Testing for Sickle Cell Disease Caused by a Mutation in the Beta-globin Gene

Transcription

1 Testing for Sickle Cell Disease Caused by a Mutation in the Beta-globin Gene INTRODUCTION: If you knew that a disease like Sickle Cell Anemia ran in your family, would you want to know if you had a mutated copy of the gene? This information may be helpful when you are deciding whether to have children or not. If you and your spouse both have a copy of the mutated gene, there is a one in four chance that your child will inherit the condition. Sickle Cell Anemia (SCA) is a genetically inherited recessive disease. Patients with the disease often have fatigue, enlarged heart and enlarged lymph nodes, susceptibility to viral infections, and pain. Red blood cells in those with SCA have a characteristic halfmoon or sickled appearance when oxygen levels are low in the blood (Figure 1), hence the name of the disease. The sickled shape of the affected red blood cells slows the travel of the red blood cells and as a result, organs and tissues become deprived of oxygen, which can lead to pain, damage to organs, and stroke. Red blood cells (RBCs) that have undergone the sickling process (in response below normal oxygen levels in the blood) are less flexible and break more easily than regular RBCs, leading to anemia. Figure 1. Scanning electron micrograph of normal and sickled red blood cells. On a molecular level it is well understood that SCA is due to a single base pair mutation in one of the hemoglobin genes (beta-globin). Hemoglobin, which is present in red blood cells, carries oxygen to cells in the body. In individuals who suffer from sickle cell anemia, the binding and transport of oxygen is lower than normal. This results in an oxygen deficiency in the patient. In SCA, a nucleotide in the hemoglobin gene has changed from an adenine to a thymine, causing a single amino acid difference in the resulting protein. The original amino acid, glutamate, is large and polar, whereas the mutated amino acid, valine, is smaller and hydrophobic. It turns out that valine-containing hemoglobin protein cannot bind to oxygen very well and the molecule tends to clump together with other hemoglobin molecules. It is these long fibers of hemoglobin that cause the cells to form their characteristic sickled appearance. In the United States, sickle cell anemia is of special interest because it is estimated that 8% of African Americans are carriers of sickle trait (they have one mutated copy and one normal copy). These carriers show no symptoms of sickle cell anemia, but do have a high resistance to the malaria parasite, part of whose life cycle is spent in red blood cells. Historically, sickle cell anemia has provided a selective advantage in some regions of the world, such as parts of Africa. We can test for sickle cell disease and sickle cell trait by doing gel electrophoresis. The beta-globin gene is found on the 11 th chromosome. The mutation that normally characterizes sickle cell is in the middle of a restriction enzyme site for the restriction enzyme MstII. MstII looks for the sequence CCTGAGG in the DNA and cuts there. In the mutated version, the CCTGAGG is changed to CCTGTGG. This means the enzyme will no longer recognize that site and the DNA will no longer be cut. This type of mutation is called a restriction fragment length polymorphism because the mutation affects the length of fragments made by certain restriction enzymes. In this lab, you will be testing for the presence of a mutated gene, the beta-globin gene in two parents and their newborn baby. Your task is to determine whether the child is carrying one mutated copy, two mutated copies, or whether she has two normal copies of the beta-globin gene.

