*Author for correspondence Accepted 19 January 2010

Transcription

1 The Journal of Experimental Biology, -5. Published by The Company of Biologists Ltd doi:./jeb.7689 Insulin-indued hypoglyaemia is o-ordinately regulated by liver and musle during aute and hroni insulin stimulation in rainbow trout (Onorhynhus mykiss) Sergio Polakof,,,, Sandrine Skiba-Cassy,,, Georges Choubert,, and Stéphane Panserat,,, INRA, UMR67 Nutrition Aquaulture et Génomique, F-6 Saint-Pée-sur-Nivelle, Frane, IFREMER, UMR67 Nutrition Aquaulture et Génomique, F-98 Plouzané, Frane, Université Bordeaux, UMR 67 Nutrition Aquaulture et Génomique, F-5 Talene, Frane and Laboratorio de Fisioloxía Animal, Departamento de Bioloxía Funional e Cienias da Saúde, Faultade de Bioloxía, Universidade de Vigo, E-6 Vigo, Spain Author for orrespondene (spolakof@st-pee.inra.fr) Aepted 9 January SUMMARY The relative gluose intolerane of arnivorous fish speies is often proposed to be a result of poor peripheral insulin ation or possibly insulin resistane. In the present study, data from aorti annulated rainbow trout reeiving bovine insulin (75 miu kg ) injetions show for the first time their ability to lear gluose in a very effiient manner. In another set of experiments, mrna transripts and protein phosphorylation status of proteins ontrolling glyaemia and gluose-related metabolism were studied during both aute and hroni treatment with bovine insulin. Our results show that fasted rainbow trout are well adapted at the moleular level to respond to inreases in irulating insulin levels, and that this hormone is able to potentially improve gluose distribution and uptake by peripheral tissues. After aute insulin administration we found that to ounter-regulate the insulinindued hypoglyaemia, trout metabolism is strongly modified. This short-term, effiient response to hypoglyaemia inludes a rapid, oordinated response involving the reorganization of musle and liver metabolism. During hroni insulin treatment some of the funtions traditionally attributed to insulin ations in mammals were observed, inluding inreased mrna levels of gluose transporters and glyogen storage (primarily in the musle) as well as dereased mrna levels of enzymes involved in de novo gluose prodution (in the liver). Finally, we show that the rainbow trout demonstrates most of the lassi metaboli adjustments employed by mammals to effiiently utilize gluose in the appropriate insulin ontext. Key words: fish, insulin, gluose metabolism, liver, musle. INTRODUCTION Carnivorous fish speies like rainbow trout (Onorhynhus mykiss) are traditionally onsidered as gluose intolerant (Moon, ; Wilson, 99) due primarily to the prolonged hyperglyaemia experiened after a gluose load or intake of arbohydrate-enrihed meals (Bergot, 979; Palmer and Ryman, 97). Although initially the basis for this poor metaboli gluose utilization was though to be a defiieny in insulin seretion (Furuihi and Yone, 98; Palmer and Ryman, 97), later hormone titration in several fish speies demonstrated that plasma insulin levels in pisine speies are even higher than in mammals (Mommsen and Plisetskaya, 99). The seretagogues of insulin in fish are the same as in mammals, and although gluose is not the most potent of these, generally hyperglyaemia does result in hyperinsulinaemia (Moon, ). To exert its biologial effets, insulin binds to a speifi transmembrane reeptor that possesses tyrosine kinase ativity (Gutiérrez et al., 6). Moreover, insulin is also able to indue Akt (ritial node in the insulin signalling pathway in mammals) (Taniguhi et al., 6) phosphorylation in vivo and in vitro in musle and liver of rainbow trout (Castillo et al., 6; Plagnes-Juan et al., 8; Seiliez et al., 8a). Insulin funtions primarily as a major anaboli hormone by stimulating postprandial gluose uptake by the liver and skeletal musle, depressing rates of hepati gluoneogenesis, and ativating glyogen synthesis and lipogenesis. In fish, the most prominent response to exogenous insulin injetion is hypoglyaemia (Ine, 98b). However, both the magnitude and duration of this hypoglyaemi effet are dependent on several fators, inluding insulin type and dose level, route of injetion, season, nutritional state and previous nutritional history (Ine, 98b; Mommsen and Plisetskaya, 99). The mehanism by whih insulin regulates plasma gluose levels in fish remains unknown, and the relative ontribution of the main peripheral tissues sensitive to this hormone remain to be larified (Navarro et al., 6). Regarding gluose uptake, in addition to GLUT (gluose transporter type ) transloation to the plasma membrane in response to insulin in fish skeletal musle (Díaz et al., 7), both GLUT (gluose transporter type ) and GLUT gene expression are regulated by this hormone in vivo and in vitro (Capilla et al., ; Díaz et al., 9). On the other hand, although insulin administration often results in unspeifi glyogen flutuations (Mommsen and Plisetskaya, 99), the most ommon response is the depletion of hepati glyogen stores in vivo (Bhatt et al., 98; Ottolenghi et al., 98), while a more onsistent glyogeni response is found in vitro (Foster and Moon, 99; Ottolenghi et al., 98). The response of musle glyogen to insulin administration seems to be more onsistent, as in several fish speies musle glyogen levels inrease following physiologial hormone injetion (Bhatt et al., 98; Ottolenghi et al., 98). Conurrent with its ation on gluose uptake, insulin depresses the rate of gluoneogenesis in some salmonids (De la Higuera and Cárdenas, 986), but not in other fish speies (Mommsen and Plisetskaya, 99). Consistent with these observations, insulin is also able to down-regulate in vivo and in

2 S. Polakof and others vitro the expression of the main hepati gluoneogeni genes in rainbow trout (Plagnes-Juan et al., 8). As previously stated by other authors (Mommsen and Plisetskaya, 99; Navarro et al., 6), most studies involving insulin in fish are performed using pharmaologial doses of the hormone, and thus these data need to be interpreted arefully. Studies employing physiologial doses of insulin are sare (Capilla et al., ; Ine, 98a; Ine and Thorpe, 976), and as far as we are aware, in only one of these was the plasma insulin level measured after exogenous administration (Pérez-Sánhez, 988). On the other hand, almost all the studies arried out to date have foused on aute insulin effets, subjeting fish to transient levels of the hormone, and only a few involved hroni trials (Ablett et al., 98; Polakof et al., 8a; Slagter et al., 5). Therefore, the aim of the present study utilizing the arnivorous rainbow trout was -fold: (i) to better understand the apaity of insulin to improve gluose learane and peripheral utilization using aorti annulated trout; and (ii) to investigate the metaboli effets of insulin by employing physiologial doses during both aute intraperitoneal injetion and hroni mini-pump implantation treatments. As well, for the first time the two main insulin targets, skeletal musle and liver, were studied at both the biohemial and moleular level to analyse the ellular origins responsible for the plasma gluose profiles observed. MATERIALS AND METHODS Fish Rainbow trout (Onorhynhus mykiss Walbaum) were obtained from the INRA experimental fish farm failities at Donzaq (Landes, Frane). Fish were maintained in open iruit tanks supplied with 7 C well-aerated water under a ontrolled photoperiod ( h: h L:D) and fed with a ommerial diet (T-P lassi, Trouw, Vervins, Frane). Fish mass for the annulation experiments was 5±9 g (female), and for the other trials it was 7± g (immature). The experiments were onduted following the Guidelines of the National Legislation on Animal Care of the Frenh Ministry of Researh. Experimental protools Fish dorsal aorta annulation proedures were performed aording to Zohar (Zohar, 98), allowing reovery from surgery for h under free-swimming onditions. Trout were fasted for 8 h and then subjeted to four different experiments involving injetion of solutions through the annula into the dorsal aorta: (i) gluose injetion (5 mg kg ), (ii) gluose plus bovine insulin (75 miu kg or ~.7 mgkg, Sigma, St Louis, MO, USA) injetion, (iii) gluose injetion 5 min (peak of gluose in plasma) after the first gluose administration, and (iv) gluose plus insulin injetion 5 min after the first gluose administration. The insulin dose was speifially hosen to lie within the range ommonly used in other fish and mammalian studies (between 5 and miukg ) (DeFronzo et al., 979; Ine, 98). Blood was sampled via the annula at different time points after treatment administration:, 5,, 5, 6, 9 and min. Groups of three fish were sampled at eah time point. After eah sampling, blood was flushed bak into the annula and the annula filled with heparin saline solution, whih was disarded at eah sampling time. Blood was immediately entrifuged and analysed for gluose and bovine insulin levels (see below). The K oeffiient was alulated following the modified formula suggested by Ottolenghi and olleagues (Ottolenghi et al., 995): K = logc logc, lo g(t t ) where C is the insulin onentration and t the time. Aute insulin administration was done using 8 h-fasted fish that were lightly anaesthetized with.5% (v/v) -phenoxyethanol, weighed, and intraperitoneally injeted with 5 ml kg body mass of saline solution alone (ontrol, N=8) or saline ontaining bovine insulin at. IU kg (or ~5 mgkg ) body mass (N=8). Sampling was initiated 6h after injetion. Eight fish per group were randomly killed by ervial setion and sampled. Blood was removed from the audal vein into ammonium-heparinized syringes and entrifuged ( g, 5 min), and the reovered plasma was immediately frozen and kept at C pending analyses. Liver and a sample of dorsoanterior white musle were disseted and immediately frozen in liquid nitrogen and kept at 8 C pending analyses. For hroni insulin administration, we used trout that were food deprived for 8 h and then implanted with D Alzet miniosmoti pumps (Duret Corp, Cupertino, CA, USA) ontaining either saline solution (ontrol, N=8) or bovine insulin solution (Sigma, N=8). Mini-pump flow rate was established to be.9mlh, whih at 7 C should provide sustained release of insulin at.5 IU kg day (or mg insulin kg day ) for days. Fish were first anaesthetized and their body mass determined. Minipumps were inserted into the peritoneal avity through a. m inision made in the ventral midline at a..m rostral of the pelvi fins. The inision was losed with one stith and antibioti ointment was applied topially to the inision area. After days, eight fish per group were killed and sampled as above. Moleular and biohemial analysis Gene expression levels were determined by real-time quantitative RT-PCR as previously (Díaz et al., 9; Kolditz et al., 8; Plagnes-Juan et al., 8). Primers were designed to overlap an intron if possible (Primer software) using known sequenes in nuleotide databases (GenBank and INRA-Sigenae), exept for 6-phosphofruto--kinase, liver isoform (6PFK-L; forward primer: GGTGGAGATGCACAAGGAAT; reverse primer: CTTGAT GTTGTCCCCTCCAT; tbk69.k.5_s.) and 6- phosphofruto--kinase, musle isoform (6PFK-M; forward primer: GGGA CCTCGAGATGAACGTA; reverse primer: GAGGGC GAAAGATGAAGTCTG; tad7a.e._...). Quantifiation of the target gene transript was done using efa gene expression as the referene (Olsvik et al., 5), whih was stably expressed in this experiment. Relative quantifiation of the target gene transript with the efa referene gene transript was done following the Pfaffl method (Pfaffl, ). Protein extration ( mg of protein for liver and musle) and western blotting were developed as desribed elsewhere (Plagnes- Juan et al., 8) using anti-phospho-akt Ser7, anti-akt and antib-tubulin antibodies (Cell Signaling Tehnology, Ozyme, St Quentin-en-Yvelines, Frane). These antibodies were shown to suessfully ross-reat with rainbow trout Akt and b-tubulin proteins (Seiliez et al., 8b). Plasma gluose levels were determined using a ommerial kit (Biomérieux, Mary l Etoile, Frane) adapted to a miroplate format. Bovine insulin levels were measured using a ommerial ELISA kit (Merodia, Uppsala, Sweden). Sine exogenous bovine and not endogenous trout insulin [inluding two isoforms whose biologial effetiveness remains to be larified (Plisetskaya, 989) but is expeted to be extremely low in 6day-fasted fish (see Navarro et al., 6)] levels were determined, we annot disregard possible mixed effets between the two insulin types in the present study. Glyogen levels [following the method of Keppler et al. (Keppler et al., 97)] and enzyme ativities were determined as desribed previously (Polakof et al., 8b). Briefly, glyogen phosphorylase (GPase) was

3 Insulin response in trout 5 assayed using 5 mmol l phosphate buffer (ph 7.), 7 mmol l MgSO, 9.5 mmol l EDTA,.5 mmol l NADP +, 5 mmol l gluose,6-bisphosphate,.5 mmol l AMP, exess phospho - gluomutase, exess gluose 6-phosphate dehydrogenase and mg ml glyogen (omitted in ontrols). GPase a ativity was measured with mmol l affeine present and total GPase ativity was estimated without affeine. The ratio of GPase ativity with and without affeine multiplied by represents the perentage of total GPase (a+b) in the ative form (% GPase a). Glyogen synthetase (GSase) was assessed using 5 mmol l imidazole-hcl (ph 7.5), 5 mmol l KCl, 5 mmol l MgCl, 5 mmol l phosphoenolpyruvate,.5 mmol l NADH, mg ml glyogen, exess pyruvate kinase, exess latate dehydrogenase and 6mmoll UDP-gluose (omitted in ontrols). Total GSase ativity was measured with 5 mmol l gluose 6-phosphate present, and GSase b ativity was estimated in the absene of gluose 6-phosphate. The ratio of GSase ativity without and with gluose 6-phosphate represents the perentage of total GSase (a+b) in the ative form (% GSase a). Statistial analysis Data are means ± s.e.m. Comparisons among groups and times for aorti administrations were performed using a two-way ANOVA (SigmaStat; SPSS, Chiago, IL, USA) with treatments (gluose, insulin, gluose plus gluose or gluose plus insulin) and time (, 5,, 5, 6, 9 and min) as independent variables. Post ho omparisons were made using a Student Newman Keuls test, and differenes were onsidered statistially signifiant at P<.5. Results of intraperitoneal injetion and implantation of insulin administration are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA using Student Newman Keuls multiple omparison test a posteriori. The level of signifiane was set at P<.5. When neessary (ratios and data normalization), data were log-transformed to fulfil the onditions of the analysis of variane. RESULTS Plasma glyaemia in annulated fish Plasma gluose levels in aorti annulated trout are shown in Fig.. Plasma glyaemia reahed its maximum level 5 min after a single gluose injetion into the dorsal aorta, returning slowly towards the basal level over the next h, and reovering ompletely 8h after the treatment (data not shown). The same time ourse profile was found after the o-administration of gluose and insulin, although the maximum glyaemi levels were lower than after the administration of gluose alone. In ontrast to this single injetion, the administration of gluose 5 min after a first gluose injetion produed a ontinuous inrease in glyaemia that was, however, - fold lower than the first one. The maximum gluose levels were reahed min after the first injetion. This observation was also supported by the K oeffiients, as the K ( ) value for the single gluose injetion was.7% min, while after the double gluose injetion the oeffiient reahed.%min. Similar to the profiles obtained in the first treatments, the o-administration of gluose and insulin after a first gluose injetion produed a similar kineti gluose appearane, but showed a lower maximum level. In this ase, the relative inrease after the seond injetion was.-fold smaller than after the first administration. Plasma glyaemia after aute and hroni insulin treatment After both intraperitoneal injetion and implantation treatment of insulin, gluose levels in 8 h-fasted trout dereased signifiantly (P<.5) with respet to their ontrols (Fig. A). In these treatments, Glyemia (%) a,b,b b b,, b,d b d Time (min) Glu Glu Glu Glu+Ins Glu Glu+Ins b,d,b,d,d Fig.. Time ourse of plasma gluose levels in rainbow trout after aorti injetion of gluose alone (5 mg kg ), gluose plus bovine insulin (75 miu kg ), gluose alone 5 min after a first gluose administration, and gluose plus insulin 5 min after a first gluose administration. Results are expressed as means ± s.e.m. (N=) and are represented as a perentage with respet to the preinjetion gluose levels in eah group. Mean initial plasma glyaemia (%) was.5±.9 mmol l. Comparisons were made by two-way ANOVA followed by Student Newman Keuls multiple omparison test. Signifiant differene between gluose plus gluose and gluose plus gluose and insulin injeted fish at eah sampling time (P<.5). Signifiant differene between gluose and gluose plus insulin injeted fish at eah sampling time (P<.5). Different letters indiate signifiant differenes between eah sampling time within eah injeted group. The arrow indiates the time of the seond injetion. hyperinsulinaemia was ahieved 6 h (aute) and days (hroni) after insulin administration (Fig. B). For the aute administration, the insulin dose was hosen based on preliminary studies (data not shown) in whih doses ommonly used in fish ( 6 IU kg ) demonstrated insulin levels 6 h after injetion that were -fold higher than the normal range desribed in fish (Mommsen and Plisetskaya, 99). Based on the results of Inui and Gorbman (Inui and Gorbman, 977) and the reommendation of Mommsen and Plisetskaya (Mommsen and Plisetskaya, 99) to ahieve physiologial insulin doses, fish were injeted with. IU kg of bovine insulin, ahieving ~ ng ml of plasma insulin and signifiant hypoglyaemia. For the hroni treatment the insulin dose was hosen based on previous trials arried out by us in order to determine the optimal onentration to ahieve hypoglyaemia in fish in that period of time, as reommended by Mommsen and Plisetskaya (Mommsen and Plisetskaya, 99). In this ase, after days of treatment insulin levels in trout were ±. ng ml ; higher doses were found to ause symptoms of irreversible oma and death in fasted fish (usually glyaemia < mmol l ) while the dose we used here produed a mild hypoglyaemia in healthy animals. Insulin signalling pathway after aute and hroni insulin treatment Total Akt protein levels and Akt phosphorylation status in liver and musle are presented in Fig.. After both aute and hroni insulin administration, Akt phosphorylation was inreased - to -fold in liver, although no hanges were noted in the total ontent of this protein. In skeletal musle, total Akt and phosphorylated Akt b, d d d

4 6 S. Polakof and others Gluose (mmol l ) Insulin (ng ml ) A B Saline Insulin inreased.75- and -fold, respetively, in fish reeiving a single hormone injetion (the ratio of p-akt to total Akt did inrease in insulin-treated trout); however, none of the Akt forms were affeted by the hroni hormone infusion in musle. Insulin-related gene expression after aute and hroni insulin treatment Changes in relative mrna transripts of key glyolyti and gluoneogeni enzymes are shown in Fig.. Transript levels of gluose transporter type (GLUT; Fig. A) and hexokinase (HK; Fig. B) over the short term were up-regulated in insulin-injeted fish, although transript levels of other glyolyti enzymes remained unaffeted by the hormone. In ontrast, gluokinase (GK) mrna levels (Fig. C) were diminished by insulin, resulting in a -fold derease in the levels of this enzyme. Transript levels of gluose 6-phosphatase (G6Pase; Fig. F) were greatly inreased by insulin, as were those of frutose,6-biphosphatase (FBPase; Fig. G). Phosphoenolpyruvate arboxykinase (PEPCK) transript levels (Fig. H) were unaffeted by insulin administration. Long-term administration of insulin, however, resulted in only minor hanges in transript levels of glyolyti enzymes like pyruvate kinase (PK; Fig. D), exept for GK, whih was strongly inhibited by insulin. Relative transript levels of key glyolyti enzymes and gluose transporters in musle are presented in Fig.5. In musle, aute insulin treatment eliited a ommon down-regulation response in levels of GLUT (Fig. 5A) and GLUT (Fig. 5B) transporters, and the Fig.. Plasma gluose (A) and bovine insulin (B) levels 6 h after intraperitoneal administration of insulin (. IU kg, short term) or after days of insulin implantation (.5 IU kg, long term) in 8 h-fasted rainbow trout. Control groups reeived, respetively, saline injetion or implantation. Results are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA followed by Student Newman Keuls multiple omparison test. Signifiant differene