Downloaded from ijem.sbmu.ac.ir at 19: on Friday March 22nd 2019 UPC1 UPC1. i - Uncoupling protein 1
|
|
- Crystal Johns
- 5 years ago
- Views:
Transcription
1 ( ) : fa.izaddoust@gmail.com :. :. : ) (/± / : ).. (/± /. :. p< / SPSS.(p< /).(p< /) :.(p> /). : 95/12/23 : 95/12/17 : 95/11/2 : UPC1.. UPC i. (UPC1) 1 i Uncoupling protein 1
2 , IR.IAU.RASHT.REC IRCT N2 8 10) 65 ( 5 50 ) ( i. (1RM) RM ii BMI.. i One Repetition Maximum (1RM) ii Seca /93±3/39 20.
3 v (LDLC). 0/3 HDLC LDLC /6 vi 0/ vii SPSS. p<0/05.. t.(p>0/05).(p<0/05). 1 i WHR RM = ( 1/0278 0/028 ) : ii 902. iv (HDLC) iii v Biosystem vi ZellBio GmbH vii Univariat i Gluteal ii Hitachi iii Highdensity lipoproteins iv Lowdensity lipoproteins
4 , 1 ( 6 = =10 ) 0/87 0/97 0/13 0/38 0/99 0/10 0/90 0/90 0/19 0/33 0/97 0/95 0/88 0/67 0/83 0/50 0/79 1/00 0/86 0/20 0/68 0/65 * 0/001 0/53 60/54±8/00 61/20±7/67 23/42±2/70 23/38±2/62 71/80±3/51 74/50±2/79 96/07±5/63 100/08±9/74 0/74±0/03 0/74±0/05 78/14±19/68 64/50±14/07 24/60±2/45 26/44±4/18 160/56±5/96 161/81±2/45 60/21±9/16 61/03±7/67 23/45±2/83 23/28±2/62 71/90±4/04 74/50±3/01 96/00±5/84 99/83±9/78 0/74±0/03 0/75±0/05 61/79±21/07 63/12±15/01 ( ) ( ) () ( ) BMI ( ) ( ) () WHR () (P<0/05) * :WHR :BMI.(p<0/05).(p>0/05) 2. HDLC LDLC.(p<0/05).(p>0/05) t 2 ( 6 = 10= ) 0/00 0/03 0/44 0/ / /07 435/91 26/71 0/17 0/59 0/91 0/00 F 2/03 0/30 0/01 9/19 * 0/02 0/05 0/28 * 0/03 0/41 0/05 0/08 0/07 T 2/79 2/29 1/12 2/45 0/84 2/25 1/96 2/06 182/20±44/82 183/33±35/42 113/10±73/86 141/44±65/93 110/50±39/41 102/00±34/16 42/30±3/23 40/55±3/04 ± 194/80±41/94 168/00±36/51 126/40±75/45 118/22±74/29 103/50±32/84 82/22±26/29 40/80±2/20 41/66±4/24 ) ( ) ( LDLC ) ( HDLC ) ( (P< 0/05) * :HDLC :LDLC (P< 0/05).(3) (p<0/05) (p<0/05).(p>0/05)
5 U 3 ( 6= 10= ) 0/13 0/00 Z 1/51 3/02 0/76 * 0/03 * 0/00 0/44 Z 0/30 2/09 2/80 0/77 6/72±5/60 5/36±5/35 622/30±586/64 543/11±510/64 ± 6/10±3/83 5/20±4/95 976/98±849/16 585/10±520/13 ( ) ( ) (P<0/05) (P< 0/05) * HDLC.(4 ) (p>0/05) LDLC 4 ( 10=) 0/13 0/33 0/15 0/37 r 0/39 0/15 0/35 0/11 0/24 0/39 0/22 0/33 r 0/24 0/09 0/27 LDL 0/15 HDL :HDLC :LDLC.(1 ) (p<0/05) P= / r = / ( ) ( ) 8 1
6 , HDLC HDLC i FNDC FNDC i Fibronectin type III domain containing 5 (FNDC5)
7 .. mrna... FNDC5. mrna. FNDC5. mrna.. : UCP1.. UCP (AMPK) i AMP i AMPactivated protein kinase (AMPK)
8 , References 1. Miles L. Physical activity and health. Nutr Bull 2007; 32: Cannon B, Nedergaard J. Brown adipose tissue: function and physiological significance. Physiol Rev 2004; 84: De Matteis R, Lucertini F, Guescini M, Polidori E, Zeppa S, Stocchi V, et al. Exercise as a new physiological stimulus for brown adipose tissue activity. Nutr Metab Cardiovasc Dis 2013; 23: Fenzl A, Kiefer FW. Brown adipose tissue and thermogenesis. Horm Mol Biol Clin Investig 2014; 19: Wang S, Yang X. Interorgan regulation of adipose tissue browning. Cell Mol Life Sci 2017; 74: Kim Hj, So B, Choi M, Kang D, Song W. Resistance exercise training increases the expression of irisin concomitant with improvement of muscle function in aging mice and humans. Exp Gerontol 2015; 70: MorenoNavarrete JM, Ortega F, Serrano M, Guerra E, Pardo G, Tinahones F, et al. Irisin is expressed and produced by human muscle and adipose tissue in association with obesity and insulin resistance. J Clin Endocrinol Metab 2013; 98: E769E Moienneia N, Hosseini SRA. Acute and chronic responses of metabolic myokine to different intensities of exercise in sedentary young women. Obes Med 2016; 1: Ellefsen S, Vikmoen O, Slettaløkken G, Whist JE, Nygaard H, Hollan I, et al. Irisin and FNDC5: effects of 12week strength training, and relations to muscle phenotype and body mass composition in untrained women. Eur J Appl Physiol 2014; 114: Qiu S, Cai X, Sun Z, Schumann U, Zügel M, Steinacker JM. Chronic exercise training and circulating irisin in adults: a metaanalysis. Sports Med 2015; 45: ScharhagRosenberger F, Meyer T, Wegmann M, Ruppenthal S, Kaestner L, Morsch A, et al. Irisin does not mediate resistance traininginduced alterations in resting metabolic rate. Med Sci Sports Exerc 2014; 46: Huh J, Dincer F, Mesfum E, Mantzoros C. Irisin stimulates muscle growthrelated genes and regulates adipocyte differentiation and metabolism in humans. Int J Obes (Lond) 2014; 38: Shan T, Liang X, Bi P, Kuang S. Myostatin knockout drives browning of white adipose tissue through activating the AMPKPGC1αFndc5 pathway in muscle. FASEB J 2013; 27: Sun WX, Dodson MV, Jiang ZH, Yu SG, Chu WW, Chen J. Myostatin inhibits