2 Part A: Agarose Gel Preparation 1. Get a piece of masking tape long enough to wrap several times around the gel casting tray. 2. Wrap the tape around the edge of your tray, being sure to press the tape tightly along all the edges and corners. Write your names on the tape. 3. Insert the comb in the notches at the black end of the tray. 4. Place the casting tray in an area where it won t get bumped or moved. 5. Pour the liquid agarose into the casting tray. The total height of the liquid should cover about the height of the comb teeth. You will use about 20 ml of agarose solution. 6. If you see any bubbles, use a micropipette to move the bubbles to an edge of the tray. 7. Allow the gel to solidify. Do not touch or move the gel or the tray until the gel turns from clear to cloudy, which will take about minutes. 8. Once the gel is set, remove the comb, put the gel in the plastic baggy with a little buffer solution, and label it with your name and block so it will be ready for the next class. Part B: The scientists have the following samples of DNA that have been mixed with restriction enzymes in preparation for the next step: Sample A Control DNA that is known to have two mutant copies of the beta-globin gene Sample B Control DNA that is known to be a carrier and have one mutant and one normal copy Sample C Control DNA that is known to have two normal copies of the beta-globin gene Sample D Mother s DNA Sample E Child s DNA Sample F Father s DNA Running the Gels 1. Obtain a gel electrophoresis box and fill it with TE buffer about an inch deep. 2. Cut a small piece off of one corner of your gel. On the diagram below, indicate which corner was cut, and label the wells accordingly. This will help you keep track of which wells will receive which DNA samples. 3. Place the gel tray in the electrophoresis box so that the negative end of the gel tray (where the wells are located) is near the negative black electrode. Why are we orienting the wells toward the negative end of the electrophoresis box? 4. Add more electrophoresis buffer to a level that just covers the entire surface of the gel. Do not overfill with buffer, but do make sure that the wells are completely submerged. If you notice dimples around the wells, add a little more buffer. 5. Set the micropipette to 35 µl. You will load 35 µl of each DNA sample into separate wells. 6. Place the top of the electrophoresis box so that the plugs fit into the leads. Always match red to red, and black to black! DO NOT YET PLUG ANYTHING INTO THE WALL. 7. Check in with your teacher to make sure that everything is set up correctly. Your teacher will help you plug in the box, and set the voltage. 8. Once your box is plugged in, you should see bubbles coming from the wires at the end of the box. This confirms that the power is working. 9. Check your gel in about 10 minutes to see if the dye is moving toward the positive end of the box. Do you see it separating into two colors? We ll leave the gels running for about 75 minutes. Run the gels until the loading dye has traveled 4-8 cm from the wells. Why should the gels NOT run longer than about 75 minutes? 10. Your teacher will disconnect the electricity after about 75 minutes, and will stain the gels overnight, so that you can analyze them. On the next page, label the DNA samples that you loaded onto the gel. Then do the Practice Reading Gels complete the paper lab portion of the lab (both are on a separate page).

3 Part C: Read and Discuss Results 1. Drain off the de-ionized water that was used to rinse your gels. 2. Draw a picture of your results using the gel outline that you labeled last class.

4 Part D: Practice Loading Gels: 1. Obtain a practice loading gel, and using tap water submerge the gel under water. 2. Set a micropipette with a tip on it to 35 µl. 3. Using the practice loading dye (dark green), each person in your group should practice loading 35 µl of this dye into a well of the practice gel. Remember that the loading dye is denser than water, so it will sink into the well you don t need to poke the tip into the well itself. Instead, place the tip just above the well, and steady your hand as you release the loading dye from the micropipette. CRITICAL REMINDERS: ALWAYS USE a tip on the micropipettor. a. Yellow tips for micropipettors marked with yellow tape/yellow button on top. b. White tips for micropipettors marked with white tape/white button on top. ONLY set the pipette volume within the RANGE SPECIFIED for that micropipette. ALWAYS KEEP the micropipette VERTICAL when you have liquid in the tip. How to take up a sample with a micropipette: 1. Practice pushing the yellow control knob. You should feel 2 stops. The first stop provides you with the dialed volume on the window. You use this stop when drawing up the desired volume. The second stop will release the desired volume. You push the plunger all the way when releasing the liquid. 2. Push the micropipette firmly into one of the disposable tips in the tip box. 3. Push down on the yellow control button with your thumb to the FIRST STOP and hold the button in that position. Dip the pipette tip into the liquid to be withdrawn (never dip into the liquid deeper than the top of the tip) and slowly raise the control button to draw up the liquid into the tip. How to dispense the liquid from the micropipette: 1. Insert the tip into a tube and slowly push the control button down to the FIRST STOP, wait a second. Now push the control button down to the SECOND STOP to push out the final amount of liquid. Keep the button fully depressed and while lifting the micropipette from the liquid drag the tip along the side of the tube. Now release the control button by slowly raising your thumb. DON'T let the button snap back! 2. When you re done with a tip, dispose of the used tip by placing it in the waste container. Hold the micropipette over the waste container and depress the eject button with your index finger. The tip will pop off the end of the micropipette. Loading the practice gel: 1. In a Petri dish submerged under water is an agar gel with two rows of small rectangular wells (pockets for holding a small amount of liquid). For practice, you and your partner are going to load the wells with ordinary food coloring. See the drawing below to understand how to place the pipette tip into the well. Be sure you don't push the tip into the gel. YES, use both hands and support your elbows on the lab tabletop.

