Received 5 September 2003/Returned for modification 30 November 2003/Accepted 31 January 2004
|
|
- Maria Booth
- 6 years ago
- Views:
Transcription
1 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, May 2004, p Vol. 48, No /04/$ DOI: /AAC Copyright 2004, American Society for Microbiology. All Rights Reserved. Antibiotic Susceptibility in Relation to Penicillin-Binding Protein Genes and Serotype Distribution of Streptococcus pneumoniae Strains Responsible for Meningitis in Japan, 1999 to 2002 Kimiko Ubukata, 1 * Naoko Chiba, 1 Keiko Hasegawa, 1 Reiko Kobayashi, 2 Satoshi Iwata, 3 and Keisuke Sunakawa 1 Kitasato Institute for Life Sciences and Graduate School of Infection Control Sciences, Kitasato University, Shirokane, Minato-ku, 1 and Department of Pediatrics, Tokyo National Medical Center, Higashigaoka, Meguro-ku, 3 Tokyo, and Pharmaceutical Center, Meiji Seika Kaihsha, Morookacho, Kohoku-ku, Yokohama, 2 Japan Received 5 September 2003/Returned for modification 30 November 2003/Accepted 31 January 2004 The antibiotic susceptibilities, genotypes of penicillin (PEN)-binding protein genes (pbp), and serotype distributions of Streptococcus pneumoniae isolates from meningitis patients were investigated by a nationwide surveillance group in Japan between 1999 and We analyzed 146 isolates from children (<17 years old) and 73 from adults (>18 years old). Isolates with or without abnormal pbp1a, pbp2x, or pbp2b genes identified by PCR were classified into six genotype patterns and 90% MIC (MIC 90 ) values for PEN: (i) strains with three normal genes (17.2% of isolates; MIC 90, g/ml); (ii) strains with abnormal pbp2x (22.1%, g/ml); (iii) strains with abnormal pbp2b (1.0%, g/ml); (iv) strains with abnormal pbp2x and pbp2b (7.4%, 0.25 g/ml); (v) strains with abnormal pbp1a and pbp2x (12.7%, 0.25 g/ml); and (vi) strains with three abnormal PBP genes (39.7%, 4 g/ml), which are termed genotypic PEN-resistant S. pneumoniae (gprsp). Panipenem, a carbapenem, showed an excellent MIC 90 (0.125 g/ml) against gprsp, followed by meropenem and vancomycin (0.5 g/ml), cefotaxime and ceftriaxone (1 g/ml), and ampicillin (4 g/ml). Strains of gprsp were significantly more prevalent in children (45.2%) than in adults (27.4%). The most frequent serotypes were 6B, 19F, 23F, 6A, and 14 in children and 23F, 22, 3, 10, 6B, and 19F in adults. Serotypes 6B, 6A, 19F, 23F, and 14 predominated among gprsp. In children, 7- and 11-valent pneumococcal conjugate vaccines would cover 76.2 and 81.3% of isolates, respectively, although coverage would be lower in adults (43.9 and 56.0%, respectively). These findings suggest the need for early introduction of pneumococcal conjugate vaccines and continuous bacteriological surveillance for meningitis. * Corresponding author. Mailing address: Kitasato Institute for Life Sciences and Graduate School of Infection Control Sciences, Kitasato University, Shirokane, Minato-ku, Tokyo, , Japan. Phone: (813) Fax: (813) ubukatak@lisci.kitasato-u. ac.jp. Streptococcus pneumoniae is a common etiologic agent of serious invasive infections, with high morbidity and mortality in children and adults, such as meningitis, septicemia, and pneumonia (23, 29). The evolution of strains of S. pneumoniae resistant to penicillin G (PEN) and broad-spectrum cephalosporin antibiotics has created difficulties worldwide in selecting an appropriate chemotherapeutic agent (2). Surveillance studies of antibiotic susceptibility, serotype distribution of causative strains, and mortality rate in meningitis have been carried out nationwide in many countries (8, 11, 15, 20, 21, 28, 33, 36, 39, 43). In Japan, prevalence of PEN-resistant S. pneumoniae (PRSP) among clinical isolates from acute otitis media and respiratory tract infections (RTIs) has been increasing rapidly, especially in younger children (40, 41). In parallel with overall increases in incidence of PRSP, meningitis caused by PRSP is being reported increasingly throughout Japan (4). As investigators in that country, we felt that nationwide surveillance had become crucial given increasing isolation of resistant strains that could cause meningitis, including PRSP, as well as ampicillin (AMP)- and cephalosporin-resistant strains of Haemophilus influenzae type b, the most frequent etiologic agent of bacterial meningitis. In addition, accurate up-to-date data are critical to help decision making for introduction of new conjugate antipneumococcal vaccines appropriate to the country and its population in consideration of serotype distributions among people and geographic areas (19, 38). Based on these considerations, we organized a study group, the Nationwide Surveillance for Bacterial Meningitis (NSBM), in One of the group s objectives was to characterize S. pneumoniae and H. influenzae isolates responsible for meningitis in terms of serotype and antimicrobial resistance according to gene alteration. This is the first report in Japan describing susceptibilities of isolates from pneumococcal meningitis to intravenous -lactam antibiotics and vancomycin, along with their genotypes of PEN-binding protein (PBP) genes and serotypes. MATERIALS AND METHODS Strains. The NSBM study was made possible by the participation of the bacteriology divisions of 226 medical institutions nationwide between 1999 and A total of 219 isolates of S. pneumoniae from patients with meningitis were collected in our laboratory (Kitasato Institute for Life Sciences, Kitasato University). Serotypes and antibiotic susceptibilities based on PCR results for PBP genes were determined promptly in our laboratory and then sent the same day to each bacteriology division by facsimile and . We also received cerebrospi- 1488
2 VOL. 48, 2004 S. PNEUMONIAE SUSCEPTIBILITY AND SEROTYPE 1489 TABLE 1. MIC distribution and resistance genes identified by PCR in S. pneumoniae Antimicrobial agent and resistance class a MIC ( g/ml) Range 50% 90% PEN PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) AMP PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) CTX PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) CRO PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) PAM PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) MEM PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) VAN PSSP PISP (pbp2x) PISP (pbp2b) PISP (pbp2x 2b) PISP (pbp1a 2x) PRSP (pbp1a 2x 2b) a pbp gene alterations detected by PCR are given in parentheses. nal fluid (CSF) from 15 patients with meningitis. Direct PCR examination was used to identify S. pneumoniae in these samples (see below). All clinical isolates were grown on sheep blood agar (Nippon Becton Dickinson, Tokyo, Japan) at 37 C in an atmosphere containing 5% CO 2, and a single colony was isolated for storage in 10% skim milk (Difco Laboratories, Detroit, Mich.) at 80 C. Identification of isolates as S. pneumoniae was confirmed by PCR amplification of the autolysin (lyta) gene (18). Susceptibility testing. MICs of -lactam antibiotics and vancomycin against S. pneumoniae were determined by an agar dilution method using Mueller-Hinton agar (MH; Difco Laboratories) supplemented with 5% defibrinized sheep blood (32). Bacterial inocula were prepared according to a previously reported method (40). Antibiotics used in the present study were PEN and AMP (Meiji Seika Kaisha, Tokyo, Japan); cefotaxime (CTX; Nippon Hoechst Marion Roussel, Tokyo, Japan), ceftriaxone (CRO; Nippon Roche, Tokyo, Japan), panipenem (PAM; Sankyo, Tokyo, Japan), meropenem (MEM; Sumitomo Pharmaceuticals, Tokyo, Japan), and vancomycin (VAN; Shionogi, Osaka, Japan). S. pneumoniae ATCC was used as a quality control strain for