Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus

CORRECTION NOTICE. Nat. Chem. Biol. 11, (2015) Sterol metabolism controls T H 17 differentiation by generating endogenous RORγ agonists

CORRECTION NOTICE Nat. Chem. Biol. 11, 141 147 (2015) Sterol metabolism controls T H 17 differentiation by generating endogenous RORγ agonists Xiao Hu, Yahong Wang, Ling-Yang Hao, Xikui Liu, Chuck A Lesch,

Simvastatin Modulates the Alzheimer s Disease-Related Gene seladin-1

Journal of Alzheimer s Disease 28 (2012) 1 5 IOS Press 1 Supplementary Data Simvastatin Modulates the Alzheimer s Disease-Related Gene seladin-1 Maria C. Ramos, Saleta Sierra, Carlos Ramirez, Javier Velasco

Cholesterol synthesis pathway genes in prostate cancer are transcriptionally downregulated when tissue confounding is minimized

Rye et al. BMC Cancer (2018) 18:478 https://doi.org/10.1186/s12885-018-4373-y RESEARCH ARTICLE Cholesterol synthesis pathway genes in prostate cancer are transcriptionally downregulated when tissue confounding

Proteomics in Multi-omics Workflows Using Yeast as a Model System

Proteomics in Multi-omics Workflows Using Yeast as a Model System Application Note Authors Christine A. Miller, Stefan Jenkins, Theodore R. Sana, and Steven M. Fischer Agilent Technologies, Inc. Santa

Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis

Reconstruction in yeast of human steroid metabolic pathway as a tool for drug discovery and biosynthesis Denis POMPON Laboratoire d Ingénierie des Protéines Membranaires CGM CNRS Gif sur Yvette, France.

Supplementary Figure 1: Detailed schematic of the synthetic biochemistry system for the conversion of glucose to monoterpenes.

Supplementary Figure 1: Detailed schematic of the synthetic biochemistry system for the conversion of glucose to monoterpenes. Glycolytic and mevalonate enzymes are highlighted in blue and orange respectively.

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

Controlling Cholesterol Synthesis beyond 3-Hydroxy-3-methylglutaryl-CoA Reductase (HMGCR) *

MINIREVIEW THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 26, pp. 18707 18715, June 28, 2013 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Controlling

Summary of fatty acid synthesis

Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty

Supplemental Table 1: List of genes contained on the custom Steroltalk v2 microarray prepared for this study

Supplemental Table 1: List of genes contained on the custom Steroltalk v2 microarray prepared for this study Gene GenBank No. Description Ch25h NM_009890 Cholesterol 25-hydroxylase Bile acid synthesis

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

Cholesterol: Biosynthesis, Functional Diversity, Homeostasis and Regulation by Natural Products

18 Cholesterol: Biosynthesis, Functional Diversity, Homeostasis and Regulation by Natural Products J. Thomas 1, T.P. Shentu 1 and Dev K. Singh 2* 1 Department of Medicine, University of Illinois, Chicago

Cholesterol Metabolism

Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000

Identification of peroxisomal targeting signals in cholesterol biosynthetic enzymes: AA-CoA thiolase, HMG-CoA synthase, MPPD, and FPP synthase

Identification of peroxisomal targeting signals in cholesterol biosynthetic enzymes: AA-CoA thiolase, HMG-CoA synthase, MPPD, and FPP synthase Lisa M. Olivier, Werner Kovacs, Kim Masuda, Gilbert-Andre

Global Tudor-SN transgenic mice are protected from obesity-induced hepatic steatosis and insulin resistance

THE JOURNAL RESEARCH www.fasebj.org Global Tudor-SN transgenic mice are protected from obesity-induced hepatic steatosis and insulin resistance Xinting Wang,*,,, Lingbiao Xin,*,,, Zhongchao Duan,*,,, Zhiyu

CLINICAL BIOCHEMISTRY - 5 LIPID METABOLISM

CLINICAL BIOCHEMISTRY - 5 LIPID METABOLISM DIGESTIVE MECHANISM FOR LIPIDS The average lipid intake is about 80g/day, of which more than 90% is triacylglycerol (TAG); the remainder consists of cholesterol,

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015

Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 The major site of acetoacetate and 3-hydorxybutyrate production is the liver. They are preferred substrates for myocardiocytes

Metabolic Profiling of Yeast Sterols Using the Agilent 7200 Series GC/Q-TOF System

Metabolic Profiling of Yeast Sterols Using the Agilent 7200 Series GC/Q-TOF System Application Note Metabolomics Authors Manhong Wu, Robert St. Onge, Sundari Suresh, Ronald Davis, and Gary Peltz School

Table S1 Analytical Characteristics for all sterols shown in the biosynthesis figure S1

Table S1 Analytical Characteristics for all sterols shown in the biosynthesis figure S1 Code Trivial name CAS number Chemical formula M R M R (TMS) RRT (cholestane) 1 * 2 * Hexamethyl-tetracosa-2,6,10,14,18,22-

Cholesterol metabolism Ι

Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different

FATTY ACID SYNTHESIS

FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.