porcine intramuscular preadipocyte differentiation in vitro. Domest Anim Endocrinol 2016; 55: Saremi A, Gharakhanloo R, Sharghi S, Gharaati M, Larijani B, Omidfar K. Effects of oral creatine and resistance training on serum myostatin and GASP1. Mol Cell Endocrinol 2010; 317: Walker Ks, Kambadur R, Sharma M, Smith Hk. Resistance Training Alters Plasma Myostatin but not IGF1 in Healthy Men. Med Sci Sports Exerc 2004; 36: Manini Tm TM, Vincent KR, Leeuwenburgh CL, Lees HA, Kavazis AN, Borst SE, et al. Myogenic and proteolytic mrna expression following blood flow restricted exercise. Acta Physiol (Oxf) 2011; 201: Willoughby DS. Effects of heavy resistance training on myostatin mrna and protein expression. Med Sci Sports Exerc 2004; 36: Oelmann S, Nauck M, Völzke H, Bahls M, Friedrich N. Circulating Irisin Concentrations Are Associated with a Favourable Lipid Profile in the General Population. PLoS One 2016; 11: e Tang S, Zhang R, Jiang F, Wang J, Chen M, Peng D, et al. Circulating irisin levels are associated with lipid and uric acid metabolism in a Chinese population. Clin Exp Pharmacol Physiol 2015; 42: Suzuki STN, Zhao B, Yang J. Enhanced muscle by myostatin propeptide increases adipose tissue adiponectin, PPARα, and PPARγ expressions. Biochem Biophys Res Commun 2008; 369: Gordon B, Chen S, Durstine JL. The effects of exercise training on the traditional lipid profile and beyond. Curr Sports Med Rep 2014; 13: American College of Sports Medicine. American College of Sports Medicine position stand. Progression models in resistance training for healthy adults. Med Sci Sports Exerc 2009; 41: Nascimento MAd, Cyrino ES, Nakamura FY, Romanzini M, Pianca HJC, Queiróga MR. Validation of the Brzycki equation for the estimation of 1RM in the bench press. Rev Bras Med Esporte 2007; 13: Borges Bastos CL1, Miranda H, Vale RG, Portal Mde N, Gomes MT, Novaes Jda S, et al. Chronic effect of static stretching on strength performance and basal serum IGF1 levels. J Strength Cond Res 2013; 27: Brzycki M. Strength Testing Predicting a OneRep Max from RepstoFatigue. J Phys Edu Recreat Dance 1993; 64: Norheim F, Langleite TM, Hjorth M, Holen T, Kielland A, Stadheim HK, et al. The effects of acute and chronic exercise on PGC1α, irisin and browning of subcutaneous adipose tissue in humans. FEBS J 2014; 281: Raschke S, Elsen M, Gassenhuber H, Sommerfeld M, Schwahn U, Brockmann B, et al. Evidence against a beneficial effect of irisin in humans. PLoS One 2013; 8: e Park KH, Zaichenko L, Brinkoetter M, Thakkar B, SahinEfe A, Joung KE, et al. Circulating irisin in relation to insulin resistance and the metabolic syndrome. J Clin Endocrinol Metab 2013; 98: Conn VS, Koopman RJ, Ruppar TM, Phillips LJ, Mehr DR, Hafdahl AR. Insulin sensitivity following exercise interventions: systematic review and metaanalysis of outcomes among healthy adults. J Prim Care Community Health 2014; 5: Qiu S, Cai X, Yin H, Zügel M, Sun Z, Steinacker JM, et al. Association between circulating irisin and insulin resistance in nondiabetic adults: A metaanalysis. Metabolism 2016; 65: Lehti M, Donelan E, Abplanalp W, AlMassadi O, Habegger K, Weber J, et al. Highdensity lipoprotein maintains skeletal muscle function by modulating cellular respiration in mice. Circulation 2013; 128: Diel P, Schiffer T, Geisler S, Hertrampf T, Mosler S, Schulz S, et al. Analysis of the effects of androgens and training on myostatin propeptide and follistatin concentrations in blood and skeletal muscle using highly sensitive immuno PCR. Mol Cell Endocrinol 2010; 330: Hofmann M, SchoberHalper B, Oesen S, Franzke B, Tschan H, Bachl N, et al. Effects of elastic band
9 resistance training and nutritional supplementation on muscle quality and circulating muscle growth and degradation factors of institutionalized elderly women: the Vienna Active Ageing Study (VAAS). Eur J Appl Physiol 2016; 116: Suetta C, Frandsen U, Mackey AL, Jensen L, Hvid LG, Bayer ML, et al. Ageing is associated with diminished muscle regrowth and myogenic precursor cell expansion early after immobilityinduced atrophy in human skeletal muscle. J Physiol 2013; 591: Lopaschuk GD. Uncoupling proteins as mediators of mitochondrial metabolic rates. Heart Metabolism 2016; 69: GarcíaFontana B, ReyesGarcía R, MoralesSantana S, ÁvilaRubio V, MuñozGarach A, RozasMoreno P, et al. Relationship between myostatin and irisin in type 2 diabetes mellitus: a compensatory mechanism to an unfavourable metabolic state? Endocrine 2016; 52: 5462.
