Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX

Size: px
Start display at page:

Download "Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX"

Transcription

1 Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX Ingemar Björkhem, Marjan Shafaati, Ulla Andersson, Ute Panzenboeck, Magnus Hansson, Shoshana Shpitzen, Vardiella Meiner, Wolfgang Slatter, Eran Leitersdorf

2 CYP27A1 CYP27A1 CYP27A1 Namn Efternamn 17 juli

3 CYP27A1 CYP27A1 Namn Efternamn 17 juli

4 Cerebrotendinous Xanthomatosis (CTX) CTX is caused by mutations in the CYP27A1 gene. The clinical picture includes xanthomas of the brain, skin, and tendons. The xanthomas in the brain may cause neurological disturbances (ataxia) and early dementia Biochemically the patients have markedly reduced levels of 27- hydroxycholesterol in the circulation, normal or low cholesterol levels, increased levels of cholestanol, markedly increased levels of abnormal 25-hydroxylated C27-bile alcohols Namn Efternamn 17 juli

5 Lack of CYP27A1 activity in humans leads to cerebrotendinous xanthomatosis Namn Efternamn 17 juli

6 The sterol 27-hydroxylase is antiatherogenic Namn Efternamn 17 juli

7 Treatment of CTX with chenodeoxycholic acid is effective, even xanthomas in the brain may reduced in size This means that the lack of CYP27A1 mediated flux of 27-oxygenated metabolites of cholesterol can not be the key mechanism behind the formation of xanthomas A mouse model with a disrupted Cyp27 gene does not develop xanthomas. In contrast to patients with CTX, Cyp27-/- mice do not have increased levels of cholestanol Namn Efternamn 17 juli

8 OH T HO 14 C H HO 14 C Rat T/ 14 C = 1.25 T/ 14 C = 1.02 Healthy man T/ 14 C = 1.74 T/ 14 C = 1.25 CTX- patient T/ 14 C = 1.54 T/ 14 C = 0.35 Namn Efternamn 4 april Skrede, S., Björkhem, I., et al J.Clin.Invest. 75 (1985) S Namn Efternamn 17 juli

9 HO O OH OH O O OH HO H Bile Acids Cholestanol Namn Efternamn 417 april juli

10 Comparison CTX with Cyp27-/- mice TX-patients 19-50x x 17-24x x 5-9x yp27 -/- mice 4.4x 1.8x Namn Efternamn 17 juli

11 Inhibition of CYP7A1 by bile acids in the normal situation Feed-back inhibition Bile acids Namn Efternamn 17 juli

12 Metabolic consequences of a defective CYP27A1 enzyme Bile acids Namn Efternamn 17 juli

13 Metabolic consequences of a defective CYP27A1 enzyme Namn Efternamn 17 juli

14 Metabolic consequences of a defective CYP27A1 enzyme Namn Efternamn 17 juli

15 Cholesterol Cholestanol 7-alpha-OH-4-cholesten-3-one Namn Efternamn 17 juli

16 Blood brain barrier model experiments pbcecs on filter insert apical ( blood ) 7αOH-Cholestenone Cholesterol 7αOH-Cholesterol Cholestanol 27OH-Cholesterol 15 basolateral ( brain ) % Transfer of Steroid (Mean +/- SD; n=3) Time (h) Namn Efternamn 17 juli

17 Production of Cholestanol from 7α-hydroxy-4-cholesten-3-one 0,45 Cholestanol/Cholesterol 0,30 0,15 Neuroblastoma Astrocytoma Microglia 0, Time hour Namn Efternamn 17 juli

18 O OH O OH O O HO H Namn Efternamn 17 juli

19 27-hydroxylation O OH 27-hydroxylation O OH 27-hydroxylation O 27-hydroxylation O 27-hydroxylation HO H Namn Efternamn 17 juli

20 27-hydroxylation O OH 27-hydroxylation O OH 27-hydroxylation O 27-hydroxylation O 27-hydroxylation HO H Namn Efternamn 17 juli

21 Why is the accumulation of cholestanol accompanied by accumulation of cholesterol? Cholestanol is less effective as a HMG CoA reductase inhibitor than cholesterol. Dilution of the cholesterol pool with cholestanol may thus increase cholesterol synthesis. There may be some direct conversion of cholestanol into cholesterol, due to a relatively low substrate specificity of the lathosterol 5alpha reductase There may be an upregulation of cholesterol synthesis caused by 7 alpha hydroxy-4-cholesten-3-one Namn Efternamn 17 juli