susceptibility testing. Serotyping. Serotypes of all S. pneumoniae strains were determined by the Quellung reaction using antiserum purchased from the Statens Serum Institute (Copenhagen, Denmark). PCR to identify three PBP genes and the lyta gene. To confirm that isolates were S. pneumoniae, the lyta gene (18) encoding the autolysin enzyme specificto S. pneumoniae was amplified simultaneously with the three PBP genes. Oligonucleotide primers for detection of the three PBP genes were designed to amplify proportions of the normal pbp1a (5, 27, 37), pbp2x (6, 26, 34), and pbp2b (14, 45) genes detected only in susceptible strains. Among the three sets of primers, the primers for the pbp1a gene were newly constructed based on current worldwide data (30): forward, AAACCGCGACTGGGGATCAAC ; and reverse, GGTTGAGTCCGACCTTGTTT Portions of each gene corresponding to the primers were positioned in blocks of highly divergent sequences within or near conserved amino acid motifs previously identified in the mosaic PBP genes of PEN-nonsusceptible S. pneumoniae. Primer mixture A contained primers for detecting the lyta and pbp1a genes, whereas primer mixture B contained primers for detecting the pbp2x and pbp2b genes. Bacterial samples received from each institution were suspended into 2 ml of Mueller-Hinton broth, and then the 5 l of the broth was added in a 0.5-ml microtube containing 30 l of a lysis solution made up as previously reported (40). A CSF sample was added into a lysis solution after centrifugation at 4 C and 5,000 rpm for 5 min. The tubes were placed in a thermal cycler (Gene Amp PCR System 9600-R; Perkin-Elmer Cetus, Norwalk, Conn.), and bacterial cells were lysed for 20 min at 60 C and for 5 min at 94 C to obtain template DNA. Next, 2 l of template DNA solution was added to each of two tubes marked A and B. These tubes contained 30 l of reaction mixture, consisting of (i) 600 ng of appropriate primer, (ii) 100 l of a 25 mm deoxynucleoside triphosphate mixture, (iii) 40 U of Tth DNA polymerase (Toyobo, Tokyo, Japan), and (iv) 100 l of10 PCR buffer (ph 8.3) per ml of solution. PCR cycling conditions consisted of 35 cycles at 94 C for 15 s, 53 C for 15 s, and 72 C for 15 s. Amplified DNA fragments were analyzed by electrophoresis on a 3% agarose gel. Two DNA fragments of 319 and 239 bp in mixture A corresponded to the products of lyta and pbp1a genes, respectively. Similarly, DNA fragments of 197 and 147 bp in mixture B corresponded to the pbp2x and pbp2b genes, respectively. When an isolate showed all three DNA fragments corresponding to pbp1a, pbp2x, and pbp2b, the PBP genes were regarded as having essentially the same sequences as in the R6 strain of PSSP. When any of these DNA bands was not detected or was detected in different sizes, the gene in question were regarded possessing different sequences. RESULTS Correlation of antimicrobial susceptibility and PCR results. To determine the presence or absence of abnormal pbp1a, pbp2x, and pbp2b genes, PCR was carried out for all S. pneumoniae isolates from the CSF of 204 meningitis cases, except for 15 cases where S. pneumoniae meningitis was diagnosed only by PCR of CSF. Based on the PCR results, strains tested were classified into six groups according to genotype as follows: (i) strains with three normal pbp genes (n 35, 17.2%); (ii) strains with an abnormal pbp2x gene (n 45, 22.1%); (iii) strains with an abnormal pbp2b gene (n 2, 1.0%); (iv) strains with abnormal pbp2x and pbp2b genes (n 15, 7.4%); (v) strains with abnormal pbp1a and pbp2x genes (n 26, 12.7%); and (vi) strains with three abnormal genes pbp1a, pbp2x, and pbp2b (n 81, 39.7%). In the present study, for convenience, genotypes i and vi were termed PSSP and gprsp, respectively. The remaining
3 1490 UBUKATA ET AL. ANTIMICROB. AGENTS CHEMOTHER. FIG. 1. Correlation between MICs of four -lactam antibiotics and abnormalities of three PBP genes in 204 S. pneumoniae isolates from meningitis patients.
4 VOL. 48, 2004 S. PNEUMONIAE SUSCEPTIBILITY AND SEROTYPE 1491 TABLE 2. Relationship between resistant isolates and patient age in children Resistance class a No. of isolates (%) per age group 6 mo 7 11 mo 1 yr 2 yr 3 yr 4 yr 5 yr 6 17 yr Total PSSP (15.1) PISP (pbp2x) (17.8) PISP (pbp2b) (1.4) PISP (pbp2x 2b) (6.2) PISP (pbp1a 2x) (14.4) PRSP (pbp1a 2x 2b) (45.2) Total 25 (17.1) 30 (20.6) 38 (26.0) 17 (11.7) 5 (3.4) 4 (2.7) 4 (2.7) 23 (15.8) 146 genotypes ii to v were termed genotypic PEN-intermediately resistant S. pneumoniae (gpisp). Table 1 shows the 50% MIC (MIC 50 ), the MIC 90, and the MIC range of seven intravenous antibiotics against the strains classified into the six genotype patterns. Figure 1 shows the MIC distribution for PEN, CTX, MEM, and PAM according to PCR results for comparison of the influence of each PBP alteration on MICs; this influence varied considerably depending on the category of the antibiotic. Two antibiotic types were evident among the six -lactam antibiotics. One was the PEN type, for which the strains with an abnormal pbp2x gene did not differ notably from PSSP. AMP, MEM, and PAM belonged to the PEN type. The other -lactam category was the CTX type, where strains with an abnormal pbp2x gene differed from PSSP in having an increased MIC 8 to 16 times greater than in PSSP; CTX and CRO belonged to this type. MICs of CTX-type agents were affected most by an abnormal pbp2x gene, while MICs of PEN-type agents were affected most by the pbp2b gene. The MIC 90 s of the seven antibiotics against the gprsp were excellent; listed in descending order of susceptibility, these were PAM (0.125 g/ml) MEM (0.5 g/ml) VAN (0.5 g/ml) CTX (1 g/ml) CRO (1 g/ml) AMP (4 g/ml) PEN (4 g/ml). The PSSP strains showing CTX MICs of to g/ml had amino acid substitutions located in the area of Lys-Ser-Gly (KSG) or Ser-Ser-Asn (SSN) conserved motifs that could not be detected with our pbp2x primers (data not shown here). In addition, strains with high CTX and CRO MICs of 4 g/ml had two amino acid substitutions changing a Ser-Thr-Met-Lys (STMK) conserved motif in the pbp2x gene to Ser-Ala-Phe-Lys (SAFK). The MICs of VAN for all S. pneumoniae strains were distributed from 0.25 to 0.5 g/ml, and no resistant strain was observed. Resistance types of isolates and patient ages. Tables 2 and 3, respectively, show relationships between abnormal PBP genotypes of causative strains and patient age in children ( 17 years old) and in adults ( 18 years old). The 219 cases consist of 146 children and 73 adults. Among them 15 cases were identified the genotype of the causative agent in the CSF by using direct PCR. Importantly, the gprsp accounted for 45.2% of cases in children, followed by gpisp with an abnormal pbp2x gene for 17.8% and gpisp with abnormal pbp1a plus pbp2x genes for 14.4%, and relatively few cases showed remaining types. The PSSP accounted for only 15.1% of cases. Incidence of meningitis cases caused by S. pneumoniae in children peaked at age 1 year and younger (63.7%), decreasing gradually as age increased. In adult cases compared to pediatric cases, prevalence of gprsp was significantly lower at 27.4%, whereas those of gpisp with an abnormal pbp2x gene and PSSP were higher at 27.4 and 27.4%, respectively ( , P ). The highest adulthood incidence occurred in the sixth and seventh decades. Year-by-year changes in resistant strains. Table 4 shows frequencies of identified resistance genotypes of isolates in each year. The gprsp already had increased to 42.9% in 1999, remaining highly prevalent up to the present. The prevalence of gpisp strains such as those with an abnormal pbp2x and with abnormal pbp1a plus pbp2x genes has not changed so much. Serotypes. Tables 5 and 6 show relationships between serotype and resistance type in isolates from children and adults, TABLE 3. Relationship between resistant isolates and patient age in adults Resistance class a No. of isolates (%) per age group yr yr yr yr yr yr 80 yr Total PSSP (27.4) PISP (pbp2x) (27.4) PISP (pbp2b) PISP (pbp2x 2b) (8.2) PISP (pbp1a 2x) (9.6) PRSP (pbp1a 2x 2b) (27.4) Total 1 (1.4) 6 (8.2) 8 (11.0) 20 (27.4) 25 (34.2) 11 (15.1) 2 (2.7) 73