10 67/Iranian Journal of Endocrinology and Metabolism Vol 19 No.1 AprilMay 2017 Original Article Effects of Strength Training on Serum Levels of Irisin and Myostatin Hormones, and Their Association with Lipid Profiles in Untrained Women Izaddoust F, Shabani R Physical Education and Sports Sciences, Rasht Branch, Islamic Azad University, Rasht, I.R. Iran fa.izaddoust@gmail.com Received: 21/01/2017 Accepted: 13/03/2017 Abstract Introduction: It seems that, relatively studies have examined the effects of strength training on irisin and myostatin hormones and to date, the association between irisin and myostatin with blood lipids in response to strength training has been assessed. Therefore, the purpose of this study was to investigate the effect of strength training on serum level of irisin and myostatin hormones, and their association with lipid profile in untrained women. Materials and Methods: In a semi experimental study 16 active untrained women were randomly assigned into two, the training (n=10; body mass index: 23.45±2.83 kg/m2) and the control (n=6; age; body mass index: 23.28±2.62 kg/m2) groups. The strength training program consisted of 8 weeks, three sessions per week, each session 65 minutes. Serum levels of irisin, myostatin and lipid profile concentrations were measured before and 24 hours the after last training session. Data analyses were performed using SPSS version 22 and significance was assigned at P<0.05. Results: Results showed significant decrease in levels of cholesterol and myostatin in the training group (P<0.05) with a strong correlation between irisin and myostatin levels after 8 weeks of training (P<0.05). However no correlation were seen between irisin and myostatin with lipid profile (p>0.05). Conclusion: In conclusion the results of the study demonstrated that strength training can have favorable effects on myostatin and cholesterol serum levels in untrained women and that myostatin level is strongly correlated with irisin. Keywords: Strength training, Irisin, Myostatin, Lipid profile
Downloaded from ijem.sbmu.ac.ir at 22: on Thursday March 7th PGC1-α
( ) 1 2 2 1 (2 (1 : - 14398-1317 : e-mail: Soorirahman@ut.ac.ir :. PGC1-α :. ( ) -. ( ) ). ( (p= /) :. -HDL.(p= / ) LDL (p< / ).(p< / ) HDL :.(p< / )... - : / / : / / : / / :. 1970-30 5 6. 2 7 8.. 1-3.
More informationHot Topics in Translational Endocrinology Endocrine Research
JCEM ONLINE Hot Topics in Translational Endocrinology Endocrine Research Exercise-Induced Irisin Secretion Is Independent of Age or Fitness Level and Increased Irisin May Directly Modulate Muscle Metabolism
More informationAssociation of serum adipose triglyceride lipase levels with obesity and diabetes
Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationPork Consumption and serum irisin levels in type 2 diabetes
Pork Consumption and serum irisin levels in type 2 diabetes 3B-110 Report prepared for the Co-operative Research Centre for Integrative Pork By Prof Manohar L Garg Dr Rachel Wong Prof Peter RC Howe Nutraceuticals
More informationHigh-Intensity Exercise Causes Greater Irisin Response Compared with Low-Intensity Exercise under Similar Energy Consumption
Tohoku J. Exp. Med., 2014, 233, 135-140 Irisin Response to Acute Exercise 135 High-Intensity Exercise Causes Greater Irisin Response Compared with Low-Intensity Exercise under Similar Energy Consumption
More informationPerspective. Irisin and musculoskeletal health ANNALS OF THE NEW YORK ACADEMY OF SCIENCES MARROW
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES MARROW Perspective Graziana Colaianni, 1 Saverio Cinti, 2 Silvia Colucci, 1,a and Maria Grano 3,a 1 Department of Basic Medical
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More information( ) Downloaded from ijem.sbmu.ac.ir at 20: on Friday March 22nd 2019 VEFG. HIIT. MICT. :.