22 Incubation of Astrocytes with 7-alpha-hydroxy-4- cholesten-3-one 0,35 0,3 Cholestanol/Cholesterol Lathosterol/Cholesterol 0,25 Ratio 0,2 0,15 0,1 0, ug 0,5 ug 1 ug 2 ug 4 ug 8 ug 7-alpha-hydroxy-4-cholesten-3-one Namn Efternamn 17 juli

23 Incubation of MDM with 7-alpha-hydroxy-4-cholesten-3-one. Effects on mrna levels of key genes husrebp1c hsrebp2 h-hmgcoar HuACAT Control 0,5ug/mL 1ug/mL 2ug/mL 0,1 7-alpha hydroxy-4-cholesten-3-one Namn Efternamn 17 juli

24 Conclusions Accumulation of cholestanol in patients with CTX is likely to be of critical importance for the formation of xanthomas Most probably this accumulation is a consequence of the marked accumulation of 7 alpha hydroxylated bile acid intermediates which are precursors for cholestanol Namn Efternamn 17 juli

25 One of the bile acid intermediates, 7 alpha hydroxy-4- cholesten-3-one passes the blood-brain barrier very efficiently and is converted into cholestanol in the brain It seems likely that also the accumulation of cholesterol in the brain xanthomas is secondary to the flux of 7 alpha hydroxy-4- cholesten-3-one into the brain Namn Efternamn 17 juli

26 SREBP regulation of cholesterol synthesis N C N Golgi S2P SCAP Mature SREBP S1P N C SCAP Insig Sterols N N ER Activates transcription Nucleus Namn Efternamn 17 juli

27 Sterol structure and effect on HMG CoA reductase in mouse Namn Efternamn 17 juli

28 Accessory systems that may be affected in the CTX patient Substrate transport Electron transport StarD5? Cholesterol Adrenodoxin? Adrenodoxin reductase? CYP27A1 e - Mitochondria Namn Efternamn 17 juli

29 [ 2 H 6 ]7α-hydroxy-4-cholesten-3-one m/z 388 Detector response [ 2 H 6 ]cholestanol m/z 466 [ 2 H 6 ]4-cholesten-3-one m/z 390 Time Namn Efternamn 17 juli

30 Testing the hypothesis that the increased accumulation of cholestanol in the brain of patients with CTX is due to a flux of 7alpha-hydroxy-4-cholesten-3-one into the brain Daily intraperitoneal injections of 7alpha-hydroxy-4-cholesten-3-one, 200 ug, in a wild type mice and a Cyp27-/- mice for 10 weeks % Cholestanol of total sterol fraction Liver Brain Cyp27 -/- mouse 1 11 Cyp27 +/+ mouse 1 2 Untreated Cyp27+/+ 1 1 Namn Efternamn 17 juli

31 Incubation of MDM with Cholestanol 25 Lathosterol x 100 Cholestanol 20 Ratio ug 2 ug 5 ug 10 ug 20 ug Cholestanol Namn Efternamn 17 juli

32 Production of 4-cholesten-3-one from 7α-hydroxy-4- cholesten-3-one 0,15 4-cholesten-3- one/cholesterol 0,10 0,05 Neuroblastoma Astrocytoma Microglia 0, Time hour Namn Efternamn 17 juli

33 Increase in plasma levels of intermediates in cholestanol synthesis in patients with CTX 19-50x x 17-24x x 5-9x Björkhem et al. Hepatology 7 (1987) Namn Efternamn 17 juli

34 CYP27A1 is a widely expressed mitochondrial enzyme It belongs to the cytochrome p450 enzyme family. CYP27A1 is expressed in most tissues. In the liver it has an important role for bile acid synthesis. Requires NADPH, O 2, adrenodoxin, and adrenodoxin reductase for enzymatic activity. Transfer of substrate into the mitochondria may be a limiting factor for enzymatic activity. Namn Efternamn 17 juli

35 0.08 Cholestanol:Cholesterol α-Hydroxy-4-cholesten-3-one Added to Medium (µg/ml) Namn Efternamn 17 juli

36 Incubation of Astrocytes with Cholestanol 0,600 0,500 latho x 100/Cholesterol Cholestanol/Cholesterol 0,400 Ratio 0,300 0,200 0,100 0, ug 20ug 40ug Cholestanol Namn Efternamn 17 juli

STUDIES ON STEROL 27-HYDROXYLASE (CYP27A1)

