute
More informationGenetic connections between neurological disorders and cholesterol metabolism
Genetic connections between neurological disorders and cholesterol metabolism Ingemar Björkhem a#, Valerio Leoni b and Steve Meaney c a Department of Laboratory Medicine, Karolinska Institutet, Karolinska
More informationDo oxysterols control cholesterol homeostasis?
PERSPECTIVE Biology and biochemistry of cholesterol Ira Tabas, Series Editor Do oxysterols control cholesterol homeostasis? Ingemar Björkhem Division of Clinical Chemistry, Karolinska Institutet, Huddinge
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationHepatic Transporter Proteins involved in Bile Formation
Bile salt synthesis Hepatic Transporter Proteins involved in Bile Formation Basolateral membrane transporter proteins fx: NTCP uptake of bile salts OATP bulky organic anions Canalicular membrane transporter
More informationOn the regulatory role of side-chain hydroxylated oxysterols in the brain. Lessons from CYP27A1 transgenic and Cyp27a1 / mice 1
On the regulatory role of side-chain hydroxylated oxysterols in the brain. Lessons from CYP27A1 transgenic and Cyp27a1 / mice 1 Zeina Ali, 2, * Maura Heverin, 2, * Maria Olin, * Jure Acimovic, *, Anita
More informationChenodal (chenodiol)
Chenodal (chenodiol) Policy Number: 5.01.549 Last Review: 04/2018 Origination: 06/2013 Next Review: 04/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will provide coverage for Chenodal
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationSteroid Hormones Synthesis
*I ll try my best to incorporate the Slides in this Sheet; you don t need to study the slides if you study this sheet. Steroid Hormones Synthesis - The figure to the right is the Steroid nucleus, it has
More informationTendon xanthomas are deposits of lipid and connective
Mechanism of Accumulation of Cholesterol and Cholestanol in Tendons and the Role of Sterol 27-hydroxylase (CYP27A1) Sara von Bahr, Tomas Movin, Nikos Papadogiannakis, Irina Pikuleva, Per Rönnow, Ulf Diczfalusy,
More informationA novel route for the elimination of brain oxysterols: Elimination of 27-hydroxycholesterol via conversion to 7α-hydroxy-3-oxo-4-cholestenoic acid
1 A novel route for the elimination of brain oxysterols: Elimination of 27-hydroxycholesterol via conversion to 7α-hydroxy-3-oxo-4-cholestenoic acid Steve Meaney 1 *, Maura Heverin 1 *, Ute Panzenboeck
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationmay exist for the cleavage of the cholesterol side chain in cholic acid and chenodeoxycholic acid biosynthesis.
Biosynthesis of Bile Acids in Cerebrotendinous Xanthomatosis Relationship of Bile Acid Pool Sizes and Synthesis Rates to Hydroxylations at C-12, C-25, and C-26 Gerald Salen, Sarah Shefer, G. S. rint, G.
More informationRole of the 26-Hydroxylase in the Biosynthesis of Bile Acids in the Normal State and in Cerebrotendinous Xanthomatosis
Role of the 26-Hydroxylase in the Biosynthesis of Bile Acids in the Normal State and in Cerebrotendinous Xanthomatosis AN IN VIVO STUDY INGEMAR BJbRKHEM, OLAV FAUSA, GUNNAR HOPEN, HELGE OFTEBRO, JAN I.