5 1492 UBUKATA ET AL. ANTIMICROB. AGENTS CHEMOTHER. TABLE 4. Year-to-year changes in resistant S. pneumoniae strains isolated from meningitis patients Resistance class a No. of isolates (%) per yr Total PSSP 3 (14.3) 9 (22.0) 10 (15.9) 20 (21.3) 42 (19.2) PISP (pbp2x) 7 (33.3) 3 (7.3) 17 (27.0) 19 (20.2) 46 (21.0) PISP (pbp2b) 1 (4.8) 1 (2.4) 2 (0.9) PISP (pbp2x 2b) 4 (9.8) 7 (11.1) 4 (4.3) 15 (6.8) PISP (pbp1a 2x) 1 (4.8) 8 (19.5) 7 (11.1) 12 (12.8) 28 (12.8) PRSP (pbp1a 2x 2b) 9 (42.9) 16 (39.0) 22 (34.9) 39 (41.5) 86 (39.3) Total respectively. Serotypes of isolates were significantly different between the two age groups ( , P ). The most common serotypes in young children were 6B (25.4%), 19F (16.7%), 23F (14.5%), 6A (10.1%), and 14 (8.7%), in contrast to adult cases where the most prevalent serotypes were 23F (16.7%), 22 (13.6%), 3 10 (9.1%), and 19F 6B (7.6%). Although a few resistant strains were identified as serotype 14, serotypes 6A, 6B, 19F, and 23F showed the greatest prevalence among gprsp. All serotype 3 isolates were of the mucoid type and were gpisp having an abnormal pbp2x gene. The 7- and 11-valent pneumococcal conjugate vaccines covered serotypes of strains isolated from children in 76.1 and 81.2% of cases, respectively; the corresponding percentages in those from adults were 43.9 and 56.1%. DISCUSSION Since the first cases of invasive pneumococcal infections caused by PRSP were reported in 1977 (3), PEN-nonsusceptible strains have become a worldwide concern (23). Many studies have been reported concerning epidemiologic surveillance for these infections, including serologic, antibiotic susceptibility, and resistance mechanism data (29). Since the early 1990s, isolations of PEN-nonsusceptible strains in RTI and acute otitis media have increased dramatically throughout Japan, particularly in young children (41). Currently, genotypically proven gpisp and gprsp have been isolated in 2002 at rates of 33.0 and 54.9%, respectively. The prevalence of nonsusceptible strains in Japan now appears to be higher than in other countries (2). The rapid increase in resistant strains has paralleled clinical introduction of new oral cephalosporins that have been greatly overprescribed for outpatients as a first-choice antibiotic. The prescription of antibiotics for pediatric outpatients in Japan differs fundamentally from patterns in other countries (12, 13, 22). The problem is reflected by the observation that many pneumococcal isolates (20%) possess an abnormal pbp2x gene, which decreases their susceptibility to cephalosporin antibiotics as opposed to PEN (6). In other countries, in which amoxicillin is prescribed more frequently for outpatients, the prevalence of strains possessing an abnormal pbp2x gene is lower (30). The first case of meningitis caused by PRSP in Japan was reported in 1988 (4). We noted that PEN-nonsusceptible isolates appeared to increase gradually as a causative agent of meningitis in parallel with increases of such isolates in RTI. The prolonged low incidence of pneumococcal meningitis may reflect the Japanese nationwide insurance system, under which every one has access to antibiotic medication without financial barrier. Before initiating the NSBM study, we established a rapid facsimile and reply system from our laboratory to local laboratory technicians and physicians, who received reports for their reference data. A predicted MIC for -lactam antibiotics could be calculated from PCR results for PBP genes within 2.5 h after we received an isolate. The predicted MIC was derived from a multiple regression analysis between MICs of -lactam antibiotics against S. pneumoniae and the presence of abnormal pbp1a, pbp2x, and pbp2b genes (40), with S. pneumoniae strains from RTI collected nationwide in Japan between 1998 and Subsequently, exact MICs of several TABLE 5. Serotype distribution and resistance genes identified in S. pneumoniae isolates from children Resistance class a No. of isolates (%) with pneumococcal serotype b : 3 4 6A 6B 9V C 19F 23A 23F Other Total PSSP (13.8) PISP (pbp2x) (18.9) PISP (pbp2b) 2 2 (1.4) PISP (pbp2x 2b) (6.5) PISP (pbp1a 2x) (14.5) PRSP (pbp1a 2x 2b) (44.9) Total 7 (5.1) 7 (5.1) 14 (10.1) 35 (25.4) 7 (5.1) 2 (1.4) 12 (8.7) 1 (0.7) 1 (0.7) 23 (16.7) 2 (1.4) 20 (14.5) 7 (5.1) 138 b No examples of serotypes 7F and 22 were detected.
6 VOL. 48, 2004 S. PNEUMONIAE SUSCEPTIBILITY AND SEROTYPE 1493 TABLE 6. Serotype distributions and resistance genes identified in S. pneumoniae isolates from adults Resistance class a No. of isolates (%) with pneumococcal serotype b : 3 4 6A 6B 7F 9V F 22 23A 23F Other Total PSSP (24.2) PISP (pbp2x) (28.8) PISP (pbp2b) PISP (pbp2x 2b) (9.1) PISP (pbp1a 2x) (9.1) PRSP (pbp1a 2x 2b) (28.8) Total 6 (9.1) 2 (3.0) 3 (4.5) 5 (7.6) 2 (3.0) 3 (4.5) 6 (9.1) 3 (4.5) 2 (3.1) 5 (7.6) 9 (13.6) 4 (6.1) 11 (16.7) 5 (7.6) 66 b No examples of serotype 18C were detected. intravenous antibiotics against the isolates were redetermined by standard biologic methods. As described in Results, the antimicrobial activity of PAM (31, 41), a carbapenem, was quite impressive with an MIC 90 of g/ml against gprsp. PAM has also a strong bactericidal activity compared to other intravenous antibiotics. PAM is now establishing a reputation as an antibiotic of first choice for severe pneumococcal infections instead of cephalosporins. Concentrations of PAM in CSF were 6.84 g/ml at the acute stage and 3.28 g/ml at the recovering stage after a 1-h drip infusion at a dose of 27.5 mg/kg in pediatric patients with meningitis (17). Notable neurotoxicity or nephrotoxicity have not observed clinically in the pediatric patients thus far. In a rabbit model, neurotoxicity of PAM was approximately half that of imipenem (24). Unfortunately, PAM/betamipron is not available clinically in most countries except in Japan, Korea, and China. In Japan, VAN has not been approved for the treatment of pneumococcal meningitis. This is another reason to use PAM for pneumococcal meningitis to pediatric patients. Meanwhile, various pneumococcal vaccines have been developed, ranging from a 23-polyvalent polysaccharide vaccine to conjugate vaccines, including 7-, 9-, or 11-polyvalency (7, 16, 47). Although all 90 recognized serotypes of S. pneumoniae appear to be pathogenic, how well a vaccine can cover serotypes representing invasive isolates is a key point. Predominant serotypes vary conspicuously between developing and industrialized countries (38), patient age groups, and disease types (8, 11). Some serotypes are more frequent in children for both carriage and infection, whereas others are rarely found in carriers but are frequent in patients with invasive disease. As described in Results, isolates belonging to a serogroup associated with carriage were more frequent in meningitis in children no more than 17 years old than they were in adults, probably because younger children have not yet developed antibodies to these common serotypes. Since -lactam antibiotic resistance is found mainly in serotypes associated with carriage, the prevalence of resistant strains was significantly higher in the young children in meningitis. If 