( ) VEFG 2 1 1 ( ) (2 (1 : ( e-mail: Mostafa.rahimi20@gmail.com (MICT) (HIIT) :. (VEGF) ( ± ) :. (HIIT) (MICT) MICT. HIIT.. :. Real-time RT-PCR (P / ) VEGF.(P / ) :. : 96/5/15 : 96/4/20 96//6 : 1 2014
More informationPlasma irisin levels progressively increase in response to increasing exercise workloads in young, healthy, active subjects
171:3 343 352 Plasma irisin levels progressively increase in response to increasing exercise s in young, healthy, active subjects Stella S Daskalopoulou 1,2,*,, Alexandra B Cooke 1,*, Yessica-Haydee Gomez
More informationResearch Communication Circulating Serum Irisin Levels in Obesity and Type 2 Diabetes Mellitus
Research Communication Circulating Serum Irisin Levels in Obesity and Type 2 Diabetes Mellitus Amira Shoukry 1 * Sally M. Shalaby 2 Shereen El-Arabi Bdeer 3 Amira A. Mahmoud 1 Mayada M. Mousa 1 Ashraf
More informationIncreased FNDC5 is associated with insulin resistance in high fat-fed mice
ORIGINAL RESEARCH Physiological Reports ISSN 2051-817X Increased FNDC5 is associated with insulin resistance in high fat-fed mice Brianne L. Guilford 1, Jake C. Parson 1, Caleb W. Grote 2, Stephanie N.
More informationThe Relationship of BMI, Fat Percentage, and Waist-Hip Ratio to Physical Fitness Factors in Female Students
J. Basic. Appl. Sci. Res., 3(3)1273-1278, 2013 2013, TextRoad Publication ISSN 2090-4304 Journal of Basic and Applied Scientific Research www.textroad.com The Relationship of BMI, Fat Percentage, and Waist-Hip
More informationResponses of blood lipids to aerobic and resistance type of exercise
Responses of blood lipids to aerobic and resistance type of exercise Labros Sidossis, Ph.D. Laboratory of Nutrition and Clinical Dietetics Harokopio University of Athens, Greece Triacylglycerol structure
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationIrisin: fat or artefact
Clinical Endocrinology (2015) 82, 467 474 doi: 10.1111/cen.12627 REVIEW ARTICLE Irisin: fat or artefact A.B. Crujeiras*,,1, M. Pardo*,,1 and F.F. Casanueva*, *Laboratory of Molecular and Cellular Endocrinology,
More informationImpact of Physical Activity on Metabolic Change in Type 2 Diabetes Mellitus Patients
2012 International Conference on Life Science and Engineering IPCBEE vol.45 (2012) (2012) IACSIT Press, Singapore DOI: 10.7763/IPCBEE. 2012. V45. 14 Impact of Physical Activity on Metabolic Change in Type
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationCRP. Downloaded from ijdld.tums.ac.ir at 7:15 IRDT on Friday July 20th 2018 CRP HDL CRP FBS. t-student. correlation CRP
214-220 (2 ) 10 1389 -.. 1 2 1* 1 :. 21 40 :. HDL (TG) (FBS)... correlation t-student t :.(P=0/001) TG. (P=0/004) HDL : HDL FBS... : -1-2 ( )... : afagh_anjomshoaa@yahoo.com : 0241-7270815 : 0241-7270814
More informationEffect of aerobic training and resistance training on circulating irisin level and their association
Effect of aerobic training and resistance training on circulating irisin level and their association with change of body composition in overweight/obese adults: a pilot study 1 Hee-jae Kim, 1 Hyo -Joo
More informationSkeletal muscle AMPK is essential for the maintenance of FNDC5 expression
ORIGINAL RESEARCH Physiological Reports ISSN 251-817X Skeletal muscle AMPK is essential for the maintenance of FNDC5 expression James S. V. Lally 1, Rebecca J. Ford 1, Jasper Johar 1, Justin D. Crane 1,
More informationSerum irisin and its regulation by hyperinsulinemia in women with polycystic ovary syndrome
2016, 63 (12), 1107-1112 Original Serum irisin and its regulation by hyperinsulinemia in women with polycystic ovary syndrome Agnieszka Adamska 1), Monika Karczewska-Kupczewska 2), 3), Agnieszka Łebkowska
More informationATHEROSCLEROTIC cardiovascular complications are the leading cause of. Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease
Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease To Decrease Plasma Adiponectin Levels Kuei-Chuan CHAN, 1 MD, Hsi-Hsien CHOU, 1 PhD, Der-Jinn WU, 1 PhD, Yi-Liang WU, 1 MD, and Chien-Ning
More informationThe Journal of International Medical Research 2010; 38:
The Journal of International Medical Research 2010; 38: 782 791 Resistance Exercise Did Not Alter Intramuscular Adipose Tissue but Reduced Retinol-binding Protein-4 Concentration in Individuals with Type
More informationObesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea
https://doi.org/10.7180/kmj.2016.31.2.157 KMJ Original Article Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea Ju Won Lee, Nam Kyu Kim, Hyun Joon Park,
More informationBackground/Purpose. Conclusion. Keywords: body composition, insulin resistance, irisin, lean muscle mass, obesity.