between insulin- and saline-treated fish (P<.5). glyolyti enzymes HK (Fig. 5C) and PK (Fig. 5D), while 6PFK (Fig. 5E) levels were unaffeted by insulin injetion. No hanges in transript levels of the glyolyti enzymes were found under longterm insulin treatment. However, expression of both gluose transporters was stimulated by hroni administration of the hormone. Glyogen metabolism after aute and hroni insulin treatment Glyogen levels, GPase and GSase enzyme ativities in liver and white skeletal musle of rainbow trout are shown in Fig. 6. Musle glyogen levels inreased dramatially up to 7-fold in insulininjeted fish. This inrease was paralleled by inreases in both total and ativated GSase ativity, while no hanges were noted in total GPase or perentage GPase a ativity. In ontrast, long-term insulin administration was haraterized by a -fold inrease in glyogen levels but no hanges in enzymes regulating its synthesis or depletion. In liver, short-term insulin administration produed a signifiant derease in glyogen levels, whih was followed by inreases in both total GPase and perentage GPase a ativity; no hanges ourred in GSase ativity. Long-term insulin infusion also dereased glyogen levels, but as in musle, glyogen-regulating enzymes were not affeted by the hormone. DISCUSSION The major anaboli funtions of insulin ation in fish are foused in the liver and skeletal musle (Mommsen and Plisetskaya, 99). Moreover, other lassial funtions attributed to insulin in mammals, inluding inreases in hepati glyogen stores and inhibition of gluoneogenesis, are not always observed in fish, and opposite or lak of ations are often desribed (Navarro et al., 6). Although hypoglyaemia is the most robust effet desribed in fish after insulin administration (Mommsen and Plisetskaya, 99), the mehanism by whih this happens remains under debate and the ontribution of the different peripheral tissues remains to be eluidated. In the present study we utilized aorti annulation to eluidate the ability of insulin to promote gluose learane and peripheral utilization in trout, as well as aute and hroni insulin administration to study the metaboli effets of this hormone at both biohemial and moleular levels. Plasma glyaemia regulation by insulin in annulated trout While the physiologial ations of insulin and its plasma kineti dynamis have been studied in fish (Ine, 98; Navarro et al., 6), its ability to indue gluose learane has reeived little attention (Thorpe and Ine, 97). In the present study, we found that if a seond gluose bolus is administrated to fasted trout, the glyaemi inrease is 5% lower than after a single injetion. This observation is also supported by the inreased K oeffiient following this seond injetion. However, it must be noted that even here the K oeffiient is still 9- to -fold lower than that of mammals (Appleton et al., ; Yajima et al., 98) and 5-fold higher than that of omnivorous fish speies (Ottolenghi et al., 995) but similar to those of other arnivorous fish (Ine and Thorpe, 97). Thus, in agreement with data from other fish speies (Ine and Thorpe, 97), these results suggest that rainbow trout an develop an improved apaity to lear and peripherally utilize gluose after the first injetion and will be more effiient at dealing with the seond load. This improvement in gluose learane effiieny after a first gluose load probably reflets an insulin-assistane proess, inluding stimulation of gluose-metabolizing enzyme ativities and gene expression. We also performed, for the first time in trout, o-

5 Insulin response in trout 7 p-akt 6 5 Liver Saline Insulin Musle 6 5 p-akt Fig.. Western blot analysis of Akt phosphorylation (p- Akt), total Akt protein, and p-akt to total Akt ratio in rainbow trout liver and musle after intraperitoneal administration of insulin (6 h) or insulin implantation ( days). The gel was loaded with mg of total protein per lane. Protein and phosphorylation levels were normalized with b-tubulin levels and are indiated as fold variation of the saline solution-treated group. Results are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA followed by Student Newman Keuls omparison test. Signifiant differene (P<.5). For more details see Fig.. Total Akt Total Akt p-akt/total Akt p-akt/total Akt injetions of gluose and insulin. The results obtained are in agreement with those mentioned above regarding double injetion of gluose, in whih lower maximum values of glyaemia and faster gluose learanes were found. These results are in agreement with a similar trial arried out in heart-annulated pikes (Esox luius) (Thorpe and Ine, 97), in whih o-injetion of insulin and gluose resulted in a greatly improved gluose tolerane, as observed by us in rainbow trout. Together, these results indiate that in trout exogenous insulin an improve gluose distribution and uptake by peripheral tissues. Aute insulin administration: metaboli regulation in musle and liver Most of the information onerning insulin ation on fish metabolism has been provided by intraperitoneal administration of the hormone (Mommsen and Plisetskaya, 99). However, the dose hosen for suh studies was often pharmaologial (Ine, 98b; Mommsen and Plisetskaya, 99; Navarro et al., 6; Plagnes- Juan et al., 8) and the information olleted, while valid, must be interpreted arefully. In the present study trout were intraperitoneally injeted with insulin at. IU kg, and the moderate hypoglyaemia (~ mmol l ) and insulin levels [~ ng ml, within the range observed post-prandially in this speies (Mommsen and Plisetskaya, 99)] observed in the trout 6 h after the hormone administration allow us to interpret our data from a physiologial point of view. The most probable senario explaining hypoglyaemia in insulininjeted rainbow trout in the present study is the onomitant and dramati inrease in musle glyogen levels. This inreased storage of gluose as glyogen after insulin administration was previously reported in several fish speies (Bhatt et al., 98; Emdin, 98; Ottolenghi et al., 98) and ould be related to the hanges in Akt protein found in skeletal musle. After insulin injetion we deteted not only more ative (phosphorylated) Akt but also more total Akt protein, probably resulting in a greater magnitude of insulinstimulated signal (Gosmanov et al., ), allowing a faster and stronger response of the musle to the hormone stimulation. Due to the high relative mass of the white skeletal musle in fish, a rapid response in aute insulin stimulation ould trigger a rapid and large gluose uptake and glyogen storage, explaining the aute hypoglyaemia experiened by insulin-injeted trout. This effet also mathes the lassial ation of insulin in mammals, in whih stimulation of gluose uptake by GLUT and ativation of GSase (through phosphorylation of Akt) are involved (Yeaman et al., ). However, in ontrast to other studies in trout (Capilla et al., ; Díaz et al., 9) no inreases in either GLUT or GLUT transript levels were found during hyperinsulinaemia; rather, a downregulation was observed. Sine GLUT is mainly regulated by transloation to the membrane (Díaz et al., 7), hanges in gluose uptake by this regulatory proess annot be ruled out in the present study. Nevertheless, our results in hypoglyaemi trout are onsistent with the response observed in mammals, where skeletal musle is