7- and 11-valent vaccines were introduced into Japan, up to 76.2 and 81.3% of causative isolates from meningitis in children would be covered by the respective vaccines; for adults, these percentages would be lower (43.9 and 56.0%). The relatively high coverage rate for children in Japan compared to other countries could be explained by the limitation of prevalent resistant strains to serotypes 6B, 19F, 23A, and 14 (9, 10); these are included in the 7-valent vaccine. Since the 11- valent vaccine also provides cross-protection against serotype 6A, a further 10.1% of meningitis cases would be covered, bringing total coverage to 91.4%. However, cross-protection within a given serogroup is not fully assured (42). The added presence of serotypes 1, 3, 5, and 7F in the 11-valent vaccine increases the potential coverage rate in adults considerably. In conclusion, to prevent severe infections with resistant microorganisms from increasing, vaccination against S. pneumoniae, which is not yet available in Japan, is vitally important (1, 44). In addition, to nationwide surveillance for antibiotic susceptibilities and serotypes of S. pneumoniae (25, 35, 46), postgraduate education for physicians also is necessary to ensure that selection of antibiotics is based on pharmacokinetic, pharmacodynamic, and biologic test data. ACKNOWLEDGMENTS We are extremely grateful to the bacteriologic laboratory technicians and physicians in the NSBM study group for providing us with pneumococcal isolates from meningitis patients. This study was partially supported by a grant from the Ministry of Health, Labor, and Welfare of Japan (Research Project for Emerging and Reemerging Infectious Diseases). REFERENCES 1. Advisory Committee on Immunization Practices Preventing pneumococcal disease among infants and young children: recommendations of the Advisory Committee on Immunization Practices. Morb. Mortal. Wkly Rep. 49: Appelbaum, P. C Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clin. Infect. Dis. 15: Appelbaum, P. C., A. Bhamjee, J. N. Scragg, A. F. Hallett, A. J. Bowen, and R. C. Cooper Streptococcus pneumoniae resistant to penicillin and chloramphenicol. Lancet 2: Arimasu, O., H. Meguro, H. Shiraishi, K. Sugamata, and F. Hiruma A case of pneumococcal meningitis resistant to beta-lactam antibiotic treatment. Kansenshogaku Zasshi. 62: (In Japanese.) 5. Asahi, Y., and K. Ubukata Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42: Asahi, Y., Y. Takeuchi, and K. Ubukata Diversity of substitutions within or adjacent to conserved amino acid motifs of penicillin-binding protein 2X in cephalosporin-resistant Streptococcus pneumoniae isolates. Antimicrob. Agents Chemother. 43: Black, S., H. Shinefield, B. Fireman, E. Lewis, P. Ray, J. R. Hansen, L. Elvin, K. M. Ensor, J. Hackell, G. Siber, F. Malinoski, D. Madore, I. Chang, R. Kohberger, W. Watson, R. Austrian, and K. Edwards Efficacy, safety and immunogenicity of heptavalent pneumococcal conjugate vaccine in children. Northern California Kaiser Permanente Vaccine Study Center Group. Pediatr. Infect. Dis. J. 19: Brandileone, M. C., A. L. de Andrade, J. L. Di Fabio, M. L. Guerra, and R. Austrian Appropriateness of a pneumococcal conjugate vaccine in
7 1494 UBUKATA ET AL. ANTIMICROB. AGENTS CHEMOTHER. Brazil: potential impact of age and clinical diagnosis, with emphasis on meningitis. J. Infect. Dis. 187: Camou, T., R. Palacio, J. L. Di Fabio, and M. Hortal Invasive pneumococcal diseases in Uruguayan children: comparison between serotype distribution and conjugate vaccine formulations. Vaccine 21: Dagan, R., and D. Fraser Conjugate pneumococcal vaccine and antibiotic-resistant Streptococcus pneumoniae: herd immunity and reduction of otitis morbidity. Pediatr. Infect. Dis. J. 19:S79 S Doit, C., C. Loukil, P. Geslin, and E. Bingen Phenotypic and genetic diversity of invasive pneumococcal isolates recovered from French children. J. Clin. Microbiol. 40: Dowell, S. F., J. C. Butler, G. S. Giebink, et al Acute otitis media: management and surveillance in an era of pneumococcal resistance. Pediatr. Infect. Dis. J. 18: Dowell, S. F., S. M. Marcy, W. R. Phillips, M. A. Gerber, and B. Schwartz Otitis media: principles of judicious use of antimicrobial agents. Pediatr. Suppl. 101: Dowson, C. G., A. Hutchison, and B. G. Spratt Nucleotide sequence of the penicillin-binding protein 2B gene of Streptococcus pneumoniae strain R6. Nucleic Acids Res. 17: Eriksson, M., B. Henriques, and K. Ekdahl Epidemiology of pneumococcal infections in Swedish children. Acta Paediatr. Suppl. 89: Eskola, J., T. Kilpi, A. Palmu, J. Jokinen, J. Haapakoski, E. Herva, A. Takala, H. Kayhty, P. Karma, R. Kohberger, G. Siber, P. H. Makela, et al Efficacy of a pneumococcal conjugate vaccine against acute otitis media. N. Engl. J. Med. 344: Furukawa, S., and T. Okada Clinical evaluation of panipenem/betamipron in pediatrics. Jpn. J. Antibiot. 45: (In Japanese.) 18. Garcia, P., J. L. Garcia, E. Garcia, and R. Lopez Nucleotide sequence and expression of the pneumococcal autolysin gene from its own promotor in Escherichia coli. Gene 43: Hausdorff, W. P., J. Bryant, P. R. Paradiso, and G. R. Siber Which pneumococcal serogroups cause the most invasive disease: implications for conjugate vaccine formulation and use, part I. Clin. Infect. Dis. 30: Huebner, R. E., A. D. Wasas, and K. P. Klugman Trends in antimicrobial resistance and serotype distribution of blood and cerebrospinal fluid isolates of Streptococcus pneumoniae in South Africa, Int. J. Infect. Dis. 4: Kaltoft, M. S., N. Zeuthen, and H. B. Konradsen Epidemiology of invasive pneumococcal infections in children aged 0 6 years in Denmark: a 19-year nationwide surveillance study. Acta Paediatr. Suppl. 89: Klein, J. O Review of consensus reports on management of acute otitis media. Pediatr. Infect. Dis. J. 18: Klugman, K. P Pneumococcal resistance to antibiotics. Clin. Microbiol. Rev. 3: Kurihara, A., M. Hisaoka, N. Mikuni, and K. Kamoshida Neutrotoxicity of panipenem/betamipron, a new carbapenem, in rabbits: correlation to concentration in central nervous system. J. Pharmacobiodyn. 15: Kyaw, M. H., S. Clarke, I. G. Jones, and H. Campbell Incidence of invasive pneumococcal disease in Scotland, Epidemiol. Infect. 128: Laible, G., B. G. Spratt, and R. Hakenbeck Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillinresistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5: Martin, C., B. Thomas, and R. Hakenbeck Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillinbinding proteins 1A and 1B. J. Bacteriol. 174: Miller, E., P. Waight, A. Efstratiou, M. Brisson, A. Johnson, and R. George Epidemiology of invasive and other pneumococcal disease in children in England and Wales Acta Paediatr. Suppl. 89: Musher, D. M., R. F. Breiman, and A. Tomasz Streptococcus pneumoniae: at the threshold of the 21st century, p In A. Tomasz (ed.), Streptococcus pneumoniae: molecular biology and mechanisms of disease. Mary Ann Liebert, Inc., New York, N.Y. 30. Nagai, K., Y. Shibasaki, K. Hasegawa, T. A. Davies, M. R. Jacobs, K. Ubukata, and P. C. Appelbaum Evaluations of the primers for PCR to screen Streptococcus pneumoniae isolates, -lactam resistance and to detect common macrolide resistance determinants. J. Antimicrob. Chemother. 48: Neu, H. C., N. X. Chin, G. Saha, and P. Labthavikul In vitro activity against aerobic and anaerobic gram-positive and gram-negative bacteria and beta-lactamase stability of RS-533, a novel carbapenem. Antimicrob. Agents Chemother. 