More informationBIOSYNTHESIS OF STEROID HORMONES
BIOSYNTHESIS OF STEROID HORMONES Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI sw/steroidrepro/inter/08 1 STEROID HORMONES Progestins (21 C) Glucocorticoids (21 C) Mineralocorticoids
More informationOxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol
Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol Ingemar Björkhem, 1, * Lena Starck,*, Ulla Andersson,* Dieter Lütjohann,*,
More informationAuthor's personal copy
Clinica Chimica Acta 411 (2010) 43 48 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim ESI-MS/MS quantification of 7α-hydroxy-4-cholesten-3-one
More informationab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
More informationCHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK
CHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK A dissertation submitted to Kent State University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy
More informationChapter 4. Drug Biotransformation
Chapter 4 Drug Biotransformation Drug Biotransformation 1 Why is drug biotransformation necessary 2 The role of biotransformation in drug disposition 3 Where do drug biotransformation occur 4 The enzymes
More informationDifferent phenotypes in identical twins with Cerebrotendinous Xanthomatosis: case series
Page containing authors Different phenotypes in identical twins with Cerebrotendinous Xanthomatosis: case series Authors: Dénes Zádori 1, László Szpisjak 1, László Madar 2, Viktória Evelin Varga 3, Bernadett
More information2 The abbreviations used are: SREBP, sterol regulatory element-binding protein;
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 3, pp. 1445 1455, January 18, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Effectors of Rapid Homeostatic
More informationCytochrome P 450 Unique family of heme proteins present in bacteria, fungi, insects, plants, fish, mammals and primates. Universal oxygenases (oxygen-
Cytochrome P 450 Biochemistry Department Cytochrome P 450 Unique family of heme proteins present in bacteria, fungi, insects, plants, fish, mammals and primates. Universal oxygenases (oxygen-utilizing
More informationMCB130 Midterm. GSI s Name:
1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal
More information26-Hydroxycholesterol: regulation of hydroxymethylglutaryl-coa reductase activity in Chinese hamster ovary cell culture
26-Hydroxycholesterol: regulation of hydroxymethylglutaryl-coa reductase activity in Chinese hamster ovary cell culture Abbie L. Esterman,' Howard Baum, Norman B. Javitt, and Gretchen J. Darlington2 Division
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationCerebrotendinous xanthomatosis (a rare lipid storage disorder): a case report
Razi et al. Journal of Medical Case Reports (2016) 10:103 DOI 10.1186/s13256-016-0882-y CASE REPORT Open Access Cerebrotendinous xanthomatosis (a rare lipid storage disorder): a case report Syed Mohd Razi
More informationOn the importance of albumin binding for the flux of 7α-hydroxy-3-oxo-4-cholestenoic acid in the brain.
On the importance of albumin binding for the flux of 7α-hydroxy-3-oxo-4-cholestenoic acid in the brain. Ahmed A. Saeed 1,2*, Erik Edström 3*, Irina Pikuleva 4, Gösta Eggertsen 1 and Ingemar Björkhem 1#
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationMechanism of degradation of the steroid side chain in the formation of bile acids
, Mechanism of degradation of the steroid side chain in the formation of bile acids Ingemar Bjorkhem Department of Clinical Chemistry, Karolinska Institute, Huddinge Hospital, Huddinge, Sweden Introduction
More informationBiologic Oxidation BIOMEDICAL IMPORTAN
Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron
More informationDepartment of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of Medicine, P. O. Box 95, Rootstown, OH 44272
[Frontiers in Bioscience 3, d176-193, February 15, 1998] REGULATION OF BILE ACID SYNTHESIS John Y. L. Chiang Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of
More informationCholesterol 25-hydroxylation activity of CYP3A
Cholesterol 25-hydroxylation activity of CYP3A Akira Honda, *,, Teruo Miyazaki,, Tadashi Ikegami, * Junichi Iwamoto, * Tomomi Maeda, ** Takeshi Hirayama, * Yoshifumi Saito, * Tamio Teramoto, ** and Yasushi
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationCommentary. New mechanisms by which statins lower plasma cholesterol. Henri Brunengraber
Commentary New mechanisms by which statins lower plasma cholesterol Henri Brunengraber Department of Nutrition Case Western Reserve University Cleveland, OH 44109 Phone: 216 368 6429 Fax: 216 368 6560
More informationBile Acid Synthesis in Cultured Human Hepatocytes: Support for an Alternative Biosynthetic Pathway to Cholic Acid
