The obesity-related FTO gene variant associates with the risk of recurrent miscarriage

Transcription

1 A C TA Obstetricia et Gynecologica AOGS MAIN RESEARCH ARTICLE The obesity-related FTO gene variant associates with the risk of recurrent miscarriage PRABHA H. ANDRAWEERA 1,2, GUSTAAF A. DEKKER 1,3, ROHAN W. JAYASEKARA 2, VAJIRA H.W. DISSANAYAKE 2 & CLAIRE T. ROBERTS 1 1 School of Paediatrics and Reproductive Health, Robinson Research Institute, University of Adelaide, Adelaide, South Australia, Australia, 2 Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka, and 3 Women s and Children s Division, Lyell McEwin Hospital, Elizabeth Vale, South Australia, Australia Key words Recurrent miscarriage, FTO rs , polymorphism Correspondence Prabha H. Andraweera, School of Paediatrics and Reproductive Health, Robinson Research Institute, University of Adelaide, Adelaide, South Australia, Australia. prabha.andraweera@adelaide.edu.au Conflict of interest The authors have stated explicitly that there are no conflicts of interest in connection with this article. Please cite this article as: Andraweera PH, Dekker GA, Jayasekara RW, Dissanayake VHW, Roberts CT. The obesity-related FTO gene variant associates with the risk of recurrent miscarriage. Acta Obstet Gynecol Scand 2015; 94: Received: 15 July 2014 Accepted: 29 March 2015 DOI: /aogs Abstract Objective. To investigate the association of the fat mass and obesity associated gene (FTO) rs single nucleotide polymorphism with recurrent miscarriage. Design. Candidate gene association study. Setting. Human Genetics Unit, Colombo, Sri Lanka. Population. A total of 202 Sinhalese women with two or more first-trimester miscarriages and no living children (cases) and 202 ageand ethnicity-matched women with no history of miscarriage and having two or more living children (controls). Methods. Peripheral blood was collected from the participants and DNA was extracted. Genotyping was performed at the Australian genome Research Facility using the Sequenom MassARRAY system. and allele frequencies of cases were compared with controls using chi-squared testing. Main outcome measures. The prevalence of the single nucleotide polymorphism in cases and controls. Results. The mean age of the women in the recurrent miscarriage group was years and that of the control group was years. Of the women in the recurrent miscarriage group, 140 (69.3%) had experienced three or more first-trimester miscarriages. The prevalence of the AA genotype [p = , odds ratio (95% CI) = 3.8 ( )] and A allele [p = 0.002, odds ratio (95% CI) = 1.6 ( )] of the FTO rs single nucleotide polymorphism were increased in women in the recurrent miscarriage group compared with the control group. Conclusion. The obesity-related FTO rs single nucleotide polymorphism associates with recurrent miscarriage. This finding warrants further investigation with controlling for important factors such as body mass index, diabetes and cardiovascular disease status. The single nucleotide polymorphism may be useful in predicting the risk of recurrent miscarriage. Abbreviations: BMI, body mass index; FTO, fat mass and obesity; OR, odds ratio; RM, recurrent miscarriage; SNP, single nucleotide polymorphism. Introduction Spontaneous miscarriage is involuntary pregnancy loss before the 20th week of gestation and affects approximately 15% of normal couples. Of these, 1 5% experience recurrent miscarriage (RM). At present the Key Message The FTO rs single nucleotide polymorphism, which is well known for associations with obesity and vascular and metabolic phenotypes, is associated with increased risk of recurrent miscarriage. The single nucleotide polymorphism may be useful in predicting the risk of recurrent miscarriage. 722

2 definition of RM is debated with the American definition being the loss of two or more consecutive pregnancies, whereas the European definition is the loss of three or more consecutive pregnancies (1,2). A genetic contribution to RM is suggested by studies that have shown that the prevalence of RM among first-degree relatives is twoto seven-fold higher compared with the general population and that the prevalence of miscarriage among siblings of those experiencing RM is approximately double that of the general population (3,4). Women who experience RM are at increased risk of later life vascular and metabolic disorders, including coronary artery disease and diabetes mellitus and parents of