30: National Committee for Clinical Laboratory Standards Performance standards for antimicrobial susceptibility testing. Fifth informational supplement M100 S10. NCCLS, Wayne, Pa. 33. Pantosti, A., F. D Ambrosio, A. Tarasi, S. Recchia, G. Orefici, and P. Mastrantonio Antibiotic susceptibility and serotype distribution of Streptococcus pneumoniae causing meningitis in Italy, Clin. Infect. Dis. 31: Pares, S., N. Mouz, Y. Petillot, R. Hakenbeck, and O. Dideberg X-ray structure of Streptococcus pneumoniae PBP2x, a primary target enzyme. Nat. Struct. Biol. 3: Pelton, S. I., R. Dagan, B. M. Gaines, K. P. Klugman, D. Laufer, K. O Brien, and H. J. Schmitt Pneumococcal conjugate vaccines: proceedings from an interactive symposium at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy. Vaccine 21: Skoczynska, A., and W. Hryniewicz Genetic relatedness, antibiotic susceptibility, and serotype distribution of Streptococcus pneumoniae responsible for meningitis in Poland, Microb. Drug Resist. 9: Smith, A. M., and K. P. Klugman Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42: Sniadack, D. H., B. Schwartz, H. Lipman, J. Bogaerts, J. C. Butler, R. Dagan, G. Echaniz-Aviles, N. Lloyd-Evans, A. Fenoll, N. I. Girgis, J. Henrichsen, K. Klugman, D. Lehmann, A. K. Takala, J. Vandepitte, S. Gove, and R. F. Breiman Potential interventions for the prevention of childhood pneumonia: geographic and temporal differences in serotype and serogroup distribution of sterile site pneumococcal isolates from children: implications for vaccine strategies. Pediatr. Infect. Dis. J. 14: Spanjaard, L., A. van der Ende, H. Rumke, J. Dankert, and L. van Alphen Epidemiology of meningitis and bacteraemia due to Streptococcus pneumoniae in The Netherlands. Acta Paediatr. Suppl. 89: Ubukata, K., T. Muraki, A. Igarashi, Y. Asahi, and M. Konno Identification of penicillin and other -lactam resistance in Streptococcus pneumoniae by PCR. J. Infect. Chemother. 3: Ubukata, K., Y. Asahi, K. Okuzumi, and M. Konno Incidence of penicillin-resistant Streptococcus pneumoniae in Japan, J. Infect. Chemother. 1: Vakevainen, M., C. Eklund, J. Eskola, and H. Kayhty Cross-reactivity of antibodies to type 6B and 6A polysaccharides of Streptococcus pneumoniae, evoked by pneumococcal conjugate vaccines, in infants. J. Infect. Dis. 184: Verhaegen, J., S. J. Vandecasteele, J. Vandeven, N. Verbiest, K. Lagrou, and W. E. Peetermans Antibiotic susceptibility and serotype distribution of 240 Streptococcus pneumoniae causing meningitis in Belgium Acta Clin. Belg. 58: Whitney, C. G., M. H. Farley, J. Hadler, L. H. Harrison, N. M. Bennett, R. Lynfield, A. Reingold, P. R. Cieslak, T. Pilishvili, D. Jackson, R. R. Facklam, J. H. Jorgensen, A. Schuchat, et al Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N. Engl. J. Med. 348: Yamane, A., H. Nakano, Y. Asahi, K. Ubukata, and M. Konno Directly repeated insertion of 9-nucleotide sequence detected in penicillin-binding protein 2B gene of penicillin-resistant Streptococcus pneumoniae. Antimicrob. Agents Chemother. 40: Ziebold, C., R. von Kries, A. Siedler, and H. J. Schmitt Epidemiology of pneumococcal disease in children in Germany. Acta Paediatr. Suppl. 89: Zielen, S., I. Buhring, N. Strnad, J. Reichenbach, and D. Hofmann Immunogenicity and tolerance of a 7-valent pneumococcal conjugate vaccine in nonresponders to the 23-valent pneumococcal vaccine. Infect. Immun. 68:
We determined the nucleotide sequence between 1,903 and 3,097 bp of pbp1a
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 1998, p. 2267 2273 Vol. 42, No. 9 0066-4804/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Association of a Thr-371 Substitution
More informationInvasive Pneumococcal Infections in Denmark from 1995 to 1999: Epidemiology, Serotypes, and Resistance
CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, Mar. 2002, p. 358 365 Vol. 9, No. 2 1071-412X/02/$04.00 0 DOI: 10.1128/CDLI.9.2.358 365.2002 Copyright 2002, American Society for Microbiology. All Rights
More informationPotential Impact of Conjugate Vaccine on the Incidence of Invasive Pneumococcal Disease among Children in Scotland
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2006, p. 1224 1228 Vol. 44, No. 4 0095-1137/06/$08.00 0 doi:10.1128/jcm.44.4.1224 1228.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved.
More informationChanges in the Distribution of Capsular Serotypes of Streptococcus pneumoniae Isolated from Adult Respiratory Specimens in Japan
ORIGINAL ARTICLE Changes in the Distribution of Capsular Serotypes of Streptococcus pneumoniae Isolated from Adult Respiratory Specimens in Japan Hisashi Shoji 1, Masayuki Maeda 2, Tetsuro Shirakura 3,
More informationORIGINAL ARTICLE /j x
ORIGINAL ARTICLE 10.1111/j.1469-0691.2004.00869.x Invasive Streptococcus pneumoniae from Portugal: implications for vaccination and antimicrobial therapy I. Serrano, M. Ramirez, the Portuguese Surveillance
More informationExtremely High Incidence of Macrolide and Trimethoprim- Sulfamethoxazole Resistance among Clinical Isolates of Streptococcus pneumoniae in Taiwan
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 1999, p. 897 901 Vol. 37, No. 4 0095-1137/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Extremely High Incidence of Macrolide
More informationSimultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR (1167)
From the Japanese Association of Medical Sciences The Japanese Association for Infectious Diseases Simultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR
More information...REPORTS... Epidemiology of Pneumococcal Disease/ Rationale for and Efficacy of PnC7
...REPORTS... Epidemiology of Pneumococcal Disease/ Rationale for and Efficacy of PnC7 Summary A Streptococcus pneumoniae Conjugate Vaccine Managed Care Advisory Panel was presented with information on
More informationAffinity of Doripenem and Comparators to Penicillin-Binding Proteins in Escherichia coli and ACCEPTED
AAC Accepts, published online ahead of print on February 00 Antimicrob. Agents Chemother. doi:./aac.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationjournal of medicine The new england Decline in Invasive Pneumococcal Disease after the Introduction of Protein Polysaccharide Conjugate Vaccine
The new england journal of medicine established in 1812 may 1, 2003 vol. 348 no. 18 Decline in Invasive Pneumococcal Disease after the Introduction of Protein Polysaccharide Conjugate Vaccine Cynthia G.
More informationChapter 11: Pneumococcal Disease
Pneumococcal Disease: Chapter 11-1 Pneumococci can be found in the upper respiratory tract of 15% of well adults; in child care settings, up to 65% of children are colonized. Chapter 11: Pneumococcal Disease
More informationBenefits of the pneumococcal immunisation programme in children in the United Kingdom
Benefits of the pneumococcal immunisation programme in children in the United Kingdom 2006-2014 Professor Mary P E Slack mpeslack@gmail.com March 2015 Disclosure of interest The presenter has received
More informationImpact of pneumococcal conjugate vaccine: US experience Stephanie Schrag Centers for Disease Control and Prevention Atlanta, GA
Impact of pneumococcal conjugate vaccine: US experience Stephanie Schrag Centers for Disease Control and Prevention Atlanta, GA San Jose, Costa Rica, August 2007 Pneumococcal Conjugate Vaccine Introduction
More informationReport of Typing & Antimicrobial Susceptibilities of Isolates Causing Invasive Pneumococcal Disease in Ireland,
Report of Typing & Antimicrobial Susceptibilities of Isolates Causing Invasive Pneumococcal Disease in Ireland, 2011-2013 1. Background Streptococcus pneumoniae is a major cause of life-threatening infections
More informationAmpicillin Resistance Mechanisms in Clinical Haemophilus influenzae: What is Happening in Portugal?