Obesity Science doi: 10.1002/osp4.43 ORIGINAL ARTICLE Relationships between serum irisin levels and metabolic parameters in Japanese patients with obesity Yaeko Fukushima 1, Satoshi Kurose 1,2, Hiromi
More informationHypertension and beyond does circulating irisin matter?
REVIEW Hypertension and beyond does circulating irisin matter? Aleksandra Taszarek, Anna Kaczmarkiewicz, Tomasz Miazgowski Department of Hypertension and Internal Medicine, Pomeranian Medical University,
More informationStudy of the correlation between growth hormone deficiency and serum leptin, adiponectin, and visfatin levels in adults
Study of the correlation between growth hormone deficiency and serum leptin, adiponectin, and visfatin levels in adults Z.-P. Li 1, M. Zhang 2, J. Gao 3, G.-Y. Zhou 3, S.-Q. Li 1 and Z.-M. An 3 1 Golden
More informationRelationship of Waist Circumference and Lipid Profile in Children
International Journal of Biomedical Science and Engineering 2015; 3(3): 44-48 Published online May 28, 2015 (http://www.sciencepublishinggroup.com/j/ijbse) doi: 10.11648/j.ijbse.20150303.12 ISSN: 2376-7227
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationAssociation between irisin and major chronic diseases: a review
European Review for Medical and Pharmacological Sciences 2016; 20: 4072-4077 Association between irisin and major chronic diseases: a review M.C. GOUVEIA, J.P. VELLA, F.R. CAFEO, F.L. AFFONSO FONSECA,
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationCirculating Betatrophin Levels Are Associated with the Lipid Profile in Type 2 Diabetes
Original Article www.cmj.ac.kr Circulating Betatrophin Levels Are Associated with the Lipid Profile in Type 2 Diabetes Hassan Ghasemi, Heidar Tavilani, Iraj Khodadadi, Massoud Saidijam 1 and Jamshid Karimi*
More informationAssociation of circulating irisin levels with normal weight obesity, glycemic and lipid profile
Mehrabian et al. Journal of Diabetes & Metabolic Disorders (2016) 15:17 DOI 10.1186/s40200-016-0239-5 RESEARCH ARTICLE Association of circulating irisin levels with normal weight obesity, glycemic and
More informationAerobic exercise increases meteorin-like protein in muscle and. adipose tissue of chronic high-fat diet-induced obese mice
BioMed Research International Aerobic exercise increases meteorin-like protein in muscle and adipose tissue of chronic high-fat diet-induced obese mice Ju Yong Bae 1 Correspondence should be addressed
More informationImpacts of combining aerobic exercises with resistance training on chemerin level in obese undergraduates.
Biomedical Research 2017; Special Issue: S654-S658 ISSN 0970-938X www.biomedres.info Impacts of combining aerobic exercises with resistance training on chemerin level in obese undergraduates. Jianyong
More information1389 (54 )1 - *** *** *** ** *** * * ** *** ( ) : /8/26 : 88/2/1 : (WC) (BMI) :.. (CVD) - : :
JQUMS, Vol.14, No.1, Spring 2010 18 Predicting risk factors of cardiovascular disease according to anthropometric measures in children and adolescents R Kelishadi* M Hashemipour** Z Faghihimani*** E Nazemi***
More informationThe Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women
Brief Report The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Nasrin Zaer Ghodsi (MSc) Department of Physical Education,
More informationHealth Innovations Research Institute (Annual Meeting 2012) Metabolism, Exercise and Disease (MED) Skeletal muscle in health and disease
Health Innovations Research Institute (Annual Meeting 2012) Metabolism, Exercise and Disease (MED) Skeletal muscle in health and disease John A. Hawley, Ph.D. Exercise Metabolism Group School of Medical
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More information*Corresponding author: Mohammadreza Esmaelzadeh toloee, Assistance Professor of Exercise Physiology, Shomal University,
International Journal of Applied Exercise Physiology 2322-3537 www.ijaep.com Vol.6 No.3 Received: April 2017, Accepted: August 2107, Available online: October 2017 The effect of 8 weeks of Circuit Resistance
More informationKeeping Senior Muscle Strong
Keeping Senior Muscle Strong Some Terms Hypertrophy Growth of muscle cell Gain in mass Gain in muscle strength Atrophy Reduced contractile properties Increased adipose cell infiltration Sarcopenia Age
More informationInteractions of exercise and diet in health prevention
Interactions of exercise and diet in health prevention Dr Jason Gill Institute of Cardiovascular and Medical Sciences University of Glasgow Physical activity and health outcomes does one size fit all?