women who experience RM are also at a higher risk of developing coronary artery disease (5 7). These findings suggest that these families may have shared genetic, epigenetic and environmental risk factors that predispose them to RM and later life vascular disease. Among the many mechanistic pathways that have been proposed to contribute to the above findings, one plausible mechanism is the presence of phenotypic variants that predispose to metabolic syndrome, including obesity, higher fasting insulin, glucose and triglycerides, and lower high-density lipoproteins (8). A few years ago, genome-wide association studies identified a strong association between a common single nucleotide polymorphism (SNP rs ) in the fat mass and obesity associated gene (FTO) on chromosome 16q12.2 and the risk of obesity. Since then, the FTO rs SNP has been investigated in relation to many metabolic diseases and molecular pathways and is one of the most extensively investigated SNPs. There is strong and consistent evidence that has been replicated by many groups on the association of this SNP with adverse metabolic traits, diabetes mellitus and coronary artery disease (9). However, this polymorphism has not been studied in RM. The aim of our study was to investigate the association of the FTO rs SNP with RM in Sinhalese women in Sri Lanka. Material and methods This study was conducted on 404 DNA samples that comprise a biobank of samples extracted from peripheral blood of 404 women recruited to the Recurrent Miscarriage Study, which was conducted with the aim of identifying genetic variants that are associated with RM. We have investigated a total of 100 SNPs in different molecular pathways that are implicated in the pathogenesis of RM and some of the findings have been published (10,11). The FTO rs SNP was the only obesityrelated polymorphism that was investigated in this cohort and the findings are discussed in this manuscript. The participants were consecutively recruited at two tertiary-care maternity hospitals and at the Human Genetics Unit of the Faculty of Medicine, University of Colombo, Sri Lanka between January 2006 and December The study population consisted of 202 women in the RM group and 202 women in the control group. The eligibility criteria for recruitment into the RM group included women who had experienced at least two consecutive first-trimester pregnancy losses and having no living children. All eligible women and their partners underwent karyotyping. If a chromosome abnormality was detected in the woman or her partner, the woman was not eligible to participate in the study. Only Sinhalese women were eligible to participate. Women of mixed ethnicity and those who had pregnancies fathered by non-sinhalese men were not recruited to ensure ethnic homogeneity. All women in the RM group had been assessed by an obstetrician and had undergone routine testing to identify a cause for RM including endocrine disorders, structural abnormalities of the reproductive tract, thrombophilias and anti-phospholipid antibody syndrome. Those with an identifiable cause for RM were not eligible to participate in the study. The control group consisted of 202 ethnicity- and age-matched women who had two or more living children and who did not have a past history of miscarriage. The women in the control group were recruited at postnatal wards of the same maternity hospitals as the women in the RM group. The study was approved by the Ethics Review Committee of the Faculty of Medicine, University of Colombo, Sri Lanka (EC/05/003, 10/02/2005) and the Human Ethics Committee of the University of Adelaide, Australia (H , 13/11/2008). All women provided written informed consent. Peripheral blood samples were collected from the women and DNA was extracted using QiaAmp blood midi-dna extraction kits (Qiagen, Limberg, the Netherlands). Genotyping was performed at the Australian Genome Research Facility (Brisbane, Australia) using the Sequenom MassARRAY system (Sequenom Inc, San Diego, CA, USA). The primer sequences were AC- GTTGGATGTGTCTGAATTATTATTCTAG [first polymerase chain reaction (PCR) primer], ACGTTGGATG TAGAGTAACAGAGACTATCC (second PCR primer) and GGTACTTGCGACTGCTGTGAATTT (extend primer). As a quality control measure 300 independent samples that were genotyped in-house for the same SNPs using real-time PCR and high-resolution melting analysis were genotyped using the Sequenom MassARRAY system at the Australian Genome Research Facility. The concordance rate of the reverse transcription-pcr results and MassARRAY results was 100%. 723