Ampicillin Resistance Mechanisms in Clinical Haemophilus influenzae: What is Happening in Portugal? M. Paula Bajanca-Lavado Haemophilus Reference Laboratory Infectious Disease Department National Institute
More informationORIGINAL ARTICLE. Pneumococcal acute otitis media in children
ORIGINAL ARTICLE Pneumococcal acute otitis media in children G. Kouppari 1, A. Zaphiropoulou 1, G. Stamos 1, V. Deliyianni 1, N. Apostolopoulos 2 and N. J. Legakis 3 1 Microbiology Laboratory, 2 ENT Department
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationEPIREVIEW INVASIVE PNEUMOCOCCAL DISEASE, NSW, 2002
EPIREVIEW INVASIVE PNEUMOCOCCAL DISEASE, NSW, 2002 Robyn Gilmour Communicable Diseases Branch NSW Department of Health BACKGROUND Infection with the bacterium Streptococcus pneumoniae is a major cause
More informationAssociation of Serotypes of Streptococcus pneumoniae with Age in Invasive Pneumococcal Disease
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2010, p. 1291 1296 Vol. 48, No. 4 0095-1137/10/$12.00 doi:10.1128/jcm.01937-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Association
More informationMolecular Epidemiology of Penicillin-Susceptible, Multidrug- Resistant Serotype 6B Pneumococci Isolated from Children in Greece
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2001, p. 581 585 Vol. 39, No. 2 0095-1137/01/$04.00 0 DOI: 10.1128/JCM.39.2.581 585.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Molecular
More informationEconomic Evaluation of a Universal Childhood Pneumococcal Conjugate Vaccination Strategy in Ireland
Volume 11 Number 5 2008 VALUE IN HEALTH Economic Evaluation of a Universal Childhood Pneumococcal Conjugate Vaccination Strategy in Ireland Lesley Tilson, BSc (Pharm), PhD, 1 Cara Usher, BSc, PhD, 1 Karina
More informationPrediction of the potential benefit of different pneumococcal conjugate vaccines on invasive pneumococcal disease in German children
Pediatr Infect Dis J, 2002;21:1017 23 Vol. 21, No. 11 Copyright 2002 by Lippincott Williams & Wilkins, Inc. Printed in U.S.A. Prediction of the potential benefit of different pneumococcal conjugate vaccines
More informationIncidence per 100,000
Streptococcus pneumoniae Surveillance Report 2005 Oregon Active Bacterial Core Surveillance (ABCs) Office of Disease Prevention & Epidemiology Oregon Department of Human Services Updated: March 2007 Background
More informationÖrebro University Hospital
Örebro University Hospital Department of Laboratory Medicine Susanne Jacobsson Date: 2015-02-18 Page 1 (8) Neisseria meningitidis 2014 Annual report concerning serogroup, genosubtype and antibiotic susceptibility
More informationEARSS in Ireland, Results of invasive Streptococcus pneumoniae infection (blood/csf) surveillance
EARSS in Ireland, 2007 Results of invasive Streptococcus pneumoniae infection (blood/csf) surveillance Antibiotic codes and abbreviations: CTX, Ciprofloxacin ERY, Erythromycin OXA, Oxacillin TCY, Tetracycline
More informationChanging Epidemiology of Bacterial Meningitis in the United States
Changing Epidemiology of Bacterial Meningitis in the United States William R. Short, MD and Allan R. Tunkel, MD, PhD Address Department of Medicine, Medical College of Pennsylvania/Hahnemann University,
More informationBacterial diseases caused by Streptoccus pneumoniae in children
Bacterial diseases caused by Streptoccus pneumoniae in children Bactermia 85% Bacterial pneumonia 66% Bacterial meningitis 50% Otitis media 40% Paranasal sinusitis 40% 0% 10% 20% 30% 40% 50% 60% 70% 80%
More informationResistance among Streptococcus pneumoniae Clinical Isolates by Use of the E Test
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1994, p. 159-163 0095-1137/94/$04.00+0 Copyright 1994, American Society for Microbiology Vol. 32, No. 1 Detection of Penicillin and Extended-Spectrum Cephalosporin
More informationEconomic Impact of a Pneumococcal Conjugate Vaccine in Managed Care
...PRESENTATIONS... Economic Impact of a Pneumococcal Conjugate Vaccine in Managed Care Based on a presentation by Tracy Lieu, MD, MPH* Presentation Summary Conjugate pneumococcal vaccines may soon allow
More informationAbility of Pneumococcal Serotypes and Clones To Cause Acute Otitis Media: Implications for the Prevention of Otitis Media by Conjugate Vaccines
INFECTION AND IMMUNITY, Jan. 2004, p. 76 81 Vol. 72, No. 1 0019-9567/04/$08.00 0 DOI: 10.1128/IAI.72.1.76 81.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Ability of Pneumococcal
More informationPneumococcal Vaccine Effectiveness. Steven Black, MD Center for Global Health Cincinnati Children s s Hospital Cincinnati, Ohio USA
Pneumococcal Vaccine Effectiveness Steven Black, MD Center for Global Health Cincinnati Children s s Hospital Cincinnati, Ohio USA Overview Possible effectiveness outcomes for pneumococcal vaccines Pre-licensure
More informationImpacto de la vacuna conjugada en EUA
Impacto de la vacuna conjugada en EUA Richard Facklam, PhD, Distinguished Consultant, Retired, Centers for Disease Control and Prevention Atlanta, GA Bogotá, Colombia, February 2008 Pneumococcal Conjugate
More informationIncreasing Genetic Relatedness of Ciprofloxacin-Resistant Streptococcus pneumoniae Isolated in Canada from 1997 to 2005
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2008, p. 1190 1194 Vol. 52, No. 3 0066-4804/08/$08.00 0 doi:10.1128/aac.01260-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Increasing
More informationCharacterization of Mucoid and Non-Mucoid Streptococcus pneumoniae Isolated From Outpatients
Original Article Clinical Microbiology Ann Lab Med 2015;35:410-415 http://dx.doi.org/10.3343/alm.2015.35.4.410 ISSN 2234-3806 eissn 2234-3814 Characterization of Mucoid and Non-Mucoid Streptococcus pneumoniae
More informationAssociation of Clinical Signs and Symptoms with Pneumococcal Acute Otitis Media by Serotype Implications for Vaccine Effect
MAJOR ARTICLE Association of Clinical Signs and Symptoms with Pneumococcal Acute Otitis Media by Serotype Implications for Vaccine Effect Arto A. I. Palmu, 1,2 Jukka T. Jokinen, 1 Tarja Kaijalainen, 1
More informationStreptococcus pneumoniae is a major etiology of serious bacterial infection among children
Focused Issue of This Month Direct and Indirect Effects of Pneumococcal Protein Conjugate Vaccine Eunhwa Choi, MD Department of Pediatrics, Seoul National University College of Medicine E mail : eunchoi@snu.ac.kr
More informationSerotype Distribution and Antimicrobial Resistance of
BioMed Research International Volume 2016, Article ID 6950482, 7 pages http://dx.doi.org/10.1155/2016/6950482 Research Article Serotype Distribution and Antimicrobial Resistance of Streptococcus pneumoniae
More informationEmergence of Streptococcus pneumoniae with Very-High-Level Resistance to Penicillin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2004, p. 3016 3023 Vol. 48, No. 8 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.8.3016 3023.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationGenetic Relatedness within Serotypes of Penicillin-Susceptible Streptococcus pneumoniae Isolates
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2000, p. 4548 4553 Vol. 38, No. 12 0095-1137/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Genetic Relatedness within Serotypes
More informationIncrease in numbers of b-lactam-resistant invasive Streptococcus pneumoniae in Brazil and the impact of conjugate vaccine coverage
Journal of Medical Microbiology (2006), 55, 567 574 DOI 10.1099/jmm.0.46387-0 Increase in numbers of b-lactam-resistant invasive Streptococcus pneumoniae in Brazil and the impact of conjugate vaccine coverage
More informationCUMULATIVE INVASIVE PNEUMOCOCCAL DISEASE CASE NUMBERS REPORTED BY THE GERMS-SA SURVEILLANCE PROGRAMME, 2005 TO DATE
CUMULATIVE INVASIVE PNEUMOCOCCAL DISEASE CASE NUMBERS REPORTED BY THE GERMS-SA SURVEILLANCE PROGRAMME, 5 TO DATE GERMS-SA surveillance programme http://www.nicd.ac.za/?page=germs-sa&id=97 National, active,
More informationVOL. 43, 2005 RESPONSE TO PNEUMOCOCCAL CONJUGATE VACCINATION 75 for children 24 months of age and older (Prevnar; Wyeth Lederle) or twice for children
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2005, p. 74 83 Vol. 43, No. 1 0095-1137/05/$08.00 0 doi:10.1128/jcm.43.1.74 83.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. lecular
More informationPneumococcal infection is one of. Epidemiology of Pneumococcal Disease ...PRESENTATIONS... Based on a presentation by Chris Van Beneden, MD, MPH
...PRESENTATIONS... Epidemiology of Pneumococcal Disease Based on a presentation by Chris Van Beneden, MD, MPH Presentation Summary Pneumococcus is a leading cause of pneumonia and meningitis in the United
More informationTwo-in-one: GSK s candidate PHiD-CV dual pathogen vaccine
Two-in-one: GSK s candidate PHiD-CV dual pathogen vaccine Dr. Bernard Hoet Director, Medical affairs GlaxoSmithKline Biologicals Rixensart, Belgium Istanbul, Feb 13, 2008 PHiD-CV: A novel concept in Bacterial
More informationPneumococcal vaccines. Safety & Efficacy. Prof. Rajesh Kumar, MD PGIMER School of Public Health Chandigarh
Pneumococcal vaccines Safety & Efficacy Prof. Rajesh Kumar, MD PGIMER School of Public Health Chandigarh Disclosure Slide X X I DO NOT have any significant or other financial relationships with industry
More informationMulti-drug Resistant Serotype 19A Pneumococci in Toronto
TML Lab Rounds January 17, 2008 Multi-drug Resistant Serotype 19A Pneumococci in Toronto The Role of the Microbiology Lab Susan M. Poutanen, MD, MPH, FRCPC Microbiologist/ID Consultant, TML/MSH Assistant
More informationRisk profiles and vaccine uptake in children with invasive pneumococcal disease at a tertiary hospital in Tshwane:
Risk profiles and vaccine uptake in children with invasive pneumococcal disease at a tertiary hospital in Tshwane: A retrospective review Xandré Dearden www.up.ac.za IPD: disease spectrum and epidemiology
More informationRESEARCH NOTE. 86 Clinical Microbiology and Infection, Volume 12 Number 1, January 2006
86 Clinical Microbiology and Infection, Volume 12 Number 1, January 2006 REFERENCES 1. Archer GL. Staphylococcus aureus: a well-armed pathogen. Clin Infect Dis 1998; 26: 1179 1181. 2. Barenfanger J, Drake
More informationDissemination of Macrolide-Resistant Streptococcus pneumoniae Isolates Containing Both erm(b) and mef(a) in South Korea
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2003, p. 5787 5791 Vol. 41, No. 12 0095-1137/03/$08.00 0 DOI: 10.1128/JCM.41.12.5787 5791.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.