STUDIES ON STEROL 27-HYDROXYLASE (CYP27A1) From the Department of Laboratory Medicine Division of Clinical Chemistry Karolinska Institutet Karolinska University Hospital, Huddinge S-141 86 Stockholm, Sweden STUDIES ON STEROL 27-HYDROXYLASE (CYP27A1)

More information

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010 cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

More information

Thematic Review Series: Genetics of Human Lipid Diseases. Genetic connections between neurological disorders and

Thematic Review Series: Genetics of Human Lipid Diseases. Genetic connections between neurological disorders and thematic review Thematic Review Series: Genetics of Human Lipid Diseases Genetic connections between neurological disorders and cholesterol metabolism Ingemar Björkhem, 1, * Valerio Leoni, and Steve Meaney

More information

Genetic Connections Between Neurological Disorders and Cholesterol Metabolism

Genetic Connections Between Neurological Disorders and Cholesterol Metabolism Dublin Institute of Technology ARROW@DIT Articles School of Biological Sciences 2010-01-01 Genetic Connections Between Neurological Disorders and Cholesterol Metabolism Ingemar Bjorkhem Karolinska Institute

More information

Genetic connections between neurological disorders and cholesterol metabolism

Genetic connections between neurological disorders and cholesterol metabolism Genetic connections between neurological disorders and cholesterol metabolism Ingemar Björkhem a#, Valerio Leoni b and Steve Meaney c a Department of Laboratory Medicine, Karolinska Institutet, Karolinska

More information

Do oxysterols control cholesterol homeostasis?

Do oxysterols control cholesterol homeostasis? PERSPECTIVE Biology and biochemistry of cholesterol Ira Tabas, Series Editor Do oxysterols control cholesterol homeostasis? Ingemar Björkhem Division of Clinical Chemistry, Karolinska Institutet, Huddinge

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport. Alice Skoumalová Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

More information

Hepatic Transporter Proteins involved in Bile Formation

Hepatic Transporter Proteins involved in Bile Formation Bile salt synthesis Hepatic Transporter Proteins involved in Bile Formation Basolateral membrane transporter proteins fx: NTCP uptake of bile salts OATP bulky organic anions Canalicular membrane transporter

More information

On the regulatory role of side-chain hydroxylated oxysterols in the brain. Lessons from CYP27A1 transgenic and Cyp27a1 / mice 1

On the regulatory role of side-chain hydroxylated oxysterols in the brain. Lessons from CYP27A1 transgenic and Cyp27a1 / mice 1 On the regulatory role of side-chain hydroxylated oxysterols in the brain. Lessons from CYP27A1 transgenic and Cyp27a1 / mice 1 Zeina Ali, 2, * Maura Heverin, 2, * Maria Olin, * Jure Acimovic, *, Anita

More information

Chenodal (chenodiol)

Chenodal (chenodiol) Chenodal (chenodiol) Policy Number: 5.01.549 Last Review: 04/2018 Origination: 06/2013 Next Review: 04/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will provide coverage for Chenodal

More information

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

Steroid Hormones Synthesis

Steroid Hormones Synthesis *I ll try my best to incorporate the Slides in this Sheet; you don t need to study the slides if you study this sheet. Steroid Hormones Synthesis - The figure to the right is the Steroid nucleus, it has

More information

Tendon xanthomas are deposits of lipid and connective

Tendon xanthomas are deposits of lipid and connective Mechanism of Accumulation of Cholesterol and Cholestanol in Tendons and the Role of Sterol 27-hydroxylase (CYP27A1) Sara von Bahr, Tomas Movin, Nikos Papadogiannakis, Irina Pikuleva, Per Rönnow, Ulf Diczfalusy,

More information

A novel route for the elimination of brain oxysterols: Elimination of 27-hydroxycholesterol via conversion to 7α-hydroxy-3-oxo-4-cholestenoic acid

A novel route for the elimination of brain oxysterols: Elimination of 27-hydroxycholesterol via conversion to 7α-hydroxy-3-oxo-4-cholestenoic acid 1 A novel route for the elimination of brain oxysterols: Elimination of 27-hydroxycholesterol via conversion to 7α-hydroxy-3-oxo-4-cholestenoic acid Steve Meaney 1 *, Maura Heverin 1 *, Ute Panzenboeck

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol

More information

may exist for the cleavage of the cholesterol side chain in cholic acid and chenodeoxycholic acid biosynthesis.

may exist for the cleavage of the cholesterol side chain in cholic acid and chenodeoxycholic acid biosynthesis. Biosynthesis of Bile Acids in Cerebrotendinous Xanthomatosis Relationship of Bile Acid Pool Sizes and Synthesis Rates to Hydroxylations at C-12, C-25, and C-26 Gerald Salen, Sarah Shefer, G. S. rint, G.