3 The chi-squared test was used to test the genotypes for Hardy Weinberg equilibrium and to compare categorical variables. All data analyses were performed using PASW version (SPSS, Chicago, IL, USA). The genotype and allele frequencies of cases were compared with those of controls using chi-squared analyses. Results were reported as number and percentage [n (%)] or mean SD where appropriate. To account for multiple testing, the Bonferroni correction was applied. Significant associations were defined at a two-tailed p-value <0.05/ 100, i.e The prevalence of the SNP in the general population was determined by genotyping 85 randomly selected Sinhalese men and women. On the basis of prevalence of a polymorphism in 20% in the general population, a ratio of one control subject to one case, 200 women with RM and 200 control women have 80% power to detect an odds ratio (OR) of 2.0 (b = 80%, a = 0.05). Results The mean age of the women in the RM group was years and the mean age of the control group was years. Of the 202 women in the recurrent pregnancy loss group, 140 (69.3%) had experienced three or more first-trimester pregnancy losses and 114 (56.4%) had experienced only first-trimester pregnancy losses. The details of pregnancy loss are shown in Table 1. All cases and controls were nonsmokers. The FTO rs SNP was in Hardy Weinberg equilibrium in both cases and controls. data of seven (3.5%) women in the RM group and nine (4.5%) women in the control group were not available because of genotyping failure. The prevalence of the AA genotype [p = , OR (95% CI) = 3.8 ( )] and A allele [p = 0.002, OR (95% CI) = 1.6 ( )] of the FTO rs SNP were increased in women in the RM group compared with the control group (Table 2). The association of the AA genotype of the FTO rs SNP with RM was significant after Bonferroni correction. As a post-hoc analysis, we Table 1. Characteristics of the study population. Characteristic Controls (n = 202) RM (n = 202) Age (years) Pregnancy loss, n (%) T1 only (56.4) T1 and T (37.1) T1 and T (4.5) T1, T2 and T3 0 4 (2.0) Three or more T1 losses (69.3) RM, recurrent miscarriage; T1, first trimester; T2, second trimester; T3, third trimester. sub-categorized the women in the RM group into those who had had three or more first-trimester miscarriages and those who had had two-first-trimester miscarriages and compared the prevalence of the genotypes with the control group. We observed similar results in the two groups (Table 3). Discussion This is the first study to investigate the prevalence of the FTO rs SNP in women who experience RM. Our Table 2. and allele frequency distribution of FTO rs single nucleotide polymorphism in Sinhalese women with recurrent miscarriage and controls. FTO rs Controls RM n % n % p value OR (95% CI) TT ref 1.0 (ref) TA ( ) AA ( ) T ref 1.0 (ref) A ( ) OR, odds ratios; RM, recurrent miscarriage. p values and OR (95% CI) in bold are significant after Bonferroni correction. Table 3. and allele frequency distribution of FTO rs single nucleotide polymorphism in recurrent miscarriage sub-groups and controls. FTO rs Controls RM n % n % p value OR (95% CI) Three or more T1 miscarriages TT ref 1.0 (ref) TA ( ) AA ( ) T ref 1.0 (ref) A ( ) Two T1 miscarriages TT ref 1.0 (ref) TA ( ) AA ( ) T ref 1.0 (ref) A ( ) OR, odds ratio; RM, recurrent miscarriage; T1, first trimester. p values and OR (95% CI) in bold are significant after Bonferroni correction. 724

4 findings demonstrate a significant increase in the prevalence of the variant allele of the SNP in women who experience RM. There is increasing evidence linking RM with coronary artery disease and diabetes mellitus in later life (5,6,12). A recent systematic review and meta-analysis demonstrated that women with a history of miscarriage are at a 45% higher risk and those with a history of RM at a two-fold increased risk of developing coronary artery disease (8). Women with a history of RM are also shown to be at a two times higher risk of developing diabetes mellitus in later life (6). These associations can be explained by two plausible theories. One theory is that RM and later-life vascular and metabolic disorders share the same etiology and the second theory is that pathological processes initiated due to the pregnancy loss may predispose a woman to future vascular and metabolic