More informationSurveillance of antimicrobial susceptibility of Enterobacteriaceae pathogens isolated from intensive care units and surgical units in Russia
Feb. 2016 THE JAPANESE JOURNAL OF ANTIBIOTICS 69 1 41 41 Surveillance of antimicrobial susceptibility of Enterobacteriaceae pathogens isolated from intensive care units and surgical units in Russia IRINA
More information97 80 Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis
4 4 9 6 6 6 7 6 66 4 99.9.7 8. 7..8.4..7.9.. 4. 7.4 8.7 99 97 8 Streptococcus pneumoniae, Haemophilus influenzae, oraxella catarrhalis 4 4 64 7 9 7 89. RT PCR 4. 6 46. Key words: RT PCR I 6 6 46 64. 8.
More informationStreptococcus pneumoniae 356 moxifloxacin (MFLX), garenoxacin (GRNX) sitafloxacin
2009 21 1) 1, 2) 1, 2) 1) 1) 2) 1) 1) 1) 1) 1) 1, 2) 1) 2) 20 2 29 21 1 14 Streptococcus pneumoniae 356 moxifloxacin (MFLX), garenoxacin (GRNX) sitafloxacin (STFX), DX619 S. pneumoniae S. pneumoniae 60
More informationEditorial. Pneumococcal Vaccination for Indian Children
Editorial Pneumococcal Vaccination for Indian Children Six years have passed since the last editorial on pneumococcal vaccines, written by Prof. Kim Mulholland, appeared in this journal(1). At that time,
More informationTen-Year Surveillance of Pneumococcal Infections in Temuco, Chile: Implications for Vaccination Strategies
CLINICAL AND VACCINE IMMUNOLOGY, June 2007, p. 660 664 Vol. 14, No. 6 1556-6811/07/$08.00 0 doi:10.1128/cvi.00379-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Ten-Year Surveillance
More informationEffect of Pneumococcal Conjugate Vaccine on Pneumococcal Meningitis
The new england journal of medicine original article Effect of Pneumococcal Conjugate Vaccine on Pneumococcal Meningitis Heather E. Hsu, M.P.H., Kathleen A. Shutt, M.S., Matthew R. Moore, M.D., M.P.H.,
More informationReceived 8 February 2006/Returned for modification 17 March 2006/Accepted 27 March 2006
JOURNAL OF CLINICAL MICROBIOLOGY, June 2006, p. 2032 2038 Vol. 44, No. 6 0095-1137/06/$08.00 0 doi:10.1128/jcm.00275-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Distribution
More informationReceived 26 June 1995/Returned for modification 15 September 1995/Accepted 5 February 1996
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1996, p. 941 946 Vol. 40, No. 4 0066-4804/96/$04.00 0 Copyright 1996, American Society for Microbiology Amoxicillin Dose-Effect Relationship with Streptococcus
More informationMacrolide-resistant phenotypes of invasive Streptococcus pneumoniae isolates in Serbia
Arch. Biol. Sci., Belgrade, 64 (4), 1377-1382, 2012 DOI:10.2298/ABS1204377G Macrolide-resistant phenotypes of invasive Streptococcus pneumoniae isolates in Serbia Ina GajiĆ, NataŠa Opavski, Vera MIJAČ
More informationAntibiotic-Resistant Invasive Pneumococcal Clones in Italy
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2007, p. 306 312 Vol. 45, No. 2 0095-1137/07/$08.00 0 doi:10.1128/jcm.01229-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Antibiotic-Resistant
More informationAXITAB-CV TAB. COMPOSITION :
AXITAB-CV TAB. COMPOSITION : Each film coated tablet contains: Cefuroxime Axetil I.P. Eq. to Anhydrous 500mg. Potassium Clavulanate Diluted I.P. Eq. to Clavulanic Acid 125mg DESCRIPTION : Cefuroxime Axetil
More informationSurveillance of invasive pneumococcal infection in Belgium
Surveillance of invasive pneumococcal infection in Belgium National Reference Laboratory Start in 198 Laboratory Microbiology UH Leuven (prof. J. Vandepitte) Capsular type determination Antibiotic susceptibility
More informationHaemophilus influenzae and its invisibility cloak. Anna Strain Virology Supervisor/VPD Reference Center Coordinator June 5, 2018
Haemophilus influenzae and its invisibility cloak Anna Strain Virology Supervisor/VPD Reference Center Coordinator June 5, 2018 Haemophilus influenzae Gram negative aerobic coccobacilli Pfeiffer s Bacillus-
More informationWorld Health Organization Department of Communicable Disease Surveillance and Response
WHO/CDS/CSR/DRS/2001.6 Resistant pneumococcal infections Stephanie J. Schrag, Bernard Beall and Scott Dowell World Health Organization Department of Communicable Disease Surveillance and Response This
More informationDiagnosis of Pneumococcal Disease
Diagnosis of Pneumococcal Disease Limitations of Surveillance for Invasive Disease David Murdoch University of Otago, Christchurch New Zealand Key Points We are still reliant on culture-based methods for
More informationAAC Accepts, published online ahead of print on 19 March 2007 Antimicrob. Agents Chemother. doi: /aac
AAC Accepts, published online ahead of print on 19 March 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.01000-06 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationState of Hong Kong Children
HK J Paediatr (new series) 2001;6:127-132 State of Hong Children Proceedings of The First Current Topic in Infectious Diseases: Consensus Meeting on Conjugate Vaccines of the Center of Infection, Faculty
More informationCumulative invasive pneumococcal disease case numbers reported by the GERMS-SA surveillance programme, 1 January 2012 to 30 April 2018
Cumulative invasive pneumococcal disease case numbers reported by the GERMS-SA surveillance programme, 1 January 212 to 3 April 218 GERMS-SA surveillance programme GERMS-SA is a national, active, laboratory-based
More informationCumulative invasive pneumococcal disease case numbers reported by the GERMS-SA surveillance programme, 1 January 2012 to 31 October 2018
Cumulative invasive pneumococcal disease case numbers reported by the GERMS-SA surveillance programme, 1 January 212 to 31 October 218 GERMS-SA surveillance programme GERMS-SA is a national, active, laboratory-based
More informationInternational Journal of Infectious Diseases
International Journal of Infectious Diseases 14 (2010) e197 e209 Contents lists available at ScienceDirect International Journal of Infectious Diseases journal homepage: www.elsevier.com/locate/ijid Review
More informationImpact of vaccination on epidemiology in adults
Impact of vaccination on epidemiology in adults Jan Verhaegen 1. Data on prospective study on IPD in Belgium (2009-2011) 2. Evolution of capsular types of invasive isolates from adults after introduction
More informationInvasive Pneumococcal Disease in Kanti Children s Hospital, Nepal, as Observed by the South Asian Pneumococcal Alliance Network
SUPPLEMENT ARTICLE Invasive Pneumococcal Disease in Kanti Children s Hospital, Nepal, as Observed by the South Asian Pneumococcal Alliance Network A. S. Shah, 1 M. Deloria Knoll, 2 P. R. Sharma, 1 J. C.