Bile Acid Synthesis in Cultured Human Hepatocytes: Support for an Alternative Biosynthetic Pathway to Cholic Acid MAGNUS AXELSON, 1 EWA ELLIS, 2 BIRGITTA MÖRK, 1 KRISTINA GARMARK, 1 ANNA ABRAHAMSSON, 2
More informationBiosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015
Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 The major site of acetoacetate and 3-hydorxybutyrate production is the liver. They are preferred substrates for myocardiocytes
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationB. G. Wolthers, I.* H. T. Walrecht,* J. C. van der Molen,* G. T. Nagel,* J. J. Van Doormaa1,t and P. N. Wijnandts**
Use of determinations of 7-lathosterol (5a-cholest-7-en-3P-ol) and other cholesterol precursors in serum in the study and treatment of disturbances of sterol metabolism, particularly cerebrotendinous xanthomatosis
More informationUsing the Organic Acids Test Part 5 Dr. Jeff Moss
Using organic acids to resolve chief complaints and improve quality of life in chronically ill patients Part V Jeffrey Moss, DDS, CNS, DACBN jeffmoss@mossnutrition.com 413-530-08580858 (cell) 1 Summer
More informationThe role of cholestanol in the pathogenesis of cholesterol gallstones. Review: Hypothesis and Conception (1991)
The role of cholestanol in the pathogenesis of cholesterol gallstones. Review: Hypothesis and Conception (1991) Jacob L. Turumin Department of Experimental Surgery, Irkutsk Institute of Surgery, Scientific
More informationChemical Classification of Hormones
Steroid Hormones Chemical Classification of Hormones Hormones are chemical messengers that transport signals from one cell to another There are 4 major chemical classes of hormones steroid hormones - i.e.
More informationObjectives By the end of lecture the student should:
Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.
More informationSTUDIES ON REGULATORY MECHANISMS BEHIND ITS FORMATION IN THE BRAIN AND ITS POTENTIAL USE AS A MARKER FOR NEURODEGENERATION
Thesis for doctoral degree (Ph.D.) 2010 Thesis for doctoral degree (Ph.D.) 2010 24S-HYDROXYCHOLESTEROL Marjan Shafaati 24S-HYDROXYCHOLESTEROL. STUDIES ON REGULATORY MECHANISMS BEHIND ITS FORMATION IN THE
More informationAnaesthesia recommendations for patients suffering from Cerebrotendinous xanthomatosis
orphananesthesia Anaesthesia recommendations for patients suffering from Cerebrotendinous xanthomatosis Disease name: Cerebrotendinous xanthomatosis ICD 10: E75.5 Synonyms: cerebrotendinous xanthomatosis,
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationXTreme 200 Human Liver Microsomes Lot No Human Liver Microsomes Pool of 200 (100 Male and 100 Female) Suspension medium: 250 mm sucrose
XTreme 200 Human Liver Microsomes Lot No. 1710084 Human Liver Microsomes Pool of 200 (100 Male and 100 Female) Suspension medium: 250 mm sucrose H2610 0.5 ml at 20 mg/ml H2620 1.0 ml at 20 mg/ml H2630
More informationnumber Done by Corrected by Doctor
number 18 Done by Mahmoud Harbi Corrected by حسام أبو عوض Doctor Nayef Karadsheh Sources of Reactive Oxygen Species (ROS) 1 P a g e 1- Oxidases: there are some that produce hydrogen peroxide (H₂O₂) 2-
More informationSupplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus
Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus Christopher M. Valdez 1, Clyde F. Phelix 1, Mark A. Smith 3, George Perry 1,2, and Fidel Santamaria
More informationSCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY
1 SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR: SEX HORMONES PART 1 An Overview What are steroid hormones? Steroid
More informationMoh Tarek + Faisal Massad. Tala Saleh ... Naif
19 Moh Tarek + Faisal Massad Tala Saleh... Naif Last lecture we ve talked about the main antioxidant system which are the enzymes found in our body, mainly: 1. Glutathione peroxidase 2. Super oxide dismutase(sod)
More informationnumber Done by Corrected by Doctor Faisal Al-Khatib
number 22 Done by Baraa Ayed Corrected by Yaseen Fatayer Doctor Faisal Al-Khatib 1 P a g e Today we are going to cover these concepts: Oxidation of odd number fatty acids Oxidation of very long fatty acids
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationMechanism of Detoxification
Mechanism of Detoxification Prof.Dr. Hedef Dhafir El-Yassin 1 Objectives: 1. To list the detoxification pathways 2. To describe detoxification pathways and phases in the liver, 2 3 4 o Xenobiotics are
More informationOccurrence of isomeric dehydrocholesterols in human plasma
Occurrence of isomeric dehydrocholesterols in human plasma Magnus Axelson' Department of Clinical Chemistry, Karolinska Hospital, S-104 01 Stockholm, Sweden Abstract Three isomeric dehydrocholesterols
More informationBile acid metabolism. doc. Ing. Zenóbia Chavková, CSc.