disorders. Interestingly, Smith et al. recently reported that the prevalence of coronary artery disease is also higher among parents of women with RM. The risk was shown to be 25% for parents of women experiencing two miscarriages and 56% for parents of women experiencing three or more miscarriages (7). These findings suggest that these families may have shared genetic, epigenetic and environmental risk factors that predispose them to RM and laterlife coronary artery disease, supporting the theory of shared genetic etiology among these disorders. The FTO rs SNP is an ideal candidate polymorphism in this setting. This SNP gained much research interest when in 2007, three well-powered genome-wide association studies identified it as a strong contributor to both childhood and adult obesity (13 16). Since then, it has been one of the most extensively studied polymorphisms with consistent evidence of its association with many metabolic and vascular phenotypes. The molecular mechanism of FTO action in metabolism is yet to be determined but the FTO protein is highly expressed in the central nervous system and is considered to be implicated in energy balance and regulation of appetite (17). The variant allele (A allele) of the SNP has been shown to have a robust and consistent association with elevated body mass index (BMI), central fat distribution and obesity (18). It has also been shown to be associated with higher fasting insulin, glucose, and triglycerides, and lower high-density lipoprotein cholesterol (19). A strong and consistent association between the variant allele and the risk of type 2 diabetes mellitus and coronary artery disease has also been reported (9,20,21). Until recently, the association between the SNP and these clinical phenotypes was thought to be mediated via its association with elevated BMI and obesity. However, recent evidence demonstrates an independent association of the SNP with disease risk. Two recent meta-analyses on the association of the FTO rs SNP with type 2 diabetes among and patients demonstrated a significant association independent of BMI (22,23). Another recent systematic review and meta-analysis of patients with coronary artery disease also reported that the association between the SNP and coronary artery disease risk is independent of BMI and other conventional coronary artery disease risk factors (23). In our study, we found that homozygosity for the variant allele of this SNP was associated with a 3.8-fold risk of RM in Sinhalese women, providing further evidence for potential shared genetic factors between RM, coronary artery disease and diabetes mellitus. When the miscarriage cohort was sub-categorized into those with three or more, or two-first-trimester miscarriages, we found a marginal increase in the odds ratio in the group with three or more miscarriages. However, the subgroups do not have sufficient power to test for significant differences between the two groups. We could not investigate the interaction between the polymorphism and the woman s BMI, cardiovascular status and the presence of diabetes mellitus because we did not have information on these variables. We consider this to be a limitation of our study. However, the presence of strong evidence from meta-analyses demonstrating the potential role of this polymorphism independent of BMI warrants further investigation of this polymorphism in other groups of women with RM for whom more clinical and environmental data are available. In addition, most consistent associations between this polymorphism and clinical variables were initially shown in studies of Europeans with less consistent evidence shown among Asians. Recently, a few groups have found strong associations between this polymorphism and disease risk in Asian populations demonstrating a potential risk independent of ethnicity (22,23). Our findings add further evidence to the association of the FTO rs SNP with disease risk among South Asians. Conclusion Our study suggests that the FTO rs SNP can be a risk factor for RM. This finding warrants further investigation with controlling for important factors such as BMI, diabetes and cardiovascular disease status. Funding This study was funded by the National Health and Medical Research Council Australia (NHMRC) Project Grant ID awarded to CTR and GAD. CTR is supported by an NHMRC Senior Research Fellowship APP PHA is supported by an NHMRC Peter 725