6 8 S. Polakof and others GLUT gene expression HK gene expression A C Saline Insulin B D GK gene expression PK gene expression Fig.. Effets of intraperitoneal administration of insulin (6 h) or insulin implantation ( days) on the level of mrna transripts enoding hepati genes. (A) Gluose transporter type (GLUT), (B) gluokinase (GK), (C) hexokinase (HK), (D) pyruvate kinase (PK), (E) 6-phosphofruto-- kinase (6PFK), (F) gluose 6-phosphatase (G6Pase), (G) frutose,6-bisphosphatase (FBPase) and (H) phosphoenolpyruvate arboxykinase (PEPCK). mrna levels were estimated using real-time RT-PCR. Expression values were normalized with elongation fator a (EFa) transripts and are indiated as fold variation of the saline solution-treated group. Results are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA followed by Student Newman Keuls omparison test. Signifiant differene (P<.5). For more details see Fig.. 6PFK gene expression FPBase gene expression E G F H G6Pase gene expression PEPCK gene expression largely responsible for the dereased systemi gluose uptake during hypoglyaemia, ontributing in an important manner to ounter-regulate it (Meyer et al., 5). In agreement with this derease in GLUT transript levels, glyolyti enzymes like HK or PK were also inhibited. Glyogen levels dereased in liver after insulin injetion in the present study (despite inreased Akt phosphorylation), probably as a result of the enhaned GPase ativity and the absene of hanges in GSase ativity. Although hepati glyogen levels after insulin administration in fish hange in a highly variable manner (Mommsen and Plisetskaya, 99), most studies using physiologial insulin doses show dereased glyogen onentrations (Navarro et al., 6). Thus, in fish as in mammals (Leavalier et al., 989), glyogen breakdown seems to be the primary mehanism responsible for the inrease in endogenous gluose prodution during the initial reovery from insulin-indued hypoglyaemia. Other oordinated responses in trout hepati metabolism were also observed in the short-term to deal with the insulin-indued hypoglyaemia. For example, we found that while GK transript levels were strongly down-regulated, G6Pase transripts were upregulated in insulin-injeted trout. Although in other fish (Egea et al., 7) and mammals (Iynedjian, 9) GK is always upregulated by insulin, in the present study its repression ould be related to the ounter-regulation during hypoglyaemia, bloking the large gluose entrane and phosphorylation. In the same sense, the inreased G6Pase transript level probably improves gluose export to the bloodstream, as observed in the mammalian liver under hypoglyaemi onditions (Bady et al., ). As a whole, it seems that the gluose/gluose 6-phosphate yle in fish liver is stritly regulated to meet the gluose requirements under insulin-indued hypoglyaemia, favouring gluose export and limiting gluose entry and phosphorylation to maintain normoglyaemia. These results are also supported by inreased transript levels of FBPase and GLUT, the last probably favouring gluose export into the blood. The fat that PEPCK transripts remain unaltered in insulin-injeted fish may be related to a delayed inrease in de novo gluose prodution, in ontrast to the rapid glyogenolyti proess ( h) during the ounter-regulation to hypoglyaemia (Caprio et al., 99). Globally, we found that when aute hypoglyaemia is produed by physiologial insulin doses, rainbow trout are able to deal with

7 Insulin response in trout 9 GLUT gene expression HK gene expression..5 A C Saline Insulin B D GLUT gene expression PK gene expression Fig. 5. Effets of intraperitoneal administration of insulin (6 h) or insulin implantation ( days) on the level of mrna transripts enoding musle genes. (A) gluose failitative transporter type (GLUT), (B) gluose failitative transporter type (GLUT), (C) HK, (D) PK and (E) 6PFK. mrna levels were estimated using real-time RT- PCR. Expression values were normalized with elongation fator a (EFa) transripts and are indiated as fold variation of the saline solutiontreated group. Results are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA followed by Student Newman Keuls omparison test. Signifiant differene (P<.5). For more details see Fig.. 6PFK gene expression..5 E the fall in plasma gluose levels in a very effiient manner. This proess inludes a strong and rapid hepati glyogenolyti response, but also moleular hanges in major enzymes involved in gluose metabolism. In addition, and despite the large glyogen storage (probably taking plae in the first hours of insulin exposure), dereased mrna levels of GLUTs and glyolyti enzymes (probably refleting depressed gluose transport and utilization) in the white musle of trout were found, whih ould also be taking plae in response to the hypoglyaemia. Thus even though the basis of this response in fish remains to be eluidated, the inrease in the level of glyogenolyti hormones (adrenaline or gluagon) as a result of the insulin-indued hypoglyaemia (Matty and Lone, 985) seems to be the more logial explanation. Our results show that under physiologial insulin treatment most of the results obtained in other studies with pharmaologial doses are not observed, probably due to a saturation of the system under high insulin levels (Ine, 98a) whih may mask the ounter-regulatory natural response to hypoglyaemia by the trout. Chroni insulin administration: metaboli regulation in liver and musle The long-term regulation of glyaemia and the effets of hroni insulin infusion on metaboli-related genes was studied in trout implanted with osmoti mini-pumps that delivered bovine insulin at. IU kg (or.5 IU kg day ), orresponding to the same amount of hormone administered in a single injetion for the aute trial. As far as we are aware, this is the first study in fish in whih Akt phosphorylation status has been assessed in the long-term in both skeletal musle and liver. Surprisingly, we found no ativation of Akt phosphorylation in musle after this insulin infusion. Although insulin levels in the present study were low, Akt phosphorylation in the liver was ativated, indiating that this level ould also be suffiient to ativate this protein in skeletal musle. The absene of phosphorylation of Akt was also desribed in skeletal musle of mammals during hroni insulin infusion, where it was onsidered a symptom of insulin resistane (Del Prato et al., 99; Ueno et al., 5). However, Ueno and olleagues showed that after 5 days of insulin infusion the rat liver also beame insulin resistant, like the musle (Ueno et al., 5), while Del Prato and olleagues did not find any suh symptoms during days of hyperinsulinaemia (Del Prato et al., 99). From these data, we an hypothesize that trout liver is not insulin resistant after days of insulin stimulation, although the liver may beome resistant if the hyperinsulinaemia is maintained for a longer period. Whereas in liver insulin stimulates Akt phosphorylation and inhibits de novo gluose prodution, in musle Akt phosphorylation is not stimulated, but in ontrast gluose transport and storage are enhaned. In mammals persistent hyperinsulinaemia leads to impaired insulin signalling through Akt, gluose transport, storage and gluose utilization in musle (Bertaa et al., 5; Del Prato et al., 99). In this ontext, Akt phosphorylation in musle seems to orrelate with different biologial effets on insulin-sensitive proesses in trout in omparison with mammals. Rainbow trout subjeted to a ontinuous mild insulin infusion over days exhibited hypoglyaemia as observed during the aute insulin treatment. However, this glyaemi profile may not result from the same metaboli events in the two ases. In ontrast to the aute trial where the hypoglyaemia was linked primarily to an inreased musle glyogenesis, during the hroni insulin treatment

8 5 S. Polakof and others Glyogen levels Total GSase ativity Liver Musle Saline Insulin Glyogen levels Total GSase ativity Fig. 6. Effets of intraperitoneal administration of insulin (6 h) or insulin implantation ( days) on the liver and musle glyogen levels, total glyogen synthase (GSase), ativated glyogen synthase (GSase a), total glyogen phosphorylase (GPase), and ativated glyogen phosphorylase (GPase a) of rainbow trout. GSase ativity (mu mg protein) in ontrols was: 55.69±.95 (liver i.p.),.95±.8 (liver pump), 98.±.5 (musle i.p.) and 5.55±5.6 (musle pump). GPase ativity (mu mg protein) in ontrols was: 768.8±.9 (liver i.p.), 88.9±5.88 (liver pump), 89.55±.6 (musle i.p.) and 7.±8. (musle pump). Data are indiated as fold variation of the saline solution-treated group. Results are expressed as means ± s.e.m. (N=8) and were analysed by one-way ANOVA followed by Student Newman Keuls omparison test. Signifiant differene (P<.5). For more details see Fig.. GSase a ativity GSase a ativity Total GPase ativity Total GPase ativity. GPase a ativity GPase a ativity the hypoglyaemia is most probably a result of a depressed hepati gluoneogenesis oupled to a persistent musle glyogenesis. Moreover, this hypoglyaemia ould be reinfored by an enhaned gluose uptake and storage in musle (aused by a diret insulin ation) whih was not observed during the short-term treatment, probably due to the urgeny of the ounter-regulatory proess against hypoglyaemia. Despite the important differenes in insulin levels in plasma in the aute (8.5 ng ml ) and the hroni ( ng ml ) treatments, fish from the two groups displayed the same degree of hypoglyaemia (about mmol l ). Unlike in the aute treatment where both hepati and musle metaboli reorganization were observed in order to deal with an aute hypoglyaemia, during the hroni insulin infusion the hepati metabolism seems not be subjet to the same ounter-regulatory hyopglyaemi urgeny. Although GK gene expression and glyogen levels are still down-regulated under hroni insulin stimulation, the degree of inhibition is less than that during the aute treatment. In fat, no hanges were notied in either GSase or GPase ativity suggesting that the glyogen metabolism is lose to equilibrium and glyogen stores are no longer potentially depleted. In agreement with this, we also found that G6Pase transript levels were not enhaned to failitate the export of gluose but in ontrast were down-regulated by insulin. Moreover, the global down-regulation of gluoneogeni transripts probably

9 Insulin response in trout 5 indiates a dereased potential for de novo gluose prodution, as desribed in mammals (MCormik et al., 979). After days of insulin infusion, as during the aute insulin treatment, we found that the musle played a ritial role in the events responsible for the hypoglyaemi effets of the hormone. Thus, enhaned gluose transport and storage were found during the hroni insulin infusion. This large gluose uptake and metabolism are probably responsible for an important part of the hypoglyaemi effet of insulin in fasted trout, sine the musle represents a large perentage of total fish mass and onstitutes the main target for insulin (see Plasma glyaemia regulation by insulin in annulated trout ). As mentioned above, despite the insulin resistane observed at the intraellular signalling level (degree of Akt phosphorylation), global musle metabolism is learly impliated in the uptake (inreased GLUT gene expression) and storage of gluose (enhaned glyogen deposition). As a whole, the metaboli response observed in the trout white musle is onsistent with the lassi anaboli role of insulin in mammals, inluding improved gluose uptake and storage, and the maintenane of oxidative gluose pathways (like glyolysis). Conlusions and perspetives Taken together, the results obtained in the present study indiate that the fasted rainbow trout is well adapted to respond to both aute and hroni inreases in irulating insulin levels, and that this hormone is able to improve gluose distribution and uptake by peripheral tissues, enhaning the apaity of the animal to deal with a gluose load. In addition, we found that in order to ounter-regulate the insulin-indued hypoglyaemia following aute insulin administration, trout metabolism is strongly modified, making it diffiult to meet some of the effets traditionally attributed to this hormone. However, the natural response to hypoglyaemia obtained in the present study allows us to validate our results in ontrast to those in whih insulin effets, while valid, were evaluated by employing pharmaologial insulin doses, where saturation of the system may have been ahieved. Despite the extremely low gluose intake of the trout under natural onditions, the present study demonstrates that this arnivorous fish speies is able not only to maintain stable plasma gluose levels during long fasting periods but also to initiate short-term effiient responses to hypoglyaemia, omposed of a rapid, oordinated response that inludes skeletal musle and liver metaboli reorganization. On the other hand and despite the insulin resistane observed in the musle at the signalling level, some of the funtions traditionally attributed to insulin were observed during the hroni insulin treatment, inluding inreased gluose uptake and storage (mostly in the skeletal musle) apaities as well as dereased de novo gluose prodution (in the liver). These results suggest that even when some evidene of ounter-regulation to hypoglyaemia remains, the hroni exposure of rainbow trout to physiologial insulin doses allows it to demonstrate several insulin effets that remain inaessible under aute