Bile acid metabolism doc. Ing. Zenóbia Chavková, CSc. Bile acid metabolism Importance: Availability for fat & cholesterol absorption Regulates total body pool of cholesterol Factors that synthesis promote
More informationLoss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
More informationReconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis
Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis Denis POMPON Laboratoire d Ingénierie des Protéines Membranaires CGM CNRS Gif sur Yvette, France.
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationDiscussion of Prism modules and predicted interactions (Fig. 4)
SUPPLEMENTARY NOTES Discussion of Prism modules and predicted interactions (Fig. 4) a. Interactions of the TCA-cycle, respiratory chain, and ATP synthetase with the amino acid biosynthesis modules. Given
More informationCHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005
CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 Name Dr. H. White - Instructor There are 8 pages to this examination including this page. In addition, you will get a metabolic
More informationCHOLBAM (cholic acid) oral capsule
CHOLBAM (cholic acid) oral capsule Coverage for services, procedures, medical devices and drugs are dependent upon benefit eligibility as outlined in the member's specific benefit plan. This Pharmacy Coverage
More informationIngemar Bjorkhem, Helge Oftebro, Sverre Skrede, and Jan I. Pedersen
Assay of intermediates in bile acid biosynthesis using isotope dilution-mass spectrometry: hepatic levels in the normal state and in cerebrotendinous xanthomatosis Ingemar Bjorkhem, Helge Oftebro, Sverre
More informationnumber Done by Corrected by Doctor
number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming
More informationHisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo
Workshop Argentina-Japan Bioscience and Biotechnology for the Promotion of Agriculture and Food Production -August 3rd to 7th 2009- Hisanori Kato Endowed Chair of Food for Life Organization for Interdisciplinary
More informationSTEROL 27-HYDROXYLASE IS a mitochondrial P450 enzyme
0013-7227/00/$03.00/0 Vol. 141, No. 11 Endocrinology Printed in U.S.A. Copyright 2000 by The Endocrine Society Cholestenoic Acid Is a Naturally Occurring Ligand for Liver X Receptor * CHING SONG AND SHUTSUNG
More informationCytochrome P450s in humans Feb. 4, 2009
Cytochrome P450s in humans Feb. 4, 2009 David Nelson (last modified Jan. 4, 2009) Reading (optional) Nelson D.R. Cytochrome P450 and the individuality of species. (1999) Arch. Biochem. Biophys. 369, 1-10.