More information9/2/2016. Faculty. Physical Activity and Obesity: How to Get Your Patients Moving. Learning Objectives. Disclosures. Identify the Target
Faculty Physical Activity and Obesity: How to Get Your Patients Moving Deborah Bade Horn, DO, MPH, FOMA President, Obesity Medicine Association Medical Director Center for Obesity Medicine & Metabolic
More informationEffects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
More informationEffects of Combined Exercise Training on Osteocalcin, Body Weight, and Inflammatory Markers Among Pre-Obese Women
Med. J. Cairo Univ., Vol. 83, No. 2, December: 233-238, 2015 www.medicaljournalofcairouniversity.net Effects of Combined Exercise Training on Osteocalcin, Body Weight, and Inflammatory Markers Among Pre-Obese
More informationNo Positive Effects of Running with Sports Compression Socks on Leg Muscle Oxygen Saturation or Muscle Injury Biomarkers
Kajsa Rennerfelt, MD, PhD; Sophia Lindorsson, MD; Helena Brisby, MD, PhD; Adad Baranto, MD, PhD; Qiuxia Zhang, PhD Institute of Clinical Sciences, Dept. of Orthopedics, Sahlgrenska Academy, Kajsa Rennerfelt,
More informationIncreased oxidative stress according to number of risk factors in metabolic syndrome patients
University of Londrina, Paraná, Brazil Increased oxidative stress according to number of risk factors in metabolic syndrome patients Danielle Venturini, PhD 2016 Venturini, Danielle 1*, Alves, Caroline
More informationAssociations of betatrophin levels with irisin in Chinese women with normal glucose tolerance
Xie et al. Diabetology & Metabolic Syndrome (2015) 7:26 DOI 10.1186/s13098-015-0019-2 DIABETOLOGY & METABOLIC SYNDROME RESEARCH Open Access Associations of betatrophin levels with irisin in Chinese women
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationPhysical activity and exercise in the regulation of adipose mass and function
Physical activity and exercise in the regulation of adipose mass and function Key Questions What is the impact of exercise on adipose and fat metabolism? To what extent does exercise and physical activity
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationMassoud Houshmand National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
QUID 2017, pp. 669-673, Special Issue N 1- ISSN: 1692-343X, Medellín-Colombia NON-GENE REGION AND INFLUENCES TUMOR CHARACTERISTICS BY LOW-RISK ALLELES IN BREAST CANCER (Recibido el 21-06-2017. Aprobado
More informationMetabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
More informationsdldl. Downloaded from ijdld.tums.ac.ir at 3:37 IRDT on Saturday April 28th 2018 sdldl sdldl 2*
390-396 (4 ) 9 1389. 0 sdldl * 1 1 1 1 1 1. :. sdldl... : 91 5 1 0 13 5 sdldl. HDL :. :. sdldl : - : emrc@tums.ac.ir : 01-88005 : 01-880037 : -1 88/10/5 : 88/9/0 : 88/6/10: 391... : A LDL. 1 (LBLDL) B.
More informationTHE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE. Key Points
December 2008 (Vol. 1, Issue 3, pages 31-35) THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE By Uberto Pagotto, MD, PhD Endocrinology Unit and Center of Applied Biomedical Research (C.R.B.A.), Department
More informationOrthopaedic Related Conditions Literature Review
Orthopaedic Related Conditions Literature Review Louis Cheung Department of Orthopaedics & Traumatology The Chinese University of Hong Kong From: mydesultoryblog.com General Facts of Skeletal Muscles 40
More informationThis document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore.
This document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore. Title Author(s) Citation Irisin treatment improves healing of dystrophic skeletal muscle Reza, Musarrat Maisha;
More informationSkeletal Muscle Is an Endocrine Organ
J Pharmacol Sci 125, 125 131 (2014) Journal of Pharmacological Sciences The Japanese Pharmacological Society Current Perspective Skeletal Muscle Is an Endocrine Organ Kenji Iizuka 1, *, Takuji Machida
More informationMATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS
Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181
More informationTHE IMPORTANCE OF EXERCISE FOR THE OVERWEIGHT AND OBESE PATIENT. Anneliese Piazza, MS, CPT
THE IMPORTANCE OF EXERCISE FOR THE OVERWEIGHT AND OBESE PATIENT Anneliese Piazza, MS, CPT Benefits of Exercise Increases energy expenditure and may result in weight loss Helps maintain or build muscle
More informationIn recent years, the interaction between adipose and muscle
JCEM ONLINE Advances in Genetics Endocrine Research Irisin Is Expressed and Produced by Human Muscle and Adipose Tissue in Association With Obesity and Insulin Resistance José María Moreno-Navarrete, Francisco
More informationAdipose tissue dysfunction in obesity. Gijs Goossens, PhD
Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More informationIrisin: a new molecular marker and target in metabolic disorder
Chen et al. Lipids in Health and Disease 2015, 14:2 REVIEW Irisin: a new molecular marker and target in metabolic disorder Jia-qi Chen 1,2, Yue-ye Huang 1, Aaron M Gusdon 3 and Shen Qu 1,2* Open Access
More informationDyslipidemia and Its Relation with Body Mass Index Versus Waist Hip Ratio
Dyslipidemia and Its Relation with Body Mass Index Versus Waist Hip Ratio Pages with reference to book, From 308 To 310 Abdul Jabbar, Asad Irfanullah, Jaweed Akhter, Y.K. Mirza ( Department of Medicine,
More informationDownloaded from journal.gums.ac.ir at 7:37 IRST on Sunday February 17th 2019
BMI * (PhD) - (PhD) -. (MA) * : fatameh_zorofi@yahoo.com : 9/08/0 : 9/06/6:.. :. (0) ). - 7 - ( () /( ) ) BMI : 0 60. :.. 60 :. 9. (LDL) (HDL) seca. t.. 0/05. HDL : BMI. LDL. HDL :.. 7-8 : / / / / : ()
More informationTime-Dependent Changes in Increased Levels of Plasma Irisin and Muscle PGC-1α and FNDC5 after Exercise in Mice
Tohoku J. Exp. Med., 2018, 244, 93-103 Effect of Exercise on PGC-1α and FNDC5 Expression 93 Time-Dependent Changes in Increased Levels of Plasma Irisin and Muscle PGC-1α and FNDC5 after Exercise in Mice
More informationLeptin levels and menstrual function in HIV-infected women in rural India
Leptin levels and menstrual function in HIV-infected women in rural India Annie Phoebe. K¹, Mini Jacob.S¹, Hemalatha.R², Sivakumar M.R¹ ¹Department of Experimental Medicine, The Tamil Nadu Dr. MGR Medical
More informationPolarized Training Striking a Balance Between High-Volume and High-Intensity Training
Polarized Training Striking a Balance Between High-Volume and High-Intensity Training Frankie TAN, PhD Senior Sports Physiologist Singapore Sports Institute 1 Introduction Exercise intensity and its distribution
More informationA novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
More informationTHE EFFECT OF EIGHT WEEKS HIGH INTENSITY INTERVAL TRAINING (HIIT) ON SERUM AMOUNTS OF FGF21 AND IRISIN IN SEDENTARY OBESE WOMEN
The Journal of Urmia University of Medical Sciences, Vol. 28(7), October 2017 Original Article THE EFFECT OF EIGHT WEEKS HIGH INTENSITY INTERVAL TRAINING (HIIT) ON SERUM AMOUNTS OF FGF21 AND IRISIN IN
More informationAssociation of Current and Past Smoking with Metabolic Syndrome in Men
J Prev Med Public Health 2009;42():160-164 DOI: 10961jpmph200942160 Association of Current and Past Smoking with Metabolic Syndrome in Men A-Rum Hong Kang-Sook Lee 1) Seon-Young Lee 1) Jae-Hee Yu 1) Graduate
More informationOriginal Article Effect of obesity and hyperglycemia on benign prostatic hyperplasia in elderly patients with newly diagnosed type 2 diabetes
Int J Clin Exp Med 2015;8(7):11289-11294 www.ijcem.com /ISSN:1940-5901/IJCEM0007877 Original Article Effect of obesity and hyperglycemia on benign prostatic hyperplasia in elderly patients with newly diagnosed
More informationRelationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with Normal Body Mass Index
J Bone Metab 2015;22:99-106 http://dx.doi.org/10.11005/jbm.2015.22.3.99 pissn 2287-6375 eissn 2287-7029 Original Article Relationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with
More informationPregnanolone effects on the blood pressure of stress-induced hypertension in rats
Acta Physiologica Sinica August June 25 25 2004 2004 56 56 (3) (4) 269-274 471-475 http//www.actaps.com.cn 471 * 130021 (pregnanolone ) (stress-induced hypertension SIH) (0.24 mg/kg) (angiotensin Ang )
More informationSNPs in FNDC5 (irisin) are associated with obesity and modulation of glucose and lipid metabolism in Saudi subjects
Al-Daghri et al. Lipids in Health and Disease (2016) 15:54 DOI 10.1186/s12944-016-0224-5 RESEARCH Open Access SNPs in FNDC5 (irisin) are associated with obesity and modulation of glucose and lipid metabolism
More informationBEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
More informationMamofillin New aesthetic perspective
New aesthetic perspective info@ White adipose tissue (WAT) White adipose tissue (WAT) is the prevalent type in human adults functioning as the major storage site for the lipids absorbed from daily intake
More informationManagement of Obesity in Postmenopausal Women
Management of Obesity in Postmenopausal Women Yong Seong Kim, M.D. Division of Endocrinology and Metabolism Inha University College of Medicine & Hospital E mail : yongskim@inha.ac.kr Abstract Women have
More informationAlpha Lipoic Acid Snapshot Monograph
vitamins minerals nutrients Alpha Lipoic Acid Snapshot Monograph Alpha lipoic Acid Most Frequent Reported Uses: - Antioxidant - Peripheral neuropathy - Improves insulin signaling and regulation of appetite
More informationDownloaded from umj.umsu.ac.ir at 19: on Friday March 22nd 2019
* 1392/06/28 1392/04/27 :.. : (DHA EPA )....(p
More informationTHE EFFECT OF EIGHT WEEKS OF AEROBIC RUNNING ON THE LIPOPROTEINS AND LIPID CONCENTRATION FACTORS IN MALE ATHLETES
Journal of Optoelectronics and Biomedical Materials Vol. 3 Issue 3, July September 2011 p. 57-61 THE EFFECT OF EIGHT WEEKS OF AEROBIC RUNNING ON THE LIPOPROTEINS AND LIPID CONCENTRATION FACTORS IN MALE
More informationThe changes of subtypes in pediatric diabetes and their clinical and laboratory characteristics over the last 20 years
Original article http://dx.doi.org/10.6065/apem.2016.21.2.81 Ann Pediatr Endocrinol Metab 2016;21:81-85 The changes of subtypes in pediatric diabetes and their clinical and laboratory characteristics over
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More informationCORRELATION BETWEEN PHYSICAL FITNESS AND BODY
IJCRR Vol 05 issue 23 Section: Healthcare Category: Research Received on: 01/10/13 Revised on: 28/10/13 Accepted on: 11/11/13 CORRELATION BETWEEN PHYSICAL FITNESS AND BODY MASS INDEX Sameer Srivastava
More informationSHORT-TERM AND LONG-TERM EFFECT OF OXYTOCIN ON THE MORPHOLOGY AND FUNCTIONAL ACTIVITY OF FEMALE RAT SUBCUTANEOUS ADIPOSE TISSUE. P.