physiologial or pharmaologial doses. Finally, data obtained in the present study do not support the idea that the gluose intolerane exhibited by arnivorous fish like rainbow trout is related to a low insulin sensitivity or insulin resistane in the fasted state. In ontrast, we demonstrate that this fish speies presents most of the metaboli omponents to effiiently utilize gluose in the appropriate insulin ontext. In this sense, the fat that rainbow trout, even having higher insulin levels than mammals (Mommsen and Plisetskaya, 99) and good insulin sensitivity in tissues over both the short and long term (this study), remains gluose intolerant represents for us a paradoxial situation. However, there are two observations that are worth mentioning. The first is the fat that urrent insulin radioimmunoassays in salmonids are possibly measuring proinsulin (the biologial ativity of whih remains to be eluidated) (Plisetskaya, 998), and then over-estimating real plasma insulin levels. In this ontext, it is possible that fish remain gluose intolerant just beause they are partially insulin defiient. The seond is that, although the use of fasted fish allows us to obtain a learer response to exogenous insulin, we annot ignore the fat that numerous fators interating in the postprandial state are not present here. Then, even in the right insulin ontext, gluose intolerane in trout ould still be influened by other fators inluding the interation with other hormones (i.e. somatostatins, gluagon) or nutrients (gluose, amino aids). LIST OF ABBREVIATIONS 6PFK-L 6-phosphofruto--kinase, liver isoform 6PFK-M 6-phosphofruto--kinase, musle isoform EFa elongation fator a FBPase frutose,6-bisphosphatase G6Pase gluose 6-phosphatase GK gluokinase GLUT gluose transporter type GLUT gluose transporter type GLUT gluose transporter type GPase glyogen phosphorylase GSase glyogen synthetase HK hexokinase PEPCK phosphoenolpyruvate arboxykinase PK-L pyruvate kinase, liver isoform PK-M pyruvate kinase, musle isoform ACKNOWLEDGEMENTS This study was supported by researh grants from Agene Nationale de la Reherhe (ANR-8-JCJC-5-) and INRA PHASE Department. S.P. was the reipient of a postdotoral fellowship from the Xunta de Galiia (Program Ángeles Alvariño). We aknowledge Dr C. Piou (INRA Saint-Pée-sur-Nivelle, Frane) for his expert assistane in pharmaokineti analysis, Dr T. W. Moon (University of Ottawa, Canada) for ritial reading of the manusript, T. Carbillet for tehnial assistane and the tehnial staff (Y. Hontang, F. Sandres and F. Terrier) of the INRA experimental fish farm of Donzaq for supplying the experimental animals. REFERENCES Ablett, R. F., Sinnhuber, R. O., Holmes, R. M. and Selivonhik, D. P. (98). The effet of prolonged administration of bovine insulin in rainbow trout (Salmo gairdneri R.). Gen. Comp. Endorinol., -7. Appleton, D. J., Rand, J. S., Priest, J. and Sunvold, G. D. (). Determination of referene values for gluose tolerane, insulin tolerane, and insulin sensitivity tests in linially normal ats. Am. J. Vet. Res. 6, Bady, I., Zitoun, C., Guignot, L. and Mithieux, G. (). Ativation of liver G-6-Pase in response to insulin-indued hypoglyemia or epinephrine infusion in the rat. Am. J. Physiol. Endorinol. Metab. 8, E95-E9. Bergot, F. (979). Effets of dietary arbohydrates and of their mode of distribution on glyaemia in rainbow trout (Salmo gairdneri Rihardson). Comp. Biohem. Physiol. 6A, Bertaa, A., Ciarone, A., Cehetti, P., Vianello, B., Laurenza, I., Maffei, M., Chiellini, C., Del Prato, S. and Benzi, L. (5). Continually high insulin levels impair Akt phosphorylation and gluose transport in human myoblasts. Metabolism 5, Bhatt, S. D., Khanna, S. S. and Gill, T. S. (98). Insulin effets in Clarias batrahus L.: a ombined biohemial and anatomial study. Anat. Anz. 8, 5-5. Capilla, E., Díaz, M., Gutiérrez, J. and Planas, J. V. (). Physiologial regulation of the expression of a GLUT homolog in fish skeletal musle. Am. J. Physiol. Endorinol. Metab. 8, E-E9. Caprio, S., Napoli, R., Saa, L., Tamborlane, W. V. and Sherwin, R. S. (99). Impaired stimulation of gluoneogenesis during prolonged hypoglyemia in intensively treated insulin-dependent diabeti subjets. J. Clin. Endorinol. Metab. 75, Castillo, J., Ammendrup-Johnsen, I., Codina, M., Navarro, I. and Gutiérrez, J. (6). IGF-I and insulin reeptor signal transdution in trout musle ells. Am. J. Physiol. Regul. Integr. Comp. Physiol. 9, R68-R69. De la Higuera, M. and Cárdenas, P. (986). Hormonal effets of gluoneogenesis from (U- C) glutamate in rainbow trout (Salmo gairdneri). Comp. Biohem. Physiol. B Biohem. Mol. Biol. 85, DeFronzo, R. A., Tobin, J. D. and Andres, R. (979). Gluose lamp tehnique: a method for quantifying insulin seretion and resistane. Am. J. Physiol. Endorinol. Metab. 7, E-E.

10 5 S. Polakof and others Del Prato, S., Leonetti, F., Simonson, D. C., Sheehan, P., Matsuda, M. and DeFronzo, R. A. (99). Effet of sustained physiologi hyperinsulinaemia and hyperglyaemia on insulin seretion and insulin sensitivity in man. Diabetologia 7, 5-5. Díaz, M., Antonesu, C. N., Capilla, E., Klip, A. and Planas, J. V. (7). Fish gluose transporter (GLUT)- differs from rat GLUT in its traffi harateristis but an transloate to the ell surfae in response to insulin in skeletal musle ells. Endorinology 8, Díaz, M., Vraskou, Y., Gutiérrez, J. and Planas, J. V. (9). Expression of rainbow trout gluose transporters GLUT and GLUT during in vitro musle ell differentiation and regulation by insulin and IGF-I. Am. J. Physiol. Regul. Integr. Comp. Physiol. 96, R79-R8. Egea, M., Meton, I. and Baanante, I. V. (7). Sp and Sp regulate gluokinase gene transription in the liver of gilthead sea bream (Sparus aurata). J. Mol. Endorinol. 8, 8-9. Emdin, S. O. (98). Effets of hagfish insulin in the atlanti hagfish, Myxine glutinosa. The in vivo metabolism of Cgluose and Cleuine and studies on starvation and gluose-loading. Gen. Comp. Endorinol. 7, -5. Foster, G. D. and Moon, T. W. (99). The role of glyogen phosphorylase in the regulation of glyogenolysis by insulin and gluagon in isolated eel (Anguilla rostrata) hepatoytes. Fish Physiol. Biohem. 8, Furuihi, M. and Yone, Y. (98). The utilization of arbohydrate by fishes.. Change of blood sugar and plasma insulin levels of fishes in gluose tolerane test. Bull. Jap. So. Si. Fish. 7, Gosmanov, A. R., Umpierrez, G. E., Karabell, A. H., Cuervo, R. and Thomason, D. B. (). Impaired expression and insulin-stimulated phosphorylation of Akt- in musle of obese patients with atypial diabetes. Am. J. Physiol. Endorinol. Metab. 87, E8-E5. Gutiérrez, J., Navarro, I., Planas, J. V., Montserrat, N., Rojas, P., Castillo, J., Chystiakova, O. V., Gabillard, J. C., Smith, A., Chan, S. J. et al. (6). Insulin and IGF reeptors in fish. In Fish Endorinology (ed. M. Reineke, G. Zaone and B. G. Kapoor), pp Enfield: Siene Publishers. Ine, B. W. (98). Plasma learane kinetis of unlabelled bovine insulin in rainbow trout (Salmo gairdneri). Gen. Comp. Endorinol. 