More information

Role of the 26-Hydroxylase in the Biosynthesis of Bile Acids in the Normal State and in Cerebrotendinous Xanthomatosis

Role of the 26-Hydroxylase in the Biosynthesis of Bile Acids in the Normal State and in Cerebrotendinous Xanthomatosis Role of the 26-Hydroxylase in the Biosynthesis of Bile Acids in the Normal State and in Cerebrotendinous Xanthomatosis AN IN VIVO STUDY INGEMAR BJbRKHEM, OLAV FAUSA, GUNNAR HOPEN, HELGE OFTEBRO, JAN I.

More information

BIOSYNTHESIS OF STEROID HORMONES

BIOSYNTHESIS OF STEROID HORMONES BIOSYNTHESIS OF STEROID HORMONES Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI sw/steroidrepro/inter/08 1 STEROID HORMONES Progestins (21 C) Glucocorticoids (21 C) Mineralocorticoids

More information

Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol

Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol Oxysterols in the circulation of patients with the Smith-Lemli-Opitz syndrome: abnormal levels of 24S- and 27-hydroxycholesterol Ingemar Björkhem, 1, * Lena Starck,*, Ulla Andersson,* Dieter Lütjohann,*,

More information

Author's personal copy

Author's personal copy Clinica Chimica Acta 411 (2010) 43 48 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim ESI-MS/MS quantification of 7α-hydroxy-4-cholesten-3-one

More information

ab SREBP-2 Translocation Assay Kit (Cell-Based)

ab SREBP-2 Translocation Assay Kit (Cell-Based) ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic

More information

CHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK

CHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK CHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK A dissertation submitted to Kent State University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy

More information

Chapter 4. Drug Biotransformation

Chapter 4. Drug Biotransformation Chapter 4 Drug Biotransformation Drug Biotransformation 1 Why is drug biotransformation necessary 2 The role of biotransformation in drug disposition 3 Where do drug biotransformation occur 4 The enzymes

More information

Different phenotypes in identical twins with Cerebrotendinous Xanthomatosis: case series

Different phenotypes in identical twins with Cerebrotendinous Xanthomatosis: case series Page containing authors Different phenotypes in identical twins with Cerebrotendinous Xanthomatosis: case series Authors: Dénes Zádori 1, László Szpisjak 1, László Madar 2, Viktória Evelin Varga 3, Bernadett

More information

2 The abbreviations used are: SREBP, sterol regulatory element-binding protein;

2 The abbreviations used are: SREBP, sterol regulatory element-binding protein; THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 3, pp. 1445 1455, January 18, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Effectors of Rapid Homeostatic

More information

Cytochrome P 450 Unique family of heme proteins present in bacteria, fungi, insects, plants, fish, mammals and primates. Universal oxygenases (oxygen-

Cytochrome P 450 Unique family of heme proteins present in bacteria, fungi, insects, plants, fish, mammals and primates. Universal oxygenases (oxygen- Cytochrome P 450 Biochemistry Department Cytochrome P 450 Unique family of heme proteins present in bacteria, fungi, insects, plants, fish, mammals and primates. Universal oxygenases (oxygen-utilizing

More information

MCB130 Midterm. GSI s Name:

MCB130 Midterm. GSI s Name: 1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

More information

26-Hydroxycholesterol: regulation of hydroxymethylglutaryl-coa reductase activity in Chinese hamster ovary cell culture

26-Hydroxycholesterol: regulation of hydroxymethylglutaryl-coa reductase activity in Chinese hamster ovary cell culture 26-Hydroxycholesterol: regulation of hydroxymethylglutaryl-coa reductase activity in Chinese hamster ovary cell culture Abbie L. Esterman,' Howard Baum, Norman B. Javitt, and Gretchen J. Darlington2 Division

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

Cerebrotendinous xanthomatosis (a rare lipid storage disorder): a case report

Cerebrotendinous xanthomatosis (a rare lipid storage disorder): a case report Razi et al. Journal of Medical Case Reports (2016) 10:103 DOI 10.1186/s13256-016-0882-y CASE REPORT Open Access Cerebrotendinous xanthomatosis (a rare lipid storage disorder): a case report Syed Mohd Razi

More information

On the importance of albumin binding for the flux of 7α-hydroxy-3-oxo-4-cholestenoic acid in the brain.

On the importance of albumin binding for the flux of 7α-hydroxy-3-oxo-4-cholestenoic acid in the brain. On the importance of albumin binding for the flux of 7α-hydroxy-3-oxo-4-cholestenoic acid in the brain. Ahmed A. Saeed 1,2*, Erik Edström 3*, Irina Pikuleva 4, Gösta Eggertsen 1 and Ingemar Björkhem 1#

More information

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital

More information

Mechanism of degradation of the steroid side chain in the formation of bile acids

Mechanism of degradation of the steroid side chain in the formation of bile acids , Mechanism of degradation of the steroid side chain in the formation of bile acids Ingemar Bjorkhem Department of Clinical Chemistry, Karolinska Institute, Huddinge Hospital, Huddinge, Sweden Introduction

More information

Biologic Oxidation BIOMEDICAL IMPORTAN

Biologic Oxidation BIOMEDICAL IMPORTAN Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron

More information

Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of Medicine, P. O. Box 95, Rootstown, OH 44272

Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of Medicine, P. O. Box 95, Rootstown, OH 44272 [Frontiers in Bioscience 3, d176-193, February 15, 1998] REGULATION OF BILE ACID SYNTHESIS John Y. L. Chiang Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of

More information

Cholesterol 25-hydroxylation activity of CYP3A

Cholesterol 25-hydroxylation activity of CYP3A Cholesterol 25-hydroxylation activity of CYP3A Akira Honda, *,, Teruo Miyazaki,, Tadashi Ikegami, * Junichi Iwamoto, * Tomomi Maeda, ** Takeshi Hirayama, * Yoshifumi Saito, * Tamio Teramoto, ** and Yasushi

More information

Cholesterol Metabolism

Cholesterol Metabolism Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000

More information

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

More information

Commentary. New mechanisms by which statins lower plasma cholesterol. Henri Brunengraber

Commentary. New mechanisms by which statins lower plasma cholesterol. Henri Brunengraber Commentary New mechanisms by which statins lower plasma cholesterol Henri Brunengraber Department of Nutrition Case Western Reserve University Cleveland, OH 44109 Phone: 216 368 6429 Fax: 216 368 6560

More information

Bile Acid Synthesis in Cultured Human Hepatocytes: Support for an Alternative Biosynthetic Pathway to Cholic Acid

Bile Acid Synthesis in Cultured Human Hepatocytes: Support for an Alternative Biosynthetic Pathway to Cholic Acid Bile Acid Synthesis in Cultured Human Hepatocytes: Support for an Alternative Biosynthetic Pathway to Cholic Acid MAGNUS AXELSON, 1 EWA ELLIS, 2 BIRGITTA MÖRK, 1 KRISTINA GARMARK, 1 ANNA ABRAHAMSSON, 2

More information

Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015

Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 The major site of acetoacetate and 3-hydorxybutyrate production is the liver. They are preferred substrates for myocardiocytes

More information

Regulating Hepatic Cellular Cholesterol

Regulating Hepatic Cellular Cholesterol Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce

More information

B. G. Wolthers, I.* H. T. Walrecht,* J. C. van der Molen,* G. T. Nagel,* J. J. Van Doormaa1,t and P. N. Wijnandts**

B. G. Wolthers, I.* H. T. Walrecht,* J. C. van der Molen,* G. T. Nagel,* J. J. Van Doormaa1,t and P. N. Wijnandts** Use of determinations of 7-lathosterol (5a-cholest-7-en-3P-ol) and other cholesterol precursors in serum in the study and treatment of disturbances of sterol metabolism, particularly cerebrotendinous xanthomatosis

More information

Using the Organic Acids Test Part 5 Dr. Jeff Moss

Using the Organic Acids Test Part 5 Dr. Jeff Moss Using organic acids to resolve chief complaints and improve quality of life in chronically ill patients Part V Jeffrey Moss, DDS, CNS, DACBN jeffmoss@mossnutrition.com 413-530-08580858 (cell) 1 Summer

More information

The role of cholestanol in the pathogenesis of cholesterol gallstones. Review: Hypothesis and Conception (1991)

The role of cholestanol in the pathogenesis of cholesterol gallstones. Review: Hypothesis and Conception (1991) The role of cholestanol in the pathogenesis of cholesterol gallstones. Review: Hypothesis and Conception (1991) Jacob L. Turumin Department of Experimental Surgery, Irkutsk Institute of Surgery, Scientific

More information

Chemical Classification of Hormones

Chemical Classification of Hormones Steroid Hormones Chemical Classification of Hormones Hormones are chemical messengers that transport signals from one cell to another There are 4 major chemical classes of hormones steroid hormones - i.e.

More information

Objectives By the end of lecture the student should:

Objectives By the end of lecture the student should: Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.

More information

STUDIES ON REGULATORY MECHANISMS BEHIND ITS FORMATION IN THE BRAIN AND ITS POTENTIAL USE AS A MARKER FOR NEURODEGENERATION

STUDIES ON REGULATORY MECHANISMS BEHIND ITS FORMATION IN THE BRAIN AND ITS POTENTIAL USE AS A MARKER FOR NEURODEGENERATION Thesis for doctoral degree (Ph.D.) 2010 Thesis for doctoral degree (Ph.D.) 2010 24S-HYDROXYCHOLESTEROL Marjan Shafaati 24S-HYDROXYCHOLESTEROL. STUDIES ON REGULATORY MECHANISMS BEHIND ITS FORMATION IN THE

More information

Anaesthesia recommendations for patients suffering from Cerebrotendinous xanthomatosis

Anaesthesia recommendations for patients suffering from Cerebrotendinous xanthomatosis orphananesthesia Anaesthesia recommendations for patients suffering from Cerebrotendinous xanthomatosis Disease name: Cerebrotendinous xanthomatosis ICD 10: E75.5 Synonyms: cerebrotendinous xanthomatosis,

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

XTreme 200 Human Liver Microsomes Lot No Human Liver Microsomes Pool of 200 (100 Male and 100 Female) Suspension medium: 250 mm sucrose

XTreme 200 Human Liver Microsomes Lot No Human Liver Microsomes Pool of 200 (100 Male and 100 Female) Suspension medium: 250 mm sucrose XTreme 200 Human Liver Microsomes Lot No. 1710084 Human Liver Microsomes Pool of 200 (100 Male and 100 Female) Suspension medium: 250 mm sucrose H2610 0.5 ml at 20 mg/ml H2620 1.0 ml at 20 mg/ml H2630

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 18 Done by Mahmoud Harbi Corrected by حسام أبو عوض Doctor Nayef Karadsheh Sources of Reactive Oxygen Species (ROS) 1 P a g e 1- Oxidases: there are some that produce hydrogen peroxide (H₂O₂) 2-

More information

Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus

Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus Christopher M. Valdez 1, Clyde F. Phelix 1, Mark A. Smith 3, George Perry 1,2, and Fidel Santamaria

More information

SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY

SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY 1 SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR: SEX HORMONES PART 1 An Overview What are steroid hormones? Steroid

More information

Moh Tarek + Faisal Massad. Tala Saleh ... Naif

Moh Tarek + Faisal Massad. Tala Saleh ... Naif 19 Moh Tarek + Faisal Massad Tala Saleh... Naif Last lecture we ve talked about the main antioxidant system which are the enzymes found in our body, mainly: 1. Glutathione peroxidase 2. Super oxide dismutase(sod)

More information

number Done by Corrected by Doctor Faisal Al-Khatib

number Done by Corrected by Doctor Faisal Al-Khatib number 22 Done by Baraa Ayed Corrected by Yaseen Fatayer Doctor Faisal Al-Khatib 1 P a g e Today we are going to cover these concepts: Oxidation of odd number fatty acids Oxidation of very long fatty acids

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship

More information

Mechanism of Detoxification

Mechanism of Detoxification Mechanism of Detoxification Prof.Dr. Hedef Dhafir El-Yassin 1 Objectives: 1. To list the detoxification pathways 2. To describe detoxification pathways and phases in the liver, 2 3 4 o Xenobiotics are

More information

Occurrence of isomeric dehydrocholesterols in human plasma

Occurrence of isomeric dehydrocholesterols in human plasma Occurrence of isomeric dehydrocholesterols in human plasma Magnus Axelson' Department of Clinical Chemistry, Karolinska Hospital, S-104 01 Stockholm, Sweden Abstract Three isomeric dehydrocholesterols

More information

Bile acid metabolism. doc. Ing. Zenóbia Chavková, CSc.

Bile acid metabolism. doc. Ing. Zenóbia Chavková, CSc. Bile acid metabolism doc. Ing. Zenóbia Chavková, CSc. Bile acid metabolism Importance: Availability for fat & cholesterol absorption Regulates total body pool of cholesterol Factors that synthesis promote

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis

Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis Denis POMPON Laboratoire d Ingénierie des Protéines Membranaires CGM CNRS Gif sur Yvette, France.

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

Discussion of Prism modules and predicted interactions (Fig. 4)

Discussion of Prism modules and predicted interactions (Fig. 4) SUPPLEMENTARY NOTES Discussion of Prism modules and predicted interactions (Fig. 4) a. Interactions of the TCA-cycle, respiratory chain, and ATP synthetase with the amino acid biosynthesis modules. Given

More information

CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005

CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 Name Dr. H. White - Instructor There are 8 pages to this examination including this page. In addition, you will get a metabolic

More information

CHOLBAM (cholic acid) oral capsule

CHOLBAM (cholic acid) oral capsule CHOLBAM (cholic acid) oral capsule Coverage for services, procedures, medical devices and drugs are dependent upon benefit eligibility as outlined in the member's specific benefit plan. This Pharmacy Coverage

More information

Ingemar Bjorkhem, Helge Oftebro, Sverre Skrede, and Jan I. Pedersen

Ingemar Bjorkhem, Helge Oftebro, Sverre Skrede, and Jan I. Pedersen Assay of intermediates in bile acid biosynthesis using isotope dilution-mass spectrometry: hepatic levels in the normal state and in cerebrotendinous xanthomatosis Ingemar Bjorkhem, Helge Oftebro, Sverre

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming

More information

Hisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo

Hisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo Workshop Argentina-Japan Bioscience and Biotechnology for the Promotion of Agriculture and Food Production -August 3rd to 7th 2009- Hisanori Kato Endowed Chair of Food for Life Organization for Interdisciplinary

More information

STEROL 27-HYDROXYLASE IS a mitochondrial P450 enzyme

STEROL 27-HYDROXYLASE IS a mitochondrial P450 enzyme 0013-7227/00/$03.00/0 Vol. 141, No. 11 Endocrinology Printed in U.S.A. Copyright 2000 by The Endocrine Society Cholestenoic Acid Is a Naturally Occurring Ligand for Liver X Receptor * CHING SONG AND SHUTSUNG

More information

Cytochrome P450s in humans Feb. 4, 2009

Cytochrome P450s in humans Feb. 4, 2009 Cytochrome P450s in humans Feb. 4, 2009 David Nelson (last modified Jan. 4, 2009) Reading (optional) Nelson D.R. Cytochrome P450 and the individuality of species. (1999) Arch. Biochem. Biophys. 369, 1-10.

More information

Fonnation of Bile Acids in Man: Conversion of Cholesterol into 53-Cholestane-3a,7a, 12a-triol in Liver Homogenates *

Fonnation of Bile Acids in Man: Conversion of Cholesterol into 53-Cholestane-3a,7a, 12a-triol in Liver Homogenates * Fonnation of Bile Acids in Man: Conversion of Cholesterol into 53-Cholestane-3a,7a, 12a-triol in Liver Homogenates * INGEMAR BJORKHEM, HENRY DANIELSSON, KuRT EINARSSON, and GUNNAR JOHANSSON From the Department

More information

A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis

A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis A point mutation in the bile acid biosynthetic enzyme sterol 27-hydroxylase in a family with cerebrotendinous xanthomatosis Naoki Nakashima, Yoshiyuki Sakai, Hironori Sakai, Toshihiko Yanase, Masafumi

More information

CARBOHYDRATE METABOLISM 1

CARBOHYDRATE METABOLISM 1 CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2

More information

Fatty acids synthesis

Fatty acids synthesis Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

More information

Cholesterol is an essential component of mammalian cell

Cholesterol is an essential component of mammalian cell Brief Reviews Intracellular Cholesterol Transport Raymond E. Soccio, Jan L. Breslow Abstract Intracellular cholesterol transport is essential for the maintenance of cholesterol homeostasis. Many aspects

More information

Bile acid abnormalities in peroxisomal disorders

Bile acid abnormalities in peroxisomal disorders Bile acid abnormalities in peroxisomal disorders Sacha Ferdinandusse Lab. Genetic Metabolic Diseases Academic Medical Center Amsterdam Peroxisomes play an important role in bile acid biosynthesis Bile

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Epidemiology, diagnosis, and treatment of cerebrotendinous xanthomatosis (CTX)

Epidemiology, diagnosis, and treatment of cerebrotendinous xanthomatosis (CTX) J Inherit Metab Dis (2017) 40:771 781 DOI 10.1007/s10545-017-0093-8 REVIEW Epidemiology, diagnosis, and treatment of cerebrotendinous xanthomatosis (CTX) Gerald Salen 1 & Robert D. Steiner 2,3 Received:

More information

CHOLBAM (cholic acid) oral capsule

CHOLBAM (cholic acid) oral capsule CHOLBAM (cholic acid) oral capsule Coverage for services, procedures, medical devices and drugs are dependent upon benefit eligibility as outlined in the member's specific benefit plan. This Pharmacy Coverage

More information

Structural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis

Structural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis Structural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis Magnus Axelson, * Olle Larsson, t Jie Zhang,t * Junichi Shoda: * and Jan Sjovall*

More information

Technical Report. Sugar and Sterol Analysis in Human Body Fluids on a True Dual Column GCMS System. 1. Summary. 2. Introduction

Technical Report. Sugar and Sterol Analysis in Human Body Fluids on a True Dual Column GCMS System. 1. Summary. 2. Introduction C146-E151A Technical Report Sugar and Sterol Analysis in Human Body Fluids on a True Dual Column GCMS System Fokje S.M. Zijlstra 1, Leo A.J. Kluijtmans 1, and Mark H.P.M. van Lieshout 2 1. Summary Being

More information

Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry

Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry Determination of 24S- and 27-hydroxycholesterol in plasma by high-performance liquid chromatography-mass spectrometry methods Ines Burkard, Katharina M. Rentsch, 1 and Arnold von Eckardstein Institute

More information

Side chain hydroxylation of C,,-steroids and vitamin D3 by a cytochrome P-450 enzyme system isolated from human liver mitochondria

Side chain hydroxylation of C,,-steroids and vitamin D3 by a cytochrome P-450 enzyme system isolated from human liver mitochondria Side chain hydroxylation of C,,-steroids and vitamin D3 by a cytochrome P-450 enzyme system isolated from human liver mitochondria Helge Oftebro, Kristin Saarem, Ingemar Bjorkhem, and Jan I. Pedersen'

More information

Hormonal effects of prohormones in bovines

Hormonal effects of prohormones in bovines Hormonal effects of prohormones in bovines Jeroen Rijk Supervisors: Michel Nielen, Maria Groot and Ad Peijnenburg RIKILT Institute of Food Safety, Wageningen UR WT Theme 3 Introduction Prohormone = A chemical

More information

Cerebrotendinous xanthomatosis with cholestanolaemia - involvement of five individuals in a Malay family

Cerebrotendinous xanthomatosis with cholestanolaemia - involvement of five individuals in a Malay family Med. J. Malaysia Vol. 45 No. 4 December 1990 Cerebrotendinous xanthomatosis with cholestanolaemia - involvement of five individuals in a Malay family NorHayati Othman, MBBS, M.Path Lecturer Sabariah Abdul

More information

by either cholesterol or cholestyramine feeding. J.

by either cholesterol or cholestyramine feeding. J. Alternate pathways of bile acid synthesis in the cholesterol 7 -hydroxylase knockout mouse are not upregulated by either cholesterol or cholestyramine feeding Margrit Schwarz, 1, * David W. Russell,* John

More information

Problem Set #5 4/3/ Spring 02

Problem Set #5 4/3/ Spring 02 Question 1 Chloroplasts contain six compartments outer membrane, intermembrane space, inner membrane, stroma, thylakoid membrane, and thylakoid lumen each of which is populated by specific sets of proteins.

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

Cholesterol metabolism Ι

Cholesterol metabolism Ι Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different

More information

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

More information

Name Class Date. 1. Cellular respiration is the process by which the of "food"

Name Class Date. 1. Cellular respiration is the process by which the of food Name Class Date Cell Respiration Introduction Cellular respiration is the process by which the chemical energy of "food" molecules is released and partially captured in the form of ATP. Carbohydrates,

More information

These are example problems, which are similar to those you may see on the final exam.

These are example problems, which are similar to those you may see on the final exam. MCB102 / Metabolism Problem Set #3 Spring 2008 These are example problems, which are similar to those you may see on the final exam. QUESTION 1: /. Circle the correct answer, but if the answer is provide

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Peroxisomes and bile acid biosynthesis

Peroxisomes and bile acid biosynthesis Biochimica et Biophysica Acta 1763 (2006) 1427 1440 www.elsevier.com/locate/bbamcr Review Peroxisomes and bile acid biosynthesis Sacha Ferdinandusse, Sander M. Houten Laboratory Genetic Metabolic Diseases,

More information

Schoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins

Schoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins Research article Schoenheimer effect explained feedback regulation of cholesterol synthesis in mice mediated by Insig proteins Luke J. Engelking, 1 Guosheng Liang, 1 Robert E. Hammer, 2 Kiyosumi Takaishi,

More information

Integration Of Metabolism

Integration Of Metabolism Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal

More information