Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence

Size: px
Start display at page:

Download "Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence"

Transcription

1 Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2 reverse MafA forward MafA reverse PDX-1 forward PDX-1 reverse NeuroD forward NeuroD reverse FoxA2 reverse FoxA2 reverse IRS-1 forward IRS-1 reverse IRS-2 forward Nuleotide sequene AAGAGCGTGCCCTACTTCAA CTCTTGCCCAGACTGGAGAG TGGATGACAGAGCCAGGATGG ACTTCTGAGCCTTCTGGGGTG CTTGCCCTCTGGGAGCCCA TGAAGGTCCCCGGGGCTTC CTTCCTCTGGGAGTCCCAC CACCTGCTCCCGGGCCTCCA TCAGAAGACAAGATCACCGG GTGAGCAGATCCTTCAGTCT AGGAGGAGGTCATCCGACTG CTTCTCGCTCTCCAGAATGTG AGCAGTACTACGCGGCCACA GCACTTCGTATGGGGAGATG GATCGTCACTATTCAGAACC CCTCTAGATCCTCATCTTCC CTGGGAGCCGTGAAGATGGA TGAGCCGCTCATGCCCGCCA GCGAGCCCTCCGGATACC GTGTAGAGAGCCACCAGGTGC AGCAGAAGCACGGCCACAA 1

2 IRS-2 reverse Cnd1 forward Cnd1 reverse Cnd2 forward Cnd2 reverse Cnd3 forward Cnd3 reverse CnA2 forward CnA2 reverse CnH forward CnH reverse Cdk1 forward Cdk1 reverse Cdk2 forward Cdk2 reverse Cdk4 forward Cdk4 reverse Cdk6 forward Cdk6 reverse 2F2 forward 2F2 reverse p16 forward p16 reverse p21 forward TGCTCGTTCTCCGCCGCTA CAAAATGCCAGAGGCGGATG GAAAGTGCGTTGTGCGGTAG CTGCGGAAAAGCTGTGCATT AACTTGAAGTCGGTAGCGCA GCTTCTCCTAGGACTCGCTAAC CATGTGCGGCTTGATCTCCT TCCTTGCTTTTGACTTGGCT ATGACTCAGGCCAGCTCTGT TGCATTTTTGGCCTGCAAAG TCCAACATGGGGTACCGAGT CACCAAGAAGCCGCTTTTCC AAAGTACGGGTGCTTCAGGG GTGTACCCAGCACCATGCTA AAATCTTGCCGAGCCCACTT CTCGCGGCCTGTGTCTATGG TCTGGAGGTGGCCCTTTATCT GCCTATGGGAAGGTGTTCAA GGGCTCTGGAACTTTATCCA ATTTGAAGACCCCACCCGAC CTGTCCGGCACTTCCAATCT GTCGCAGGTTCTTGGTCACT TCTGCACCGTAGTTGAGCAG TCCAGACATTCAGAGCCACA 2

3 p21 reverse p27 forward p27 reverse p57 forward p57 reverse prb forward prb reverse Cat forward Cat reverse Sod1 forward Sod1 reverse Gpx1 forward Gpx1 reverse 18S RNA forward 18S RNA reverse rsod1 forward rsod1 reverse rgpx1 forward rgpx1 reverse rcat forward rcat reverse rpdx1 forward rpdx1 reverse rbl-2 forward GACCCAGGGCTCAGGTAGA AGATACGAGTGGCAGGAGGT ATGCCGGTCCTCAGAGTTTG CACTCTGTACCATGTGCAAGGAGTA TTTCTCTTTTTGTTTTGCACTGAGA TCAGAAGGTCTGCCAACACC AAGCGCAGCTTTTTCAGTGG GTCCAGTGCGCTGTAGATGT GCGTGTAGGTGTGAATTGCG GTACCAGTGCAGGACCTCAT CGCAATCCCAATCACTCCAC TGCAATCAGTTCGGACACCA AAGGTAAAGAGCGGGTGAGC AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA ATGAAGGCCGTGTGCGTGCT CATTGCCCAGGTCTCCAACA TGGCACAGTCCACCGTGTAT CATTCTTGCCATTCTCCTGA CAGCCAGCGACCAGATGA CTGGTAATATCGTGGGTGAC GTGAGGAGCAGTACTACGCG AGCTGAGCTGGGAGGTGGT GAGGGGCTACGAGTGGGATA 3

