Regulation of adipose tissue remodeling by peripheral serotonin
|
|
- Loren Hunter
- 5 years ago
- Views:
Transcription
1 Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry
2 Serotonin (5-HT) is a signaling molecule Hemostasis Vasoconstriction GI motility Anxiety Depression Food intake Sleep Nat Rev Neurosci. 23 2
3 Serotonin is synthesized from Tryptophan Tryptophan Tryptophan Hydroxylase 5-HTP (Tph) AADC 5-HT (serotonin) 3
4 Two separated pools of serotonin Peripheral serotonin Neuronal serotonin Tryptophan 5-HTP AADC Tph1 5-HT (serotonin) BBB Tryptophan Tph2 5-HTP AADC 5-HT (serotonin) 4
5 Serotonin receptors 5
6 Central serotonin is an anorectic neurotransmitter Tecott LH, Cell Metabolism, 27 6
7 Depletion of brain serotonin induces hyperphagia and body weight gain Tryptophan Tph 5-HTP PCPA (p-chloro phenylalanine) AADC 5-HT (serotonin) Breisch ST et al, Science,
8 Extracellular 5-HT levels were increased in the ventral hippocampus of SERT KO rats Homberg et al. Neuroscience, 27 8
9 SERT KO mice show obese phenotypes Murphy DL, Nat Rev Neurosci, 28 Chen X et al. PLOS One 7, 212 9
10 Genetic evidences for serotonin in obesity Association of Variations in TPH1 and HTR2B with Gestational Weight Gain and Measures of Obesity. Kwak SH et al. Obesity, 212 Association of variations in HTR2A with the different effects on BMI in men and women. Li P et al. Intl J Obesity, 213 Association of polymorphisms in HTR2A with increased energy and fat intake in French children. Herberth et al. Am J Clin Nutr, 25 Plasma serotonin is increased in diabetic patients. Pietraszek MH et al. Thrombosis Research,
11 High Fat Diet () increases serum 5-HT levels 11 Kim HJ et al. J Proteome Res, 211
12 Body weight (g) Glucose (mg/dl) Minor differences in body mass and adiposity in standard chow diet (SCD) mice SCD SCD+PCPA SCD SCD+PCPA Time (min) Age (wks) Oh et al. Nat Commun,
13 Body weight (g) Tph inhibition by PCPA protects from -induced obesity PCPA Age (wks) Breisch ST et al, Science,
14 Glucose (mg/dl) Glucose (mg/dl) PCPA increases glucose disposal in fed mice 5 GTT 15 ITT PCPA PCPA Time (min) Time (min) 14
15 Physical activity (1 5 cm/day) VO 2 (ml/h/kg) Heat (kcal/h/kg) Food intake (g/day) PCPA increases energy expenditure in mice , 4, 25 2 Vehicle PCPA 15 Vehicle PCPA 3, 2, , 5 5 Light Dark Light Dark Vehicle PCPA 15
16 Adipocyte size (um 2 ) Serotonin depletion decreases adipocyte cell size in ewat ewat 4, 3, 2, +Vehicle +PCPA 1, Vehicle PCPA +PCPA ewat: epidydimal (visceral) WAT 16
17 Relative expression PCPA decreases lipogenic gene expressions in ewat 1.5 Fasn 1.5 Gpam 1.5 Lpin1 1.5 Dgat1 1.5 Dgat SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA 17
18 SCD SCD PCPA induces decreased cell size and increased Ucp1 expression in iwat Ucp1 Vehicle PCPA Vehicle PCPA iwat: inguinal (subcutaneous) WAT 18
19 Relative expression PCPA increases thermogenic gene expressions in iwat 1 Ucp1 1.5 Ucp2 5 Dio2 1.5 Ppargc1a 3 Prdm SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA SCD SCD+PCPA +PCPA 19
20 Relative expression SCD PCPA increases thermogenic gene expressions in BAT Vehicle PCPA Ucp Dio Ppargc1a Cidea SCD SCD+PCPA +PCPA SCD SCD+PCPA +PCPA SCD SCD+PCPA +PCPA. SCD SCD+PCPA +PCPA 2
21 % Injected dose / body weight PCPA increases glucose uptake into BAT Vehicle 1.5 BAT 1. PCPA.5. Vehicle PCPA 21
22 PCPA treatment increases mitochondrial number and size in BAT Vehicle PCPA 65x 22
23 LP53341, a synthetic Tph inhibitor that does not cross BBB Yadav VK, et al., Nature Medicine, 21 23
24 Body weight (g) Body weight (g) Weight gain by was lower in LP53341 treated mice LP PCPA Age (wks) Age (wks) 24
25 LP decreases size of adipocytes Vehicle LP ewat iwat BAT 25
26 Glucose (mg/dl) Glucose (% of initial) LP improves glucose homeostasis and insulin tolerance LP LP Time (min) Time (min) 26
27 Relative expression Relative expression LP increases thermogenic gene expressions in BAT 8 6 Ucp1 8 6 Dio Vehicle LP SCD SCD 27