MBB 694:407, 115:511 Name Third Exam Niederman, Deis. Please use BLOCK CAPITAL letters like this --- A, B, C, D, E. Not lowercase!

MBB 694:407, 115:511 Name Third Exam Niederman, Deis Wed. Nov. 22, 2006 Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth two points.

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

Please use BLOCK CAPITAL letters like this --- A, B, C, D, E. Not lowercase! 1. E 10. D 19. E 2. D 11. A 20. A 3. D 12. D 21. A 4. D 13. A 22.

Molecular Biology and Biochemistry 694:407/115:511 Third Exam Deis Niederman Wednesday, November 22, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of

Chapter 19: Lipid Metabolism

1 hapter 19: Lipid Metabolism Triacylglycerols = triglycerides = fats - Triacylglycerols are the major biological energy source, which are water insoluble. Glycogen is also biological energy source, but

review Sterols in spermatogenesis and sperm maturation Rok Keber, * Damjana Rozman, and Simon Horvat 1, *,

Sterols in spermatogenesis and sperm maturation review Rok Keber, * Damjana Rozman, and Simon Horvat 1, *, Department of Animal Science,* Biotechnical Faculty, University of Ljubljana, Groblje 3, 1230

UCL INSTITUTE OF NEUROLOGY DCEE. HNF1B and the brain

UCL INSTITUTE OF NEUROLOGY DCEE HNF1B and the brain Sanjay Sisodiya Department of Clinical and Experimental Epilepsy UCL Institute of Neurology National Hospital for Neurology and Neurosurgery, Queen Square

STUDIES ON THE REGULATORY ROLES OF CHOLESTEROL AND BILE ACIDS

From the Department of Laboratory Medicine, Division of Clinical Chemistry Karolinska Institutet, Stockholm, Sweden STUDIES ON THE REGULATORY ROLES OF CHOLESTEROL AND BILE ACIDS Charlotte Murphy Stockholm

Chapter 26: Lipids. Hydrophobic (non-polar, soluble in organic solvent), typically of low molecular compound or organic origin

hapter 26: Lipids. ydrophobic (non-polar, soluble in organic solvent), typically of low molecular compound or organic origin fatty acids and waxes essential oils many vitamins hormones (non-peptide) components

Sample mid-quarter exam 1 (winter 2015)

Chemistry 256 Sample mid-quarter exam 1 (winter 2015) 1. Which one of the following processes is not stimulated by insulin? a. Glucose uptake in muscle (t-j1.7f '-''";r ) b. Dephosphorylation of glycogen

October 19, 1970 (Date)

GERALD SPRINGER ADAMS (Name of student) AN ABSTRACT OF THE THESIS OF in Biochemistry presented on (Major) for the Ph. D. (Degree) October 19, 1970 (Date) Title: ISOPRENOIDS OF BOVINE AORTA: ISOLATION,

Københavns Universitet

university of copenhagen Københavns Universitet Expression and Localization of micrornas in Perinatal Rat Pancreas Larsen, Louise; Rosenstierne, Maiken Worsøe; Gaarn, Louise Winkel; Bagge, Annika; Pedersen,

Inhibition of Human Sterol 7 -Reductase and Other Postlanosterol Enzymes by LK-980, a Novel Inhibitor of Cholesterol Synthesis S

Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2010/10/15/dmd.110.035840.dc1 0090-9556/11/3901-39 46$20.00 DRUG METABOLISM AD DISPOSITIO Vol. 39, o. 1

The aryl hydrocarbon receptor (AhR) is a

Aryl Hydrocarbon Receptor Regulates the Cholesterol Biosynthetic Pathway in a Dioxin Response Element-Independent Manner Rachel Tanos, Rushang D. Patel, Iain A. Murray, Philip B. Smith, Andrew D. Patterson,

Metabolism of lipids. Szerkesztette: Fekete Veronika

Metabolism of lipids Transport of free fatty acid in the plasma ketone bodies C 2 + H 2 phospholipid synthesis Ac-CoA FFA oxidation ketone bodies FREE FATTY ACID (FFA) fatty acid-albumin triacyl glycerol

Lecture: 26 OXIDATION OF FATTY ACIDS

Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty

INTRODUCTORY BIOCHEMISTRY. BI 28 Second Midterm Examination April 3, 2007

INTRODUCTORY BIOCHEMISTRY BI 28 Second Midterm Examination April 3, 2007 Name SIS # Make sure that your name or SIS # is on every page. This is the only way we have of matching you with your exam after

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

in peroxisomal-deficient Pex2 CHO cell lines. J.