4 rbl-2 reverse rbax forward rbax reverse rbad forward rbad reverse rcasp3 forward rcasp3 reverse rcasp8 forward rcasp8 reverse rcasp9 forward rcasp9 reverse CGGTAGCGACGAGAGAAGTC AGGGGCCTTTTTGCTACAGG CCAGTTGAAGTTGCCGTCTG AGATCCCAGAGTTTGAGCCG GCGCCTCCATGATGACTGTT ACCCTGAAATGGGCTTGTGT CACAGGTCCGTTCGTTCCAA GAACGTCTGGGCAACGAAGA TCCCGCCGACTGATATGGAA GCGCGACATGATCGAGGATA CCAGGTGGTCTAGGGGTGTA All nuleotide sequenes are in 5ʼ-to-3ʼ orientation and were purhased from Integrated DNA Tehnologies (Coralville, IA). All primers were for mouse mrna speies exept for the ones labeled with the lower ase letter of r for rat mrna speies. 4

5 Supplemental Figure legends: Supplemental Fig. 1. Central FoxO1 expression and food intake in FoxO1-tg vs. WT mie on regular how: FoxO1-tg mie (male, 12 weeks of age, n=6) and sex/age-mathed WT littermates (n=6) were euthanized and hypothalamus was retrieved for immunoblot analysis using anti- FoxO1 and anti-β-atin antibodies (A) as well as for real-time qrt-pcr analysis for quantifying FoxO1 mrna levels using 18S RNA as ontrol (B). In addition, FoxO1-tg mie (male, 12 weeks of age, n=3) and sex/age-mathed WT littermates (n=3) were euthanized and the whole brain FoxO1 protein levels were determined by anti-foxo1 and anti-β-atin immunoblot analysis (C). FoxO1-tg mie (male, 12 weeks of age, n=1) and sex/age-mathed WT littermates (n=1) were monitored for food intake. The amount of food intake per mouse was determined during a 24-h feeding period (D). NS, not signifiant. Supplemental Fig. 2. Food intake and immunoytohemistry of dispersed islet ells of FoxO1-tg vs. WT mie on high fat diet: (A) Food intake. FoxO1-tg mie (male, 8 weeks old, n=1) and sex/age-mathed WT littermates (n=1) were fed high fat for 8 weeks. Individual mie were monitored for food intake. The amount of food intake per mouse was determined during a 24-h feeding period. In addition, mie were plaed individually in metaboli ages with free aess to food and water in the Oxymax Lab Animal Monitoring System. After alamation for 2 days, oxygen onsumption and respiratory exhange ratio of mie were determined during a 48-h period. (B) The oxygen onsumption rate. (C) The mean oxygen onsumption rate. (D) The respiratory exhange ratio (RR) in a 12-h light/dark yle. 5

6 () The mean respiratory exhange ratio. To perform immunoytohemistry of dispersed islet ells, FoxO1-tg mie (male, 8 weeks old, n=4) and sex/age-mathed WT littermates (n=4) were fed high fat diet for 8 weeks. Mie were euthanized for isolating islets. Handpiked islets (n=1-15 per mouse) from ontrol and FoxO1-tg mie were dispersed into single ells by DTA-trypsin treatment, followed by anti-insulin immunoytohemistry. Shown are representative pitures of insulin-positive ells dispersed from about 5 islets in WT (F) and FoxO1-tg (G) groups. NS, not signifiant. Bar, 2 µm. Supplemental Fig. 3. Gluose and lipid metabolism in obese C57BL/6J mie: C57BL/6J mie (male, 6 weeks old, n=7 per group) were fed regular how or high fat diet for 1 weeks. Blood gluose and lipid metabolism were determined. (A) Gluose tolerane. Mie were fasted for 16 h, followed by i.p. injetion of gluose (2g/kg). Blood gluose levels were determined before and after gluose administration. (B) Plasma triglyeride levels. (C) Plasma holesterol levels. Plasma triglyeride and holesterol levels were determined in mie after 16-h fasting. *P<.5 and **P<.1 vs. lean mie. Supplemental Fig. 4. ffet of FoxO1 on Pdx1 expression and nulear loalization in β-ells: INS-1 ells were transdued with ontrol and FoxO1 vetor (1 pfu/ell) in ulture. ah ondition was run in tripliate. After 24-h inubation, ells were proessed for real-time qrt-pcr analysis for determining Pdx1 mrna levels (A), as well for immunoblot assay (B) for determining subellular distribution of Pdx1 (C) and FoxO1 (D). Aliquots of INS-1 pre-transdued with ontrol and FoxO1 vetor were subjeted to anti-pdx1 6