28 Summary I PCPA treatment protected from diet induced obesity reduced adipose fat pad and size of adipocytes increased browning of iwat and thermogenic gene expressions increased glucose tolerance and insulin sensitivity increased whole body energy expenditure Inhibition of Tph1 by LP showed similar phenotypes like PCPA 28
29 Gut derived serotonin has no effect on body weight gain Sumara G, et al. Cell Metabolsim,
30 Tph1 is expressed in 3T3-L1 adipocytes Kinoshita M et al., Mol Endocrinol,21 3
31 Serotonin modulates adipocyte differentiation Kinoshita M et al., Mol Endocrinol,21 31
32 Serotonin (ng/mg) increases 5-HT contents in adipose tissues SCD 5 25 ewat iwat BAT 32
33 increases 5-HT expressions in adipose tissues Tph1 Tph2 Fabp4 ewat iwat BAT Tph1 relative expression SCD Actb ewat iwat BAT 33
34 Weight gain (g) Glucose (mg/dl) Fat-specific Tph1 KO (FKO) shows resistance to obesity 1 WT Tph1 FKO Age (wks) WT Tph1 FKO Time (min) 34
35 KO WT Fat-specific Tph1 KO mice shows decreased fat size ewat iwat BAT 35
36 Fat-specific Tph1 KO mice shows increased Ucp1 expression in iwat Ucp1 WT Tph1 FKO 36
37 Fat-specific Tph1 KO mice shows increased Ucp1 expression in SVF from BAT BAT SVF Ucp1 Relative expression WT Tph1 FKO Control 5-HT β3 agonist 37
38 Serotonin receptors Lam DD et al, Expert Rev Mol Med, 27 38
39 Body weight (g) VO 2 (ml/h/kg) Heat (kcal/h/kg) Htr3a KO mice are resistant to and shows increased energy expenditure WT, Htr3a KO, Age (wks) 5, 4, 3, 2, 1, Light Dark WT Htr3a KO Light Dark 39
40 Relative expression SCD Htr3a KO mice shows reduced lipid droplet and increased thermogenic gene expression in BAT WT Htr3a KO WT Htr3a KO Ucp1 Dio2 4
41 WT There is no significant difference in WAT of Htr3a KO mice ewat iwat WT Htr3a KO Htr3a KO 41
42 camp (pmol/ml) camp-pka pathway is activated by Htr3a antagonist Vehicle Ondan m-cpbg Ondan+CL Ondan: Ondansetron, Htr3a antagonist m-cpbg: Htr3a agonist CL: CL316243, b3 AR agonist 42
43 Relative expression Relative expression Htr3a antagonist increased thermogenic gene expression in brown adipocytes Vehicle Ondan Ucp1 2 Ppara Hsl Ppargc1a Prdm16 Dio2 Ucp1.5. Vehicle m-cpbg 43
44 OCR (pmoles/min) Htr3a antagonist increased O2 consumption in brown adipocytes Ondansetron CL Rotenone/Antimycin A Oligomycin 1,5 1, Vehicle CL Ondan + CL Time (min) 44
45 Conclusions and Questions 1. Serotonin is synthesized in adipose tissues. 2. Expression of serotonin is increased by high fat diet in adipose tissues. 3. Chemical or genetic inhibition of serotonin synthesis improves glucose homeostasis, and induces browning of subcutaneous WAT. 4. Inhibition of Htr3 increased thermogenesis in BAT. 5. Which mechanisms are involved in browning of WAT? Htr browning 45
46 Acknowledgements KAIST Chang-Myung Oh Ko Eun Shong Kyuho Kim Hail Kim Jun Namkung Hyungseok Kim Hee-Saeng Jung Kyungbook National University Yonghoon Go In-Kyu Lee Chungnam National University Minho Shong Seoul National University Junghan Song Hak Chul Jang Sung Hee Choi UCSF Shingo Kajimura 46
47 Thank you for your attention! 47
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationIntestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction
Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Jiang, C., Xie, C., Lv, Y., Li, J., Krausz, K. W., Shi, J.,... & Gonzalez, F. J. (215). Intestine-selective
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
More informationAdipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated
Adipocyte-specific deletion of Ip6k1 reduces diet-induced obesity by enhancing AMPKmediated thermogenesis Qingzhang Zhu,, James C. Barrow, Anutosh Chakraborty J Clin Invest. 2016;126(11):4273-4288. https://doi.org/10.1172/jci85510.
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationBEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
More informationPeripheral Serotonin: a New Player in Systemic Energy Homeostasis