More informationEvelyn A. Kluka, MD FAAP November 30, 2011
Evelyn A. Kluka, MD FAAP November 30, 2011 > 80% of children will suffer from at least one episode of AOM by 3 years of age 40% will have > 6 recurrences by age 7 years Most common diagnosis for which
More informationHaemophilus influenzae
Haemophilus influenzae type b Severe bacterial infection, particularly among infants During late 19th century believed to cause influenza Immunology and microbiology clarified in 1930s Haemophilus influenzae
More informationReceived 30 March 2005; returned 16 June 2005; revised 8 September 2005; accepted 12 September 2005
Journal of Antimicrobial Chemotherapy (2005) 56, 1047 1052 doi:10.1093/jac/dki362 Advance Access publication 20 October 2005 Evaluation of PPI-0903M (T91825), a novel cephalosporin: bactericidal activity,
More informationAlberta Health and Wellness Public Health Notifiable Disease Management Guidelines August Pneumococcal Disease, Invasive (IPD)
August 2011 Pneumococcal Disease, Invasive (IPD) Revision Dates Case Definition Reporting Requirements Remainder of the Guideline (i.e., Etiology to References sections inclusive) Case Definition August
More informationChanges Over Time in Nasopharyngeal Colonization in Children Under 2 Years of Age at the Time of Diagnosis of Acute Otitis Media ( )
Open Forum Infectious Diseases MAJOR ARTICLE Changes Over Time in Nasopharyngeal Colonization in Children Under 2 Years of Age at the Time of Diagnosis of Acute Otitis Media (1999 2014) Judith M. Martin,
More informationNationwide Surveillance of Nasopharyngeal Streptococcus pneumoniae Isolates from Children with Respiratory Infection, Switzerland,
MAJOR ARTICLE Nationwide Surveillance of Nasopharyngeal Streptococcus pneumoniae Isolates from Children with Respiratory Infection, Switzerland, 1998 1999 Kathrin Mühlemann, 1 Hans C. Matter, 2 Martin
More informationGAS surveillance. emm12 emm28 emm89 GAS GAS. A GAS Streptococcus pyogenes GAS GAS PSAGN GAS GAS. emm. Vol. 26 No GAS surveillance study group
014 Vol. 6No. 11 A 1 1 GAS surveillance study group A GAS GAS surveillance study group01 GAS 44 PCR 60 GAS emm emm8emm8 GAS emm GAS A GASStreptococcus pyogenes GAS 1 6 1 GAS 1, GAS GAS GAS PSAGN GAS Key
More informationFaculty Disclosure. Stephen I. Pelton, MD. Dr. Pelton has listed no financial interest/arrangement that would be considered a conflict of interest.
Faculty Disclosure Stephen I. Pelton, MD Dr. Pelton has listed no financial interest/arrangement that would be considered a conflict of interest. Advances in the management of fever in infants 0 to 3 and
More informationStreptococcus pneumoniae is a Gram-positive, facultative
Special Section 765 Pneumococcal Vaccines Chen-Fang Ho, MD; Tzou-Yien Lin, MD Streptococcus pneumoniae is the leading bacterial pathogen of infectious diseases in children and adolescents. The 23-valent
More informationMolecular Characterization of Penicillin-Resistant Streptococcus pneumoniae Isolates from Bulgaria
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1999, p. 638 648 Vol. 37, No. 3 0095-1137/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Characterization of Penicillin-Resistant
More informationInvasive Pneumococcal Isolates from Danish Infants (0-90 Days) during the Years 1943 to 2013
Invasive Pneumococcal Isolates from Danish Infants (0-90 Days) during the Years 1943 to 2013 Hans-Christian Slotved*, Tine Dalby, Steen Hoffmann Neisseria and Streptococcus Reference Laboratory (NSRlab),
More informationMolecular characterization of Streptococcus pneumoniae invasive serotype 19A isolates from adults in two Spanish regions ( )
DOI 10.1007/s10096-011-1399-3 ARTICLE Molecular characterization of Streptococcus pneumoniae invasive serotype 19A isolates from adults in two Spanish regions (1994 2009) J. M. Marimón & M. Alonso & D.
More informationMolecular Epidemiology of Penicillin-Nonsusceptible Streptococcus pneumoniae among Children in Greece
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2000, p. 4361 4366 Vol. 38, No. 12 0095-1137/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Molecular Epidemiology of Penicillin-Nonsusceptible
More informationControl Sciences & Kitasato Institute for Life Sciences, Kitasato University Shirokane, Minato-ku, Tokyo , Japan
AAC Accepts, published online ahead of print on 30 March 2009 Antimicrob. Agents Chemother. doi:10.1128/aac.01716-08 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationCONJUGATE VACCINES A BREAKTHROUGH IN VACCINE DEVELOPMENT
CONJUGATE VACCINES A BREAKTHROUGH IN VACCINE DEVELOPMENT P Helena Mäkelä National Public Health Institute, Helsinki, Finland Abstract. The encapsulated bacteria Streptococcus pneumoniae (the pneumococcus),
More informationIntroduction. Journal of Antimicrobial Chemotherapy (2008) 62, Suppl. 2, ii87 ii95 doi: /jac/dkn355
Journal of Antimicrobial Chemotherapy (2008) 62, Suppl. 2, ii87 ii95 doi:10.1093/jac/dkn355 Non-susceptibility trends and serotype distributions among Streptococcus pneumoniae from community-acquired respiratory
More information* these authors contributed equally to the preparation of this report
AAC Accepts, published online ahead of print on June 00 Antimicrob. Agents Chemother. doi:0./aac.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationORIGINAL ARTICLES. Pneumococcal conjugate vaccine a health priority. The burden of pneumococcal pneumonia. Heather J Zar, Shabir A Madhi
Pneumococcal conjugate vaccine a health priority Heather J Zar, Shabir A Madhi Pneumonia is a major cause of childhood mortality and morbidity. Streptococcus pneumoniae is the most important bacterial
More informationU.S. Hospitalizations for Pneumonia after a Decade of Pneumococcal Vaccination
original article U.S. Hospitalizations for Pneumonia after a Decade of Pneumococcal Vaccination Marie R. Griffin, M.D., M.P.H., Yuwei Zhu, M.D., Matthew R. Moore, M.D., M.P.H., Cynthia G. Whitney, M.D.,
More informationAcute Bacterial Meningitis in Infants and Children Epidemiology and Management
REVIEW ARTICLE Pediatr Drugs 2011; 13 (6): 385-400 1174-5878/11/0006-0385/$49.95/0 ª 2011 Adis Data Information BV. All rights reserved. Acute Bacterial Meningitis in Infants and Children Epidemiology
More informationEvaluation of Innovative Surveillance for Drug-resistant Streptococcus pneumoniae
American Journal of Epidemiology Copyright 2001 by the Johns Hopkins University Bloomberg School of Public Health All rights reserved Vol. 154,. 11 Printed in U.S.A. Surveillance for Drug-resistant S.
More informationPrevalence of Extended Spectrum -Lactamases In E.coli and Klebsiella spp. in a Tertiary Care Hospital
ISSN: 2319-7706 Volume 3 Number 10 (2014) pp. 474-478 http://www.ijcmas.com Original Research Article Prevalence of Extended Spectrum -Lactamases In E.coli and Klebsiella spp. in a Tertiary Care Hospital
More informationDiscrepancies in the recovery of bacteria from multiple sinuses in acute and chronic sinusitis
Journal of Medical Microbiology (2004), 53, 879 885 DOI 10.1099/jmm.0.45655-0 Short Communication Correspondence Itzhak Brook ib6@georgetown.edu Received 1 March 2004 Accepted 18 May 2004 Discrepancies
More informationMAJOR ARTICLE. M. Catherine McEllistrem, 1 Jennifer Adams, 1 Edward O. Mason, 2 and Ellen R. Wald 3
MAJOR ARTICLE Epidemiology of Acute Otitis Media Caused by Streptococcus pneumoniae Before and After Licensure of the 7-Valent Pneumococcal Protein Conjugate Vaccine M. Catherine McEllistrem, 1 Jennifer
More informationby author ESCMID Online Lecture Library Steroids in acute bacterial meningitis
Steroids in acute bacterial meningitis Javier Garau, MD, PhD University of Barcelona Spain ESCMID Summer School, Porto, July 2009 Dexamethasone treatment in childhood bacterial meningitis in Malawi: a
More informationFull public health impact or. cherry-picking?
Full public health impact or cherry-picking? Arto Palmu, MD, PhD, Research manager, head of Clinical Research Team, Department of Public Health Solutions 10.11.2017 Arto Palmu / RIVM2017 1 Disclosure The
More informationActivity of Ceftolozane/Tazobactam Against a Broad Spectrum of Recent Clinical Anaerobic Isolates
AAC Accepts, published online ahead of print on 25 November 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.02253-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. Activity
More informationStreptococcus pneumoniae
Streptococcus pneumoniae EPIDEMIOLOGY AND PREVENTION 2^4. November 2007 Prof. Dr. Kathrin Mühlemann Klinik und Poliklinik für Infektionskrankheiten Universität Bern, INSELSPITAL S. pneumoniae: epidemiology
More information