Analysis of isoprenoid biosynthesis in peroxisomal-deficient Pex2 CHO cell lines Nahla Aboushadi and Skaidrite K. Krisans 1 Department of Biology, San Diego State University, San Diego, CA 92182 Abstract

Transposition of animal and plant biosynthetic pathways in yeast cells

Transposition of animal and plant biosynthetic pathways in yeast cells FROM SUCCESSES TO CHALLENGES Denis POMPON Centre National de la Recherche Scientifique CGM Gif-sur-Yvette & LISBP Toulouse denis.pompon@insa-toulouse.fr

Original Article Identification of candidate genes associated with Xiang pig estrus by genome-wide transcriptome analysis

Int J Clin Exp Med 2018;11(11):12079-12087 www.ijcem.com /ISSN:1940-5901/IJCEM0070285 Original Article Identification of candidate genes associated with Xiang pig estrus by genome-wide transcriptome analysis

Naturally occurring compounds that are typically of low molecular weight and are hydrophobic (soluble in organic solvent).

hapter 27. Biomolecules: Lipids aturally occurring compounds that are typically of low molecular weight and are hydrophobic (soluble in organic solvent). fatty acids and waxes essential oils many vitamins

Integrative pathway dissection of molecular mechanisms of moxldl-induced vascular smooth muscle phenotype transformation

Karagiannis et al. BMC Cardiovascular Disorders 2013, 13:4 RESEARCH ARTICLE Open Access Integrative pathway dissection of molecular mechanisms of moxldl-induced vascular smooth muscle phenotype transformation

Zocor versus lipitor liver enzymes

Zocor versus lipitor liver enzymes 09/02/2018 7zip command line zip directory 09/02/2018 Mixing xanax with oxycodone 09/02/2018 -Icd 10 code compression fracture l3 -Super smash flash 2 v0.9 unblocked

Markedly Inhibited 7-Dehydrocholesterol-A7-Reductase Activity in Liver

Markedly Inhibited 7-Dehydrocholesterol-A7-Reductase Activity in Liver Microsomes from Smith-Lemli-Opitz Homozygotes Sarah Shefer,* Gerald Salen,** A. K. Batta,* A. Honda,* G. S. Tint,*" Mira Irons, Ellen

Cholesterol biosynthesis

D.E. Vance and J.E. Vance (Eds.) Biochemisn 3' ~f Lipids, l.il~ol~;otein.~ aml Memhranes (4th Edit.) ~; 2002 Elsevier Science B.V. All rights reserved CHAPTER 15 Cholesterol biosynthesis Laura Liscum Department

From Cholesterogenesis to Steroidogenesis: Role of Riboflavin and Flavoenzymes in the Biosynthesis of Vitamin D 1,2

REVIEW From Cholesterogenesis to Steroidogenesis: Role of Riboflavin and Flavoenzymes in the Biosynthesis of Vitamin D 1,2 John T. Pinto* and Arthur J. L. Cooper Department of Biochemistry and Molecular

CELLULAR RESPIRATION SUMMARY EQUATION. C 6 H 12 O 6 + O 2 6CO2 + 6H 2 O + energy (ATP) STEPWISE REDOX REACTION

CELLULAR RESPIRATION SUMMARY EQUATION C 6 H 12 O 6 + O 2 6CO2 + 6H 2 O + energy (ATP) STEPWISE REDOX REACTION Oxidation: partial or complete loss of electrons Reduction: partial or complete gain of electrons

Production Management: New Lessons from Biology. James E. Metherall, Ph.D., M.B.A. Associate Professor of Human Genetics University of Utah

Production Management: New Lessons from Biology James E. Metherall, Ph.D., M.B.A. Associate Professor of Human Genetics University of Utah Major Points 1) Metabolic Regulation is an Extremely Complex Operations

Oxidative Phosphorylation

Oxidative Phosphorylation Oxidative Phosphorylation - In Glycolysis and the citric acid cycle, we ve made a lot of reduced cofactors NADH and FADH 2 - In oxidative phosphorylation, we use the energy generated

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

Biomarkers of NAFLD progression an omics approach to an epidemic

Biomarkers of NAFLD progression an omics approach to an epidemic D. Lee Gorden 1,2, David S. Myers 3, Pavlina T. Ivanova 3, Eoin Fahy 4, Mano R. Maurya 4, Shakti Gupta 4, Jun Min 4, Nathanael J. Spann

New Drug Targets. Sean T. Prigge, PhD

This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh

Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

Inhibition of human sterol delta 7-reductase and other post-lanosterol enzymes by 2-(4-

DMD Fast This Forward. article has not Published been copyedited on and October formatted. 15, The 2010 final version as doi:10.1124/dmd.110.035840 may differ from this version. DMD # 35840 Title Inhibition

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

Novel bisphosphonates as inhibitors of isoprenoid biosynthesis

University of Iowa Iowa Research Online Theses and Dissertations 2011 Novel bisphosphonates as inhibitors of isoprenoid biosynthesis Brian M. Wasko University of Iowa Copyright 2011 Brian M Wasko This

number Done by Corrected by Doctor Faisal Al-Khatib

number 22 Done by Baraa Ayed Corrected by Yaseen Fatayer Doctor Faisal Al-Khatib 1 P a g e Today we are going to cover these concepts: Oxidation of odd number fatty acids Oxidation of very long fatty acids

number Done by Corrected by Doctor Faisal Al- Khateeb

number 21 Done by Omar Sami Corrected by حسام أبو عوض Doctor Faisal Al- Khateeb 1 P a g e (Only one or two marks are allocated for this sheetin the exam). Through this lecture we are going to cover the

Biosynthesis of Fatty Acids

Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

Hisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo

Workshop Argentina-Japan Bioscience and Biotechnology for the Promotion of Agriculture and Food Production -August 3rd to 7th 2009- Hisanori Kato Endowed Chair of Food for Life Organization for Interdisciplinary

Disorders of cholesterol biosynthesis: prototypic metabolic malformation syndromes

Human Molecular Genetics, 2003, Vol. 12, Review Issue 1 DOI: 10.1093/hmg/ddg072 R75 R88 Disorders of cholesterol biosynthesis: prototypic metabolic malformation syndromes Gail E. Herman* Center for Molecular

Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX

Bile acids and the brain. Suggested pathogenetic mechanism in connection with formation of brain xanthomas in patients with CTX Ingemar Björkhem, Marjan Shafaati, Ulla Andersson, Ute Panzenboeck, Magnus

Cholesterol in brain disease: sometimes determinant and frequently implicated

Review Cholesterol in brain disease: sometimes determinant and frequently implicated Mauricio G Martín 1,*, Frank Pfrieger 2,** & Carlos G Dotti 3,*** Abstract Cholesterol is essential for neuronal physiology,

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

UNCORRECTED PROOF. Mevalonate Pathway. Introduction

Mevalonate Pathway Heidrun Karlic, Ludwig Boltzmann Cluster Oncology, Hanusch Hospital, Vienna, Austria Franz Varga, Hanusch Hospital of WGKK and AUVA Trauma Centre Meidling, Vienna, Austria 2017. Email

Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia

REVIEW Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia Jerzy Bełtowski Department of Pathophysiology, Medical University, Lublin, Poland Keywords Atherosclerosis; Lipogenesis; Liver X receptor;

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:

BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures

Lecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation

Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies

Metabolic variables of cholesterol during squalene feeding in humans: comparison with cholestyramine treat mentl

Metabolic variables of cholesterol during squalene feeding in humans: comparison with cholestyramine treat mentl T. E. Strandberg, R. S. Tilvis, and T. A. Miettinen Second Department of Medicine, University

Synthesis and degradation of fatty acids Martina Srbová

Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids

The human liver secretes approximately 1gofcho- Diosgenin-Induced Biliary Cholesterol Secretion in Mice Requires Abcg8

Diosgenin-Induced Biliary Cholesterol Secretion in Mice Requires Abcg8 Astrid Kosters, 1 Raoul J. J. M. Frijters, 1 Cindy Kunne, 1 Edwin Vink, 1 Marit S. Schneiders, 2 Frank G. Schaap, 1 Catherina P. Nibbering,

Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth

Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth Michael S. Brown and Joseph L. Goldstein Departments of Molecular Genetics and

incorporation into fructose-6-phosphate and glucose-6-phosphate (F6P/G6P); 2-

Relative abundance (%) Relative abundance (%) Relative abundance (%) Relative abundance (%) 100% 80% 60% 40% F6P / G6P M+0 M+1 M+2 M+3 M+4 M+5 M+6 100% 80% 60% 40% 2PG / 3PG M+0 M+1 M+2 M+3 20% 20% 0%

UKnowledge. University of Kentucky. Li Li University of Kentucky, Recommended Citation