Mol. Cells 2015; 38(12): 1023-1028 http://dx.doi.org/10.14348/molcells.2015.0258 Molecules and Cells http://molcells.org Established in 1990 Peripheral Serotonin: a New Player in Systemic Energy Homeostasis
More informationSHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.
Title mediates adaptive thermogenesis by promoting intracellular activation of thyroid hormones in brown adipocytes Author(s) SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationLack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
More informationMfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis
Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle
More informationA Tryptophan Hydroxylase Inhibitor Decreases Hepatic FGF21 Expression and Circulating FGF21 in Mice Fed A High-Fat Diet
A Tryptophan Hydroxylase Inhibitor Decreases Hepatic FGF21 Expression Circulating FGF21 in Mice Fed A High-Fat Diet Katsunori Nonogaki, Takao Kaji, Mari Murakami Abstract Background: Fibroblast growth
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationTissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationActivation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease John Chiang, Ph.D. Northeast Ohio Medical University Rootstown, OH, USA International Conference
More informationAcquisition of brown fat characteristics by white adipose
ENERGY BALANCE-OBESITY A Role for Phosphodiesterase 3B in Acquisition of Brown Fat Characteristics by White Adipose Tissue in Male Mice Emilia Guirguis, Steven Hockman, Youn Wook Chung, Faiyaz Ahmad, Oksana
More informationUCP1-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis
ARTICLES UCP-independent signaling involving SERCA2bmediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasis 27 Nature America, Inc., part of Springer Nature. All rights
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationPregnancy outcomes in Korean women with diabetes
Pregnancy outcomes in Korean women with diabetes Sung-Hoon Kim Department of Medicine, Cheil General Hospital & Women s Healthcare Center, Dankook University College of Medicine, Seoul, Korea Conflict
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationSupporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationBut Why Bone? Gerard Karsenty MD, PhD Department of Genetics and Development Columbia University medical Center
But Why Bone? Gerard Karsenty MD, PhD Department of Genetics and Development Columbia University medical Center The evolution of bone biology Then: a walking and running tool i.e., A SURVIVAL TOOL The
More informationof professional contacts and collaborations. With various global locations these conferences attract
Abstract The Keystone Symposia are held annually to congregate people working in a specific field of research in order to disseminate unpublished findings and allow for networking and establishment of
More informationFSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More informationENHANCEMENT OF BROWN ADIPOSE TISSUE DEVELOPMENT IN VIVO BY A NOVEL INSULIN SENSITIZER
ENHANCEMENT F BRWN ADIPSE TISSUE DEVELPMENT IN VIV BY A NVEL INSULIN SENSITIZER William G. McDonald 1, Serena L. Cole 1, Brian N. Finck 2, Danielle D. Holewa 1, Angela S. Brightwell-Conrad 1, Charles Mackenzie
More informationThe Paradox of Progress Environmental Chemicals & the Origins of Diabetes
The Paradox of Progress Environmental Chemicals & the Origins of Diabetes Robert M. Sargis, MD, PhD Assistant Professor of Medicine Section of Endocrinology, Diabetes, and Metabolism University of Chicago
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationMolecular Mechanisms associated with the Cancer-Cachexia Syndrome
Molecular Mechanisms associated with the Cancer-Cachexia Syndrome Prof. Dr. Josep M. Argilés Department of Biochemistry & Molecular Biology University of Barcelona, Spain Disclosures: DANONE (Scientific
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationA Novel Method to Prevent Hypocalcemia? Can we improve cow longevity and health in the herd? Laura L. Hernandez, Ph.D.