5 Part E - Practice Paper Lab 1. You are a genetics counselor and you have a meeting with a couple from Ghana (Mary and James) because they would like to know if they are carriers for Sickle Cell Anemia. During this meeting, you tell them that there are three different types of people in regard to this disease: Normal this person makes all normal hemoglobin (2 copies of the normal DNA sequence) Sickle Cell Trait this person makes half normal and half abnormal hemoglobin, but are usually healthy because they have enough normal (1 copy of the normal DNA sequence, 1 copy of the Sickle Cell Anemia sequence) Sickle Cell Anemia this person make 100% abnormal hemoglobin and because of this have a variety of medical complications (2 copies of the Sickle Cell Anemia sequence) You take a sample of their DNA and the lab technicians use a restriction enzyme called MstII, which recognizes the DNA sequence CCTGAGG, and cuts the DNA between the first G and the first A (Like this: CCTG AGG). Note: You are only seeing one strand of the DNA molecule here. You could figure out the other half very easily. Strand A: Normal DNA sequence AAGGTCTCCTCTTTTTCCTGAGGCTCAGGTCTCCTT Strand B: Sickle Cell sequence AAGGTCTCCTCTTTTTCCTGTGGCTCAGGTCTCCTT Follow the directions below to draw sample gels for each of the three different types of people. 1. Find all the places in each DNA molecule where the enzyme will make a cut and mark the fragments with a line like was done above. 2. Count the number of base pairs in each fragment. Write down the size of each fragment from each strand: a. Size of fragments from strand A: b. Size of fragments from strand B: 3. To the right, create a drawing that indicates where the bands will be located on the gel for each of the following: a. A person with two normal copies of the hemoglobin gene b. A person with two mutated copies of the hemoglobin gene c. A person with one normal and one mutated copy of the hemoglobin gene a b c 4. How does this activity relate to the lab we re doing?

6 Using DNA Gel Electrophoresis to test for Sickle Cell Mutation Name Due: Friday, August 1st Type your answers to the following questions in complete sentences. Purpose (1 pt) 1. What is the purpose of this lab? (1 pt) Introduction (8 pt) 2. What are the symptoms of Sickle Cell Disease? (1 pt) 3. What causes Sickle Cell? How does the location of the mutation allow us to use gel electrophoresis to detect it? (2 pt) 4. Why does DNA move through the agarose gel? (2 pt) 5. Why did the DNA in this lab separate into bands? Why do some bands move further than others? (2 pt) 6. What are the bands made of what is in the bands that we see on the gel? (1 pt) Procedure (7 pt) 7. Write a paragraph to summarize the procedure. Do NOT write steps. Look at the procedure and pick out the major events. You should start with Prepare an agarose gel. (2 pt) 8. What were the three control groups? Why did we need to use these control groups? (2 pt) 9. Why did scientists use restriction enzymes before loading the DNA into the wells? What would have happened if scientists didn t use restriction enzymes? In other words, what would the gel look like if no restriction enzymes were used? Be specific here. (2 pt) 10. What was the purpose of staining the gel after running the gel? (1 pt) Results/Data (4 pt) 11. Draw a gel like the one in your lab handout and draw your results. Be sure to label each well according to the DNA you loaded into that well. Write a one sentence description of the data (no inferences) and label the positive and negative ends of the gel. Analysis (8 pt) 12. Why did you get a different set of fragments for the three control DNA lanes? In other words, why did each control lane have a different number of fragments? In your answer, you should include a diagram that helps your explanation. (2 pt) 13. What were the results for each of the parents? Do they have one, two or no copies of the mutated betaglobin gene? (2 pt) 14. Does the child have sickle cell disease or not? Be specific and thorough in your explanation- use the gel results as your evidence. (4 pt) Communicating the results (8 pt) 15. Suppose that you are a genetic counselor or doctor, and it is your job to communicate your findings to the parents. Write a mini-script in which you accurately yet optimistically present your findings. Be sure to explain to the parents what you have found, the evidence that supports your findings, what this means for the child s life and what she can do to minimize her risk of symptoms. You will likely have to do research here. Please include a bibliography of websites or other sources that you used. On the separate sheet are instructions to do a bibliography. You could also use Noodletools or Citationmachine.net or Easybib.net Organization, spelling, grammar, and overall appearance (6 pt) Report is TYPED (1pts); Uses Section Headings (1pt); No Spelling errors (1pt); No Grammar Errors (1pt); Well written (2pt)