5 Doherty Postdoctoral Fellowship (GNT ). The recruitment, characterization and establishment of the RM sample collection in Sri Lanka was funded by a grant from the National Science Foundation (NSF), Sri Lanka awarded to VHWD and RWJ (Grant no: SIDA/BT/2005/04). The study sponsors had no role in study design, data analyses and interpretation or writing this report. References 1. Practice Committee of American Society for Reproductive Medicine. Definitions of infertility and recurrent pregnancy loss: a committee opinion. Fertil Steril. 2013;99: Jauniaux E, Farquharson RG, Christiansen OB, Exalto N. Evidence-based guidelines for the investigation and medical treatment of recurrent miscarriage. Hum Reprod. 2006;21: Christiansen OB. A fresh look at the causes and treatments of recurrent miscarriage, especially its immunological aspects. Hum Reprod Update. 1996;2: Kolte AM, Nielsen HS, Moltke I, Degn B, Pedersen B, Sunde L, et al. A genome-wide scan in affected sibling pairs with idiopathic recurrent miscarriage suggests genetic linkage. Mol Hum Reprod. 2011;17: Ranthe MF, Andersen EA, Wohlfahrt J, Bundgaard H, Melbye M, Boyd HA. Pregnancy loss and later risk of atherosclerotic disease. Circulation. 2013;127: Kharazmi E, Lukanova A, Teucher B, Gross ML, Kaaks R. Does pregnancy or pregnancy loss increase later maternal risk of diabetes? Eur J Epidemiol. 2012;27: Smith GC, Wood AM, Pell JP, Hattie J. Recurrent miscarriage is associated with a family history of ischaemic heart disease: a retrospective cohort study. BJOG. 2011;118: Oliver-Williams CT, Heydon EE, Smith GC, Wood AM. Miscarriage and future maternal cardiovascular disease: a systematic review and meta-analysis. Heart. 2013;99: Liu C, Mou S, Pan C. The FTO gene rs polymorphism predicts risk of cardiovascular disease: a systematic review and meta-analysis. PLoS One. 2013;8: e Andraweera PH, Dekker GA, Thompson SD, Nowak RC, Jayasekara RW, Dissanayake VH, et al. Polymorphisms in the fibrinolytic pathway genes and the risk of recurrent spontaneous abortion. Reprod Biomed Online. 2014;29: Dissanayake VH, Sirisena ND, Weerasekera LY, Gammulla CG, Seneviratne HR, Jayasekara RW. Candidate gene study of genetic thrombophilic polymorphisms in pre-eclampsia and recurrent pregnancy loss in Sinhalese women. J Obstet Gynaecol Res. 2012;38: Kharazmi E, Dossus L, Rohrmann S, Kaaks R. Pregnancy loss and risk of cardiovascular disease: a prospective population-based cohort study (EPIC-Heidelberg). Heart. 2011;97: Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science (New York, NY). 2007;316: Dina C, Meyre D, Gallina S, Durand E, Korner A, Jacobson P, et al. Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet. 2007;39: Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, et al. Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. PLoS Genet. 2007;3:e Magi R, Manning S, Yousseif A, Pucci A, Santini F, Karra E, et al. Contribution of 32 GWAS-identified common variants to severe obesity in European adults referred for bariatric surgery. PLoS One. 2013;8:e Willer CJ, Speliotes EK, Loos RJ, Li S, Lindgren CM, Heid IM, et al. Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. Nat Genet. 2009;41: Lauria F, Siani A, Bammann K, Foraita R, Huybrechts I, Iacoviello L, et al. Prospective analysis of the association of a common variant of FTO (rs ) with adiposity in children: results of the IDEFICS study. PLoS One. 2012;7: e Freathy RM, Timpson NJ, Lawlor DA, Pouta A, Ben- Shlomo Y, Ruokonen A, et al. Common variation in the FTO gene alters diabetes-related metabolic traits to the extent expected given its effect on BMI. Diabetes. 2008;57: Binh TQ, Phuong PT, Nhung BT, Thoang DD, Lien HT, Thanh DV. Association of the common FTO-rs polymorphism with type 2 diabetes, independent of obesity-related traits in a Vietnamese population. Gene. 2013;513: Rees SD, Islam M, Hydrie MZ, Chaudhary B, Bellary S, Hashmi S, et al. An FTO variant is associated with type 2 diabetes in South Asian populations after accounting for body mass index and waist circumference. Diabet Med. 2011;28: Vasan SK, Karpe F, Gu HF, Brismar K, Fall CH, Ingelsson E, et al. FTO genetic variants and risk of obesity and type 2 diabetes: a meta-analysis of 28,394 Indians. Obesity (Silver Spring). 2014;22: Li H, Kilpelainen TO, Liu C, Zhu J, Liu Y, Hu C, et al. Association of genetic variation in FTO with risk of obesity and type 2 diabetes with data from 96,551 East and South Asians. Diabetologia. 2012;55: