Insulin increases mrna abundance of the amino acid transporter SLC7A5/LAT1 via an mtorc1-dependent mechanism in skeletal muscle cells

Transcription

1 ORIGINAL RESEARCH Physiologial Reports ISSN X Insulin inreases mrna abundane of the amino aid transporter SLC7A5/LAT1 via an mtorc1-dependent mehanism in skeletal musle ells Dillon K. Walker 1,2, Miah J. Drummond 1, Jared M. Dikinson 1, Mihael S. Borak 1, Kristofer Jennings 3, Elena Volpi 4 & Blake B. Rasmussen 1,2 1 Department of Nutrition and Metabolism, University of Texas Medial Branh, Galveston, Texas 2 Division of Rehabilitation Sienes, University of Texas Medial Branh, Galveston, Texas 3 Division of Epidemiology and Biostatistis, Department of Preventive Mediine and Community Health, University of Texas Medial Branh, Galveston, Texas 4 Department of Internal Mediine, University of Texas Medial Branh, Galveston, Texas Keywords C2C12 myotubes, PAT1, rapamyin, SLC7A5, SNAT2. Correspondene Blake B. Rasmussen, Division of Rehabilitation Sienes, Department of Nutrition and Metabolism, University of Texas Medial Branh, 31 University Blvd., Galveston, TX Tel: (49) Fax: blrasmus@utmb.edu Present Address Dillon K. Walker, Center for Translational Researh in Aging and Longevity, Texas A&M University, College Station, Texas Miah J. Drummond, Department of Physial Therapy, University of Utah, Salt Lake City, Utah Jared M. Dikinson, Shool of Nutrition and Health Promotion, Arizona State University, Phoenix, Arizona Funding Information This study was supported by National Institutes of Health grants AR49877, AG18311, and AG Abstrat Amino aid transporters (AATs) provide a link between amino aid availability and mammalian/mehanisti target of rapamyin omplex 1 (mtorc1) ativation although the diret relationship remains unlear. Previous studies in various ell types have used high insulin onentrations to determine the role of insulin on mtorc1 signaling and AAT mrna abundane. However, this approah may limit appliability to human physiology. Therefore, we sought to determine the effet of insulin on mtorc1 signaling and whether lower insulin onentrations stimulate AAT mrna abundane in musle ells. We hypothesized that lower insulin onentrations would inrease mrna abundane of selet AAT via an mtorc1-dependent mehanism in C2C12 myotubes. Insulin (.5 nmol/l) signifiantly inreased phosphorylation of the mtorc1 downstream effetors p7 ribosomal protein S6 kinase 1 (S6K1) and ribosomal protein S6 (S6). A low rapamyin dose (2.5 nmol/l) signifiantly redued the insulin-(.5 nmol/l) stimulated S6K1 and S6 phosphorylation. A high rapamyin dose (5 nmol/l) further redued the insulin- (.5 nmol/l) stimulated phosphorylation of S6K1 and S6. Insulin (.5 nmol/ L) inreased mrna abundane of SLC38A2/SNAT2 (P.43) and SLC7A5/ LAT1 (P.21) at 24 min and SLC36A1/PAT1 (P =.39) at 3 min. High rapamyin prevented an inrease in SLC38A2/SNAT2 (P =.75) and SLC36A1/PAT1 (P.6) mrna abundane whereas both rapamyin doses prevented an inrease in SLC7A5/LAT1 (P.92) mrna abundane. We onlude that a low insulin onentration inreases SLC7A5/LAT1 mrna abundane in an mtorc1-dependent manner in skeletal musle ells. Reeived: 25 November 213; Revised: 23 January 214; Aepted: 24 January 214 doi: 1.12/phy2.238 Physiol Rep, 2 (3), 214, e238, doi: 1.12/phy2.238 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of This is an open aess artile under the terms of the Creative Commons Attribution Liense, whih permits use, distribution and reprodution in any medium, provided the original work is properly ited. 214 Vol. 2 Iss. 3 e238 Page 1