A Novel Method to Prevent Hypocalcemia? Can we improve cow longevity and health in the herd? Laura L. Hernandez, Ph.D. Culling During Early Lactation 75% of production diseases occur in the 1 st month
More informationPrdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice
Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice Patrick Seale,, Saverio Cinti, Bruce M. Spiegelman J Clin Invest. 2011;121(1):96-105. https://doi.org/10.1172/jci44271.
More informationInterplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
More informationFADD is a key regulator of lipid metabolism
Research Article FADD is a key regulator of lipid metabolism Hongqin Zhuang 1, Xueshi Wang 1, Daolong Zha 1, Ziyi Gan 1, Fangfang Cai 1, Pan Du 1, Yunwen Yang 1, Bingya Yang 1, Xiangyu Zhang 1, Chun Yao
More informationCrif1 Deficiency Reduces Adipose OXPHOS Capacity and Triggers Inflammation and Insulin Resistance in Mice
Crif1 Deficiency Reduces Adipose OXPHOS Capacity and Triggers Inflammation and Insulin Resistance in Mice Min Jeong Ryu 1, Soung Jung Kim 1, Yong Kyung Kim 1, Min Jeong Choi 1, Surendar Tadi 1, Min Hee
More informationTadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual
Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical
More informationMolecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary
Published in "" which should be cited to refer to this work. Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas http://doc.rero.ch Laboratory of Metabolic Stress Biology, Division
More informationHistone demethylase JMJD1A coordinates acute and chronic adaptation to cold stress via thermogenic phospho-switch. Abe et al.
Histone demethylase JMJD1A coordinates acute and chronic adaptation to cold stress via thermogenic phospho-switch Abe et al. a BAT 1 kb Ucp1 H3Kme3 H3K7ac (., ) (., ) -13 kb -. kb -. kb b scwat Chronic
More informationId1 Promotes Obesity by Suppressing Brown Adipose Thermogenesis and White Adipose Browning
Diabetes Volume 66, June 2017 1611 Id1 Promotes Obesity by Suppressing Brown Adipose Thermogenesis and White Adipose Browning Mallikarjun Patil, Bal Krishan Sharma, Sawsan Elattar, Judith Chang, Shweta
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationIdentification and characterization of a supraclavicular brown adipose tissue in mice
Identification and characterization of a supraclavicular brown adipose tissue in mice Qianxing Mo,, Kristin I. Stanford, Miao-Hsueh Chen JCI Insight. 2017;2(11):e93166.. Research Article Development Endocrinology
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationActivités scientifiques
Prof. Françoise Rohner-Jeanrenaud Activités scientifiques I. A role for adipose tissue de novo lipogenesis in glucose homeostasis during catch-up growth: A Randle cycle favoring fat storage Catch-up growth
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSupplementary Information Titles
Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel
More informationThe enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
More informationNutritional Analysis of Wakame
As a clinical term, medical obesity occurs when a person s Body Mass Index (BMI) exceeds a measurement of 30 or greater. http://www.nhlbisupport.com/bmi/ BMI is an internationally recognized measure of
More informationNT-PGC-1α activation attenuates high-fat diet-induced obesity by enhancing brown fat thermogenesis and adipose tissue oxidative metabolism
Page 1 of 37 NT-PGC-1α activation attenuates high-fat diet-induced obesity by enhancing brown fat thermogenesis and adipose tissue oxidative metabolism Hee-Jin Jun, Yagini Joshi, Yuvraj Patil, Robert C.