6, 6-7. Ine, B. W. (98a). Effets of temperature and dose level on in vivo dynamis of unlabelled bovine insulin in eels (Anguilla anguilla L.). Gen. Comp. Endorinol. 9, 8-5. Ine, B. W. (98b). Panreati ontrol of metabolism. In Control Proesses in Fish Physiology (ed. J. C. Rankin, T. J. Pither and R. Duggan), pp London: Croom Helm. Ine, B. W. and Thorpe, A. (97). Effets of insulin and of metabolite loading on blood metabolites in the European silver eel (Anguilla anguilla L.). Gen. Comp. Endorinol., 6-7. Ine, B. W. and Thorpe, A. (976). The in vivo metabolism of C-gluose and C- glyine in insulin-treated northern pike (Esox luius L.). Gen. Comp. Endorinol. 8, Inui, Y. and Gorbman, A. (977). Sensitivity of Paifi hagfish, Eptatretus stouti, to mammalian insulin. Gen. Comp. Endorinol., -7. Iynedjian, P. B. (9). Moleular physiology of mammalian gluokinase. Cell. Mol. Life Si. 66, 7-. Keppler, D., Deker, K. and Bergmeyer, H. U. (97). Glyogen determination with amylogluosidase. In Methods of Enzymati Analysis (H.-U. Bergemeyer), pp. 7-. New York: Aademi Press. Kolditz, C., Borthaire, M., Rihard, N., Corraze, G., Panserat, S., Vahot, C., Lefevre, F. and Medale, F. (8). Liver and musle metaboli hanges indued by dietary energy ontent and geneti seletion in rainbow trout (Onorhynhus mykiss). Am J. Physiol. Regul. Integr. Comp. Physiol. 9, R5-R6. Leavalier, L., Bolli, G., Cryer, P. and Gerih, J. (989). Contributions of gluoneogenesis and glyogenolysis during gluose ounterregulation in normal humans. Am. J. Physiol. 56, E8-E85. Matty, A. J. and Lone, K. P. (985). The hormonal ontrol of metabolism and feeding. In Fish Energetis: New Perspetives (ed. P. Tyler and P. Calow), pp Baltimore: Johns Hopkins University Press. MCormik, K. L., Susa, J. B., Widness, J. A., Singer, D. B., Adamsons, K. and Shwartz, R. (979). Chroni hyperinsulinemia in the fetal rhesus monkey: effets on hepati enzymes ative in lipogenesis and arbohydrate metabolism. Diabetes 8, Meyer, C., Saar, P., Soydan, N., Ekhard, M., Bretzel, R. G., Gerih, J. and Linn, T. (5). A potential important role of skeletal musle in human ounterregulation of hypoglyemia. J. Clin. Endorinol. Metab. 9, Mommsen, T. P. and Plisetskaya, E. M. (99). Insulin in fishes and agnathans: history, struture, and metaboli regulation. Rev. Aquat. Si., Moon, T. W. (). Gluose intolerane in teleost fish: fat or fition? Comp. Biohem. Physiol. B Biohem. Mol. Biol. 9, -9. Navarro, I., Capilla, E., Castillo, A., Albalat, A., Díaz, M., Gallardo, M. A., Blaso, J., Planas, J. V., Gutiérrez, J., Reineke, M. et al. (6). Insulin metaboli effets in fish tissues. In Fish Endorinology (ed. M. Reineke, G. Zaone and B. G. Kapoor), pp Enfield: Siene Publishers. Olsvik, P. A., Lie, K. K., Jordal, A. E., Nilsen, T. O. and Hordvik, I. (5). Evaluation of potential referene genes in real-time RT-PCR studies of Atlanti salmon. BMC Mol. Biol. 6,. Ottolenghi, C., Puviani, A. C., Baruffaldi, A. and Brighenti, L. (98). Effet of insulin on arbohydrate metabolism in the atfish (Italurus melas). II. In vitro experiments. Boll. So. Ital. Biol. Sper. 57, Ottolenghi, C., Puviani, A. C. and Baruffaldi, A. (98). In vivo effets of insulin on arbohydrate metabolism of atfish (Italurus melas). Comp. Biohem. Physiol. 7A, 5-. Ottolenghi, C., Puviani, A. C., Rii, D., Brighenti, L. and Morsiani, E. (995). The effet of high temperature on blood gluose level in two teleost fish Italurus melas and Italurus puntatus. Comp. Biohem. Physiol. A, 9-5. Palmer, T. N. and Ryman, B. E. (97). Studies on oral gluose intolerane in fish. J. Fish Biol., -9. Pérez-Sánhez, J. (988). Metabolismo Intermediario En Juveniles De Lubina: Hormonas Panreátias, Control De La Gluemia Y Efeto Sparing. Barelona: Instituto de Auiultura de Torre la Sal (CSIC). Pfaffl, M. W. (). A new mathematial model for relative quantifiation in real-time RT-PCR. Nulei Aids Res. 9, e5. Plagnes-Juan, E., Lansard, M., Seiliez, I., Medale, F., Corraze, G., Kaushik, S., Panserat, S. and Skiba-Cassy, S. (8). Insulin regulates the expression of several metabolism-related genes in the liver and primary hepatoytes of rainbow trout (Onorhynhus mykiss). J. Exp. Biol., Plisetskaya, E. M. (989). Physiology of fish endorine panreas. Fish Physiol. Biohem. 7, 9-8. Plisetskaya, E. M. (998). Some of my not so favorite things about insulin and insulin-like growth fators in fish. Comp. Biohem. Physiol. B Biohem. Mol. Biol., -. Polakof, S., Míguez, J. M. and Soengas, J. L. (8a). Changes in food intake and gluosensing funtion of hypothalamus and hindbrain in rainbow trout subjeted to hyperglyemi or hypoglyemi onditions. J. Comp. Physiol. A Neuroethol. Sens. Neural. Behav. Physiol. 9, Polakof, S., Míguez, J. M. and Soengas, J. L. (8b). Dietary arbohydrates indue hanges in gluosensing apaity and food intake of rainbow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 95, R78-R89. Seiliez, I., Gabillard, J. C., Skiba-Cassy, S., Garía-Serrana, D., Gutiérrez, J., Kaushik, S., Panserat, S. and Tesseraud, S. (8a). An in vivo and in vitro assessment of TOR signaling asade in rainbow trout (Onorhynhus mykiss). Am. J. Physiol. Regul. Integr. Comp. Physiol. 95, R9-R5. Seiliez, I., Panserat, S., Skiba-Cassy, S., Friot, A., Vahot, C., Kaushik, S. and Tesseraud, S. (8b). Feeding status regulates the polyubiquitination step of the ubiquitin-proteasome-dependent proteolysis in rainbow trout (Onorhynhus mykiss) musle. J. Nutr. 8, Slagter, B. J., Kittilson, J. and Sheridan, M. A. (5). Expression of somatostatin reeptor mrnas is regulated in vivo by growth hormone, insulin, and insulin-like growth fator-i in rainbow trout (Onorhynhus mykiss). Regul. Pept. 8, 7-. Taniguhi, C. M., Emanuelli, B. and Kahn, C. R. (6). Critial nodes in signalling pathways: insights into insulin ation. Nat. Rev. Mol. Cell Biol. 7, Thorpe, A. and Ine, B. W. (97). The effets of panreati hormones, ateholamines, and gluose loading on blood metabolites in the northern pike (Esox luius L.). Gen. Comp. Endorinol., 9-. Ueno, M., Carvalheira, J. B., Tambasia, R. C., Bezerra, R. M., Amaral, M. E., Carneiro, E. M., Folli, F., Franhini, K. G. and Saad, M. J. (5). Regulation of insulin signalling by hyperinsulinaemia: role of IRS-/ serine phosphorylation and the mtor/p7 S6K pathway. Diabetologia 8, Wilson, R. P. (99). Utilization of dietary arbohydrate by fish. Aquaulture, Yajima, M., Okamoto, T., Kurokawa, S., Itoh, A., Terashima, A. and Ui, M. (98). Speies differenes in ations of islet-ativating protein, pertussis toxin. Jpn. J. Pharmaol., Yeaman, S. J., Armstrong, J. L., Bonavaud, S. M., Poinasamy, D., Pikersgill, L. and Halse, R. (). Regulation of glyogen synthesis in human musle ells. Biohem. So. Trans. 9, Zohar, Y. (98). Dorsal aorta atheterization in rainbow trout (Salmo gairdneri) I. Its validity in the study of blood gonadotropin patterns. Reprod. Nutr. Dev., 8-8.