University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2006 HEPATIC CYTOCHROME P450 REDUCTASE-NULL MICE AS AN ANIMAL MODEL TO STUDY ELECTRON TRANSFER PATHWAYS IN

Chapter 4. Drug Biotransformation

Chapter 4 Drug Biotransformation Drug Biotransformation 1 Why is drug biotransformation necessary 2 The role of biotransformation in drug disposition 3 Where do drug biotransformation occur 4 The enzymes

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

ANSC/NUTR 618 Lipids & Lipid Metabolism

I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

4,5,9/99 Neuman Chapter 21

21: Lipids Structures of Lipids Biosynthesis of Lipids Preview Lipids are biological molecules soluble in organic solvents such as alcohols and ethers. They include fats, oils, waxes, terpenes, steroids,

Medical Biochemistry Examination II November 12, 1999 Kresge Auditorium Please follow these directions:

Medical Biochemistry Examination II November 12, 1999 Kresge Auditorium Please follow these directions: 1. Do not begin the exam until all students have received a copy of the exam. You will be instructed

number Done by Corrected by Doctor

number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming

Midterm 2. Low: 14 Mean: 61.3 High: 98. Standard Deviation: 17.7

Midterm 2 Low: 14 Mean: 61.3 High: 98 Standard Deviation: 17.7 Lecture 17 Amino Acid Metabolism Review of Urea Cycle N and S assimilation Last cofactors: THF and SAM Synthesis of few amino acids Dietary

Pragati Choudhri 1, Muniya Rani 1, Rajender S. Sangwan 2, Ravinder Kumar 1, Anil Kumar 1 and Vinod Chhokar 1*

Choudhri et al. BMC Genomics (2018) 19:427 https://doi.org/10.1186/s12864-018-4819-2 RESEARCH ARTICLE Open Access De novo sequencing, assembly and characterisation of Aloe vera transcriptome and analysis

Lipid Biosynthesis. Craig Wheelock February 2nd, 2009 Questions? Comments?

Lipid Biosynthesis Craig Wheelock February 2nd, 2009 Questions? Comments? craig.wheelock@ki.se Why do we care about lipids? ~80% of European population overweight ~ 1/3 obese =130 million obese adults

LIPID METABOLISM

LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

BY: RASAQ NURUDEEN OLAJIDE

BY: RASAQ NURUDEEN OLAJIDE LECTURE CONTENT INTRODUCTION CITRIC ACID CYCLE (T.C.A) PRODUCTION OF ACETYL CoA REACTIONS OF THE CITIRC ACID CYCLE THE AMPHIBOLIC NATURE OF THE T.C.A CYCLE THE GLYOXYLATE CYCLE

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides

Digestion, absorption, and transport of dietary lipids

TG metabolism Utilization of dietary lipids Synthesis in liver and adipose tissue Fatty acid catabolism and synthesis Mobilization of TG to provide energetic needs β-oxidation of fatty acids De novo synthesis

Anaerobic Protist Metabolism

Anaerobic Protist Metabolism Giardia, Entamoeba and Trichomonads Review glycolysis and oxidative decarboxylation Parasite Biochemistry (in general) Parasitic life style = ADAPTATIONS Specific niche = diversity

Optimizing Nutritional Strategies to Promote Growth in Newborns

Optimizing Nutritional Strategies to Promote Growth in Newborns Teresa A. Davis, Ph.D. Professor of Pediatrics USDA/ARS Children s Nutrition Research Center, Baylor College of Medicine, Houston, TX Disclosure

Comparison of catabolic and anabolic pathways

Comparison of catabolic and anabolic pathways Three stages of catabolism Glucose Synthesis of compounds e.g. lactose glycolipids Glucose-6-P Pentosephosphate Pathway Glycolysis Glycogenesis Acetyl-CoA

Syllabus for BASIC METABOLIC PRINCIPLES

Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the

MITOCHONDRIA LECTURES OVERVIEW

1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The

Introduction to Detoxification Enzymes. Evolutionary Response to Chemicals in the Environment

Evolutionary Response to Chemicals in the Environment Introduction to Detoxification Enzymes 1. Introduction to Detoxification enzymes (focusing on cytochrome P450s) 2. Evolutionary response to toxins

* This work was supported by Grant-in-aid Z from the American Heart Association. S

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 34, pp. 29501 29510, August 26, 2011 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Early Growth Response

Introduction to Metabolism Cell Structure and Function

Introduction to Metabolism Cell Structure and Function Cells can be divided into two primary types prokaryotes - Almost all prokaryotes are bacteria eukaryotes - Eukaryotes include all cells of multicellular