PROCEEDINGS OF THE BALKAN SCIENTIFIC CONFERENCE OF BIOLOGY IN PLOVDIV (BULGARIA) FROM 19 TH TILL 21 ST OF MAY 2005 (EDS B. GRUEV, M. NIKOLOVA AND A. DONEV), 2005 (P. 739 743) SHORT-TERM AND LONG-TERM EFFECT
More informationTHE EFFECT OF EIGHT WEEKS ENDURANCE TRAINING ON APELIN RECEPTOR GENE EXPRESSION IN ADIPOSE TISSUE OF OLD MALE RATS
THE EFFECT OF EIGHT WEEKS ENDURANCE TRAINING ON APELIN RECEPTOR GENE EXPRESSION IN ADIPOSE TISSUE OF OLD MALE RATS Zahra Rostami Angasi and Asieh Abbassi Daloii Department of Sport Physiology, Ayatollah
More informationNon-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure. By: Jessica Chan & Dayna Weststeyn
Non-shivering thermogenesis is found in tissues other than brown adipose tissue during cold exposure By: Jessica Chan & Dayna Weststeyn Hypothesis The hypothesis for this point presentation is that non-shivering
More informationRelationship between body fat percentage and forced vital capacity in adults with normal body mass index
Journal of Physics: Conference Series PAPER OPEN ACCESS Relationship between body fat percentage and forced vital capacity in adults with normal body mass index To cite this article: RA Safira and N Nusdwinuringtyas
More informationEffects of a Stroke Primary Prevention Program on Risk Factors for At-Home Elderly
e-issn 1643-3750 DOI: 10.12659/MSM.895519 Received: 2015.07.31 Accepted: 2015.08.29 Published: 2015.11.28 Effects of a Stroke Primary Prevention Program on Risk Factors for At-Home Elderly Authors Contribution:
More informationRelation of Muscle Indices with Metabolic Parameters and C-Peptide in Type 2 Diabetes Mellitus
ORIGINAL ARTICLE Relation of Muscle Indices with Metabolic Parameters and C-Peptide in Type 2 Diabetes Mellitus Sabah Tuzun 1, Can Oner 1, M. Resat Dabak 1, Halim Omer Kasikci 1 and Mehmet Sargin 2 ABSTRACT
More informationGonadal Dysfunction with Postprandial Hypertriglyceridemia is Risk Predictor of Cardiovascular Disease in Men with Type 2 Diabetes Mellitus
Iraqi JMS Published by Al-Nahrain College of Medicine ISSN 1681-6579 Email: iraqijms@colmed-alnahrain.edu.iq http://www.colmed-nahrain.edu.iq Gonadal Dysfunction with Postprandial Hypertriglyceridemia
More informationBrown Adipose Tissue: Research Milestones of a Potential Player in Human Energy Balance and Obesity
774 Review Brown Adipose Tissue: Research Milestones of a Potential Player in Human Energy Balance and Obesity Author Affiliation B. Zafrir Department of Cardiovascular Medicine, Lady Davis Carmel Medical
More informationMETABOLIC SYNDROME IN REPRODUCTIVE FEMALES
METABOLIC SYNDROME IN REPRODUCTIVE FEMALES John J. Orris, D.O., M.B.A Division Head, Reproductive Endocrinology & Infertility, Main Line Health System Associate Professor, Drexel University College of
More informationEffects of Conjugated Linoleic Acid and Eight Weeks of Resistance Training on Body Composition in Athletes Set Parham Clubs in the Shiraz city
J. Appl. Environ. Biol. Sci., 5(S)33-347, 2015 2015, TextRoad Publication ISSN: 200-4274 Journal of Applied Environmental and Biological Sciences www.textroad.com Effects of Conjugated Linoleic Acid and
More informationDiabetes Care Publish Ahead of Print, published online August 19, 2010
Diabetes Care Publish Ahead of Print, published online August 19, 2010 Neck circumference positively related with central obesity, overweight and metabolic syndrome in Chinese people with type 2 diabetes:
More informationMyocardial lipid accumulation and lipotoxicity in heart failure
Myocardial lipid accumulation and lipotoxicity in heart failure P. Christian Schulze, MD, PhD New York - Presbyterian Hospital, Columbia University Medical Center, Division of Cardiology, New York, NY,
More informationCAD1. Public health Diet Physical activity Non-smoking
Adipokines and myokines are important for several biological effects of adipose tissue and skeletal muscle as well as health NuGO week 2017, Varna, Bulgaria Christian A. Drevon Department of Nutrition,
More information