More informationFonnation of Bile Acids in Man: Conversion of Cholesterol into 53-Cholestane-3a,7a, 12a-triol in Liver Homogenates *
Fonnation of Bile Acids in Man: Conversion of Cholesterol into 53-Cholestane-3a,7a, 12a-triol in Liver Homogenates * INGEMAR BJORKHEM, HENRY DANIELSSON, KuRT EINARSSON, and GUNNAR JOHANSSON From the Department
More informationA point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis
A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis Naoki Nakashima, Yoshiyuki Sakai, Hironori Sakai, Toshihiko Yanase, Masafumi
More informationCARBOHYDRATE METABOLISM 1
CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationCholesterol is an essential component of mammalian cell
Brief Reviews Intracellular Cholesterol Transport Raymond E. Soccio, Jan L. Breslow Abstract Intracellular cholesterol transport is essential for the maintenance of cholesterol homeostasis. Many aspects
More informationBile acid abnormalities in peroxisomal disorders
Bile acid abnormalities in peroxisomal disorders Sacha Ferdinandusse Lab. Genetic Metabolic Diseases Academic Medical Center Amsterdam Peroxisomes play an important role in bile acid biosynthesis Bile
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationEpidemiology, diagnosis, and treatment of cerebrotendinous xanthomatosis (CTX)
J Inherit Metab Dis (2017) 40:771 781 DOI 10.1007/s10545-017-0093-8 REVIEW Epidemiology, diagnosis, and treatment of cerebrotendinous xanthomatosis (CTX) Gerald Salen 1 & Robert D. Steiner 2,3 Received:
More informationCHOLBAM (cholic acid) oral capsule
CHOLBAM (cholic acid) oral capsule Coverage for services, procedures, medical devices and drugs are dependent upon benefit eligibility as outlined in the member's specific benefit plan. This Pharmacy Coverage
More informationStructural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis
Structural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis Magnus Axelson, * Olle Larsson, t Jie Zhang,t * Junichi Shoda: * and Jan Sjovall*
More informationTechnical Report. Sugar and Sterol Analysis in Human Body Fluids on a True Dual Column GCMS System. 1. Summary. 2. Introduction
C146-E151A Technical Report Sugar and Sterol Analysis in Human Body Fluids on a True Dual Column GCMS System Fokje S.M. Zijlstra 1, Leo A.J. Kluijtmans 1, and Mark H.P.M. van Lieshout 2 1. Summary Being
More informationDetermination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry
Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry methods Ines Burkard, Katharina M. Rentsch, 1 and Arnold von Eckardstein Institute
More informationSide chain hydroxylation of C,,-steroids and vitamin D3 by a cytochrome P-450 enzyme system isolated from human liver mitochondria
Side chain hydroxylation of C,,-steroids and vitamin D3 by a cytochrome P-450 enzyme system isolated from human liver mitochondria Helge Oftebro, Kristin Saarem, Ingemar Bjorkhem, and Jan I. Pedersen'
More informationHormonal effects of prohormones in bovines
Hormonal effects of prohormones in bovines Jeroen Rijk Supervisors: Michel Nielen, Maria Groot and Ad Peijnenburg RIKILT Institute of Food Safety, Wageningen UR WT Theme 3 Introduction Prohormone = A chemical
More informationCerebrotendinous xanthomatosis with cholestanolaemia - involvement of five individuals in a Malay family
Med. J. Malaysia Vol. 45 No. 4 December 1990 Cerebrotendinous xanthomatosis with cholestanolaemia - involvement of five individuals in a Malay family NorHayati Othman, MBBS, M.Path Lecturer Sabariah Abdul
More informationby either cholesterol or cholestyramine feeding. J.
Alternate pathways of bile acid synthesis in the cholesterol 7 -hydroxylase knockout mouse are not upregulated by either cholesterol or cholestyramine feeding Margrit Schwarz, 1, * David W. Russell,* John
More informationProblem Set #5 4/3/ Spring 02
Question 1 Chloroplasts contain six compartments outer membrane, intermembrane space, inner membrane, stroma, thylakoid membrane, and thylakoid lumen each of which is populated by specific sets of proteins.
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationCholesterol metabolism Ι
Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationName Class Date. 1. Cellular respiration is the process by which the of "food"
Name Class Date Cell Respiration Introduction Cellular respiration is the process by which the chemical energy of "food" molecules is released and partially captured in the form of ATP. Carbohydrates,
More informationThese are example problems, which are similar to those you may see on the final exam.
MCB102 / Metabolism Problem Set #3 Spring 2008 These are example problems, which are similar to those you may see on the final exam. QUESTION 1: /. Circle the correct answer, but if the answer is provide
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationPeroxisomes and bile acid biosynthesis
Biochimica et Biophysica Acta 1763 (2006) 1427 1440 www.elsevier.com/locate/bbamcr Review Peroxisomes and bile acid biosynthesis Sacha Ferdinandusse, Sander M. Houten Laboratory Genetic Metabolic Diseases,
More informationSchoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins
Research article Schoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins Luke J. Engelking, 1 Guosheng Liang, 1 Robert E. Hammer, 2 Kiyosumi Takaishi,
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More information