More informationSteven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.
Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis
More informationHormonal regulation of. Physiology Department Medical School, University of Sumatera Utara
Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationBile acid receptor FXR: metabolic regulator in the gut. Sungsoon Fang
Bile acid receptor FXR: metabolic regulator in the gut Sungsoon Fang Nuclear hormone receptor 1905: Ernest Starling coined hormone 1929: Estrogen structure 1958: Estrogen receptor by Elwood Jensen 1985:
More informationThe central melanocortin system directly controls peripheral lipid metabolism
Research article The central melanocortin system directly controls peripheral lipid metabolism Ruben Nogueiras, 1,2 Petra Wiedmer, 2 Diego Perez-Tilve, 1 Christelle Veyrat-Durebex, 3 Julia M. Keogh, 4
More informationRho-kinase/AMPK axis regulates hepatic lipogenesis during overnutrition
Rho-kinase/AMPK axis regulates hepatic lipogenesis during overnutrition Hu Huang,, John Jones, Young-Bum Kim J Clin Invest. 2018;128(12):5335-5350. https://doi.org/10.1172/jci63562. Research Article Endocrinology
More informationGetting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey
Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis Keith Sharkey Department of Physiology & Pharmacology University of Calgary Dr. Keith Sharkey Financial Interest
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationMetabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
More information(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationBeige fat: A New Hope for Metabolic Disorder
Young Biomedical Scientists Forum(YBSF) Beige fat: A New Hope for Metabolic Disorder Harim Kim(2) 1 Ewha University, School of Medicine, 52, Ewhayeodae-gil, Seodaemun-gu, Seoul 120-750 Korea k3541729@ybsf21.org
More informationDietary Amino Acids and Proteins Influence Serotonin Synthesis in Brain Neurons
Dietary Amino Acids and Proteins Influence Serotonin Synthesis in Brain Neurons John D. Fernstrom University of Pi>sburgh School of Medicine Neuronal Serotonin Synthesis & Metabolism Source of Neuronal
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationAdipose-specific deletion of Kif5b exacerbates obesity and insulin resistance in a mouse model of diet-induced obesity
THE JOURNAL RESEARCH www.fasebj.org Adipose-specific deletion of Kif5b exacerbates obesity and insulin resistance in a mouse model of diet-induced obesity Ju Cui,* Jing Pang,* Ya-Jun Lin,* Huan Gong,*
More informationEnergy Balance. Applied Human Metabolism VII. Energy Out. Factors that effect BMR/RMR 17/03/2016
Energy Balance Applied Human Metabolism VII Weight Regulation The balance of energy taken in or leaving the body determines body mass Energy In = Energy Out Weight Maintenance Energy In < Energy Out Weight
More informationThrombin promotes diet-induced obesity through fibrin-driven inflammation
Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationEndonuclease G (EndoG) is one of the most abundant
ORIGINAL RESEARCH EndoG Knockout Mice Show Increased Brown Adipocyte Recruitment in White Adipose Tissue and Improved Glucose Homeostasis Rosario Pardo, Natividad Blasco,* Maria Vilà,* Daniel Beiroa,*
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationObesity is a worldwide epidemic and is driving increases. A Novel Therapeutic Approach to Treating Obesity through Modulation of TGF Signaling
ENERGY BALANCE-OBESITY A Novel Therapeutic Approach to Treating Obesity through Modulation of TGF Signaling Alan Koncarevic, Shingo Kajimura, Milton Cornwall-Brady, Amy Andreucci, Abigail Pullen, Dianne
More informationSupplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule
Cell Reports, Volume 18 Supplemental Information rown dipogenic Reprogramming Induced by a Small Molecule aoming Nie, Tao Nie, Xiaoyan Hui, Ping Gu, Liufeng Mao, Kuai Li, Ran Yuan, Jiashun Zheng, Haixia
More information