7 immunoytohemistry for visualizing FoxO1 and Pdx1 o-loalization (). Bar, 1 µm. *P<.5 vs. ontrol. NS, not signifiant. Supplemental Fig. 5. Immunohistohemistry of human fetal and mature panreas visualizes o-loalization of FoxO1 and Pdx1 in islet ells: Frozen setions of human fetal panreas (14-week old) were o-immunostained with rabbit anti-foxo1 (A) and guinea pig anti-pdx1 (B) antibodies, and ounter-stained with DAPI (C), followed by immunofluoresent mirosopy. Merged images were shown in (D). Panels (-H) were the same setions examined at high resolution. Similar results were reapitulated in mature human panreas. Frozen setions of human panreas (2.5 years old) were o-immunostained with rabbit anti-foxo1 (I) and guinea pig anti-pdx1 (J), followed by immunofluoresent mirosopy. Merged image was shown in (K). Islets were outlined by dash lines. Islet ells that were positively stained for both FoxO1 and Pdx1 in the nuleus were marked by arrows. Bar, 1 µm. Supplemental Fig. 6. The FoxO1 feedbak loop: FoxO1 ats to transmit insulin signal from ell surfae to downstream targets involved in ell metabolism, survival, proliferation and anti-oxidation. Inreased FoxO1 ativity stimulates the expression of Irs2, whih in turns inhibits FoxO1 ativity via the PI3K- Akt/PKB-dependent mehanism. This forms an autoregulated feedbak loop for regulating FoxO1 ativity in ells. Supplemental Fig. 7. FoxO1 integrates overnutrition to β-ell ompensation: FoxO1 ativity is upregulated in β-ells in response to metaboli stress suh as 7

8 overnutrition, obesity and/or insulin resistane. This effet primes β-ells to ompensate for obesity and insulin resistane via at least three distint mehanisms by improving β- ell mass and funtion, enhaning β-ell gluose sensing, and augmenting β-ell antioxidative funtion. This model is not exlusive of other potential mehanisms by FoxO1 orhestrates β-ell ompensation for overnutrition and insulin resistane in dietary obesity. 8

9 Supplemental Figure 1 A B - L. 2. NS a. <( z >< ::: 1.2 u (.).8 >< 1.2 o o.4 u.. (.).J::: a. o >- I Fox1 o.4.j:::. -atin - a.. >- WT Fox1-tg I WT Fox1-tg NS D NS - L. a >. C1l ><.8 32 NS u.. -O'l '.6.4 o ;: L. >. ( -o O'l Fox1 C1l (.). -atin WT Fox1-tg WT Fox1-tg

10 Supplemental Figure 2 A.5.4 NS s:: g, s 35.s.Q a. :::J (/) u > L WT Fox1-tg -o- WT +- Fox1-tg : ) :::J - 3 a :::J 25 (/) 8 8 > ro 2 -o-wt +- Fox1 -tg or _., Dark -o- WT Fox1-tg Light 1. Dark Light -o-wt +- Fox1 -tg (]) C) ro.s:: u X (]).8 a.. (/) :: w :: o;.... -=============== Dark Light :: w :: ro (]) Dark Light F G WT Fox1-tg

11 Supplemental Figure 3 A -...J 6 -D-Lean ---Obese "" -> 5 4 C/) 3 () ::J > 2 "" 1 o J "" -a, 1so. 12 "" 9 () 6 >. > 3 I- Lean Time (min) * Obese -2 *...J "" -> 15 - e 1oo... C/) 5 () Lean Obese

12 Supplemental Figure 4 A B C/) 2. > 1.6 <( 1.2 z a:::.8.4 X '" Cl. NS Nulear Fox1 Cytosoli Fox1 Nulear Pdx1 Cytosoli Pdx1 -a tin Control Fox1 Control Fox1 D Nule u s Cytoplasm C/) N ule u s 1.6 en > 6 > 5 * 1.2 " a; e... 3 a. a X '" 1 Cl. X Control Fox1 Control Fox1 LL. Control Fox1 Cytoplasm Control Fox1 Anti-Pdx1 DAPI Merged Control Fox1

13 Supplemental Figure 5 -en.:::&:...q,... - en u lo... () u a. u +-' - u ::::J I A 8 D F G H FOX1 PDX1 DAP1 Merged en u lo... () u a. lo... ::::J +-' u u ::::J I J FOX1 PDX1 Merged K

14 Supplemental Figure 6 lnsr PI3K Akt/PK 8! Metabolism Proliferation Anti-oxidation

15 Supplemental Figure 7 Metaboli Stress (Overnutrition, Obesity or Insulin Resistane) fi-cell Mass/Funtion Gluose Sensing Anti-Oxidation Beta-Cell Compensation

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48.

Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48. IFN (% of ells) CD7 Marophages Medium NCR LPS PMA/Ionomyin CD IFN (% of ells) T ells Marophages B ells DX CD9 KLRG NKGD B CDL CD CD CXCR CD9 CD NKGA/C/E NCR Ly9h Ly9G Ly9d Ly9i Ly9/i/h FMO CD7 CD9a CD7

More information

Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling

Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,

More information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

More information

% of Nestin-EGFP (+) cells

% of Nestin-EGFP (+) cells 8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

a b Pml F/F Prrx1-cre f 1.4 n.s.

a b Pml F/F Prrx1-cre f 1.4 n.s. a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1

More information

100 μm. Axon growth cones. Tubulin (red) + scr (green)

100 μm. Axon growth cones. Tubulin (red) + scr (green) Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1

More information

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua

More information

Normal Human Blood Glucose and Insulin Levels

Normal Human Blood Glucose and Insulin Levels Presented at the COMSOL Conferene 2010 Boston Normal Human Blood Gluose and Insulin Levels In healthy humans, blood gluose levels have to be maintained in a relatively narrow range (3.5 7.0 mm, 60 130

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor

Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Acute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish

Acute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Aute transriptional up-regulation speifi to osteoblasts/osteolasts in medaka fish immediately after exposure to mirogravity Masahiro Chatani, 1, Hiroya Morimoto,

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Expression and Significance of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma

Expression and Significance of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma Vet Pathol 39:458 472 (2002) Expression and Signifiane of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma A. KOENIG, S. R. BIANCO, S. FOSMIRE, J. WOJCIESZYN, AND J. F. MODIANO

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1 A novel approah to regulate ell membrane permeability for ATP and NADH formations in Saharomyes erevisiae indued by air old plasma 1 Xiaoyu DONG ( 董晓宇 ), Tingting LIU ( 刘婷婷 ), Yuqin XIONG ( 熊玉琴 ) Shool

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative

Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

Learned spatiotemporal sequence recognition and prediction in primary visual cortex

Learned spatiotemporal sequence recognition and prediction in primary visual cortex Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.

Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides. 1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Report on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques

Report on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques Report on Pathology Study: The effect of Compound X on pancreatic islets in rhesus macaques Prepared for: Client Name Client Address January 1, 2013 Prepared by: Charter Preclinical Services 21 Main St.,

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Ubiquitin-dependent degradation of TGF-β-activated Smad2

Ubiquitin-dependent degradation of TGF-β-activated Smad2 Ubiquitin-dependent degradation of -ativated Roger S. Lo* and Joan Massagué* *Cell Biology Program, Howard Hughes Medial Institute, Memorial Sloan-Kettering Caner Center, New York, New York 10021, USA

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Figure 1. Dnmt3b expression in murine and human knee joint cartilage. (A) Representative images

Figure 1. Dnmt3b expression in murine and human knee joint cartilage. (A) Representative images Figure Legends Figure. expression in murine and human knee joint cartilage. () Representative images showing that Dnmta is not expressed in chondrocytes from mo W articular cartilage [Dnmta expression

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al. s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

Supporting information

Supporting information Supporting information Evolution of Hollow TiO 2 Nanostrutures via the Kirkendall Effet Driven y Cation Exhange with Enhaned Photoeletrohemial Performane Yanhao Yu, 1 Xin Yin, 1 Alexander Kvit, 1,2 Xudong

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E Diabetologia () 5:9 95 DOI.7/s5--8-8 ARTICLE Methylglyoxal impairs insulin signalling and insulin ation on gluose-indued insulin seretion in the panreati beta ell line INS-E F. Fiory & A. Lombardi & C.

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

MPB333:Molecular Endocrinology of Obesity and Diabetes

MPB333:Molecular Endocrinology of Obesity and Diabetes MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and

More information

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Role of the actin cytoskeleton on epithelial Na

Role of the actin cytoskeleton on epithelial Na Kidney International, Vol. 48 (1995), pp. 970 984 Role of the atin ytoskeleton on epithelial Na hannel regulation Hoiio F. ANTIELLO Renal Unit, Massahusetts General Hospital and Department of Mediine,

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling

Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling Reeived 7 Fe 1 Aepted 14 May 1 Pulished 1 Jun 1 DOI: 1.138/nomms195 Impaired thermogenesis and adipose tissue development in mie with fat-speifi disruption of insulin and IGF-1 signalling Jeremie Bouher

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Body Mass Index Chart = overweight; = obese; >40= extreme obesity Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight

More information

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information