2 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. Introdution Maintenane of musle mass is ruial for funtionality and quality of life in aging and disease. The balane of musle mass is ahieved by a larger net positive balane between musle protein synthesis and breakdown. Musle protein anabolism an be stimulated by amino aids (Drummond and Rasmussen 28; Dikinson and Rasmussen 211), insulin (Timmerman et al. 21), and exerise (Fry et al. 211; Walker et al. 211). Insulin (in addition to amino aids and musle ontration) is apable of inreasing net musle protein anabolism through mammalian/ mehanisti target of rapamyin omplex 1 (mtorc1) signaling in vivo (Timmerman et al. 21) and in vitro (Proud 22). Insulin-indued ativation of mtorc1 ours via the phosphatidylinositol-3-kinase (PI3K)/Akt signaling pathway (Saltiel and Kahn 21). Ativation of mtorc1 results in phosphorylation of downstream effetors, p7 ribosomal protein S6 kinase 1 (S6K1) and eukaryoti initiation fator 4E-binding protein 1 (4E-BP1). S6K1 phosphorylates ribosomal protein S6 (rps6) leading to inreased translation of ribosomal and transription fator mrna resulting in protein translation initiation. Phosphorylation of 4E-BP1 relieves the inhibitory ation on eif4e allowing the eif4f translational initiation omplex to form initiating protein translation. Amino aid transporters (AATs) are ubiquitously expressed in many ell types and primarily funtion within the plasma membrane. Upon stimulation by insulin, ativity, and reruitment of the AAT, sodium-oupled neutral AAT 2 (SNAT2:SLC38A2) is enhaned (MDowell et al. 1998). SNAT2 mediates the Na + -dependent transport of short-hain amino aids and is reruited from an intraellular ompartment to the plasma membrane in a PI3Kdependent manner (Kashiwagi et al. 29). Reent researh suggests that speifi AAT are apable of regulating mtorc1 signaling. For example, inreasing intraellular glutamine onentrations via SNAT2 allows the antiport transporter, L-type AAT (LAT1: whih onsists of a heterodimer of SLC7A5 and SLC3A2) to exhange leuine for glutamine thus ativating mtorc1 (Baird et al. 29). This oupling mehanism is ritial for amino aid uptake and sensing upstream of mtorc1. Additionally, the AAT, proton-assisted AAT (PAT1:SLC36A1) has been shown to be loalized to the lysosomal membrane and failitate mtorc1 ativation (Ogmundsdottir et al. 212). Given the potential regulatory role these AAT have on mtorc1 ativation, understanding their regulation is neessary for maintaining musle mass. Notably, mtorc1 has been shown to regulate LAT1 ativity ultimately altering leuine uptake by the ell (Roos et al. 27). Given the role insulin plays in mtor ativation, it is oneivable that insulin regulates selet AATs. However, the effet of insulin on SLC38A2/SNAT2, SLC7A5/LAT1, SLC36A1/PAT1, and SLC7A1/CAT1 (ationi AAT1 an AAT also linked to mtorc1 signaling; Huang et al. 27), mrna abundane and the involvement of mtorc1 signaling has not been determined in a musle ell model using low insulin onentrations. Clinial in vivo studies are a ruial starting point and provide valuable information; however, beause the data are orrelational, delineating preise mehanisms is limited. Murine C2C12 musle myotubes are a widely used ommerial ell line for studying nutrient regulation (Conejo and Lorenzo 21; Shen et al. 25; MaKenzie et al. 29; Haegens et al. 212). Using ell ulture models provides an opportunity to ondut funtional studies by altering speifi media omponents to approximate human physiologial levels. Therefore, the purpose of this study was to (1) ompare different onentrations of insulin on mtorc1 signaling in C2C12 myotubes, and (2) determine the ability of low insulin onentrations to alter mrna abundane of SLC38A2/SNAT2, SLC7A5/LAT1, SLC7A1/ CAT1, and SLC36A1/PAT1 over a 4-h period. We hypothesized that insulin (.5 nmol/l) stimulates inreases in AAT mrna abundane and ours via an mtorc1- dependent mehanism. Experimental Proedures Cell ulture Murine C2C12 myoblasts were obtained from Amerian Type Culture Colletion and were ultured on.1% gelatin-(sigma-aldrih, St. Louis, MO) oated tissue ultureware in growth media (high-gluose Dulbeo s modified Eagle medium supplemented with 1% fetal bovine serum, 5 U of peniillin/ml, 5 lg of streptomyin/ml; Invitrogen, Carlsbad, CA) at 37 C in an atmosphere of 5% CO 2 /95% air. At ~9% onflueny, differentiation medium (low-gluose Dulbeo s modified Eagle medium supplemented with 2% horse serum, 5 U of peniillin/ml, 5 lg of streptomyin/ml; Invitrogen, Carlsbad, CA) was added to ultures for 4 5 days to allow formation of multinuleated myotubes. Prior to experiments, myotubes were serum starved for 4 h followed by nutrient deprivation for 3 min in HEPES-buffered saline (HBS, 2 mmol/l HEPES/Na, 14 mmol/l NaCl, 2.5 mmol/l MgSO 4, 5 mmol/l KCl, and 1 mmol/l CaCl 2 ; ph 7.4; Sigma-Aldrih). Experimental design In experiment 1 (Fig. 1), myotubes were inubated with.5,.25,.5, 1, 1, and 5 nmol/l insulin onentra- 214 Vol. 2 Iss. 3 e238 Page 2 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

3 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent A 1 Fold hange from Fold hange from Fold hange from B D Insulin, nm phospho total Insulin, nm phospho total Insulin, nm phospho total d a a a b d e e e f f Akt:Ser min Insulin, nmol/l 6 min Insulin, nm phospho g h e d h i i e d f g i j j a f e b g f h j k k min Insulin, nmol/l 6 min Insulin, nm phospho E-BP1:Thr37/46 5 mtor:ser2448 a a a.5 b d d d e a a a d e e f f b e f f 5 12 min 12 min C 3 Fold hange from Fold hange from 2 1 total total Insulin, nmol/l 6min Insulin, nmol/l Insulin, nmol/l 3 min 6 min 12 min 3 min 6 min 12 min min S6K1:Thr389 f h h b g i b a i d h j a j a b a ba b b ed d e i b a d j e d a a a d d d a a a d d d f k k e k k e e e e e e a a a a f g h g g f f g f d g g a h a e e d d d f h h h a rps6:ser24/ min b d g d e a a f b b b b b a e h g e f g i a d b d d d a b d a d g d b d e f i h f e h i h a e e Figure 1. The effet of insulin onentrations on Akt and mtor signaling. Different (.5,.25,.5, 1, 1, and 5 nmol/l) onentrations of insulin (in HBS) were inubated with myotubes for 3, 6, and 12 min. Myotubes were lysed and protein extrats were analyzed using western blotting. (A) Phosphorylation status of Akt Ser38. abdef Columns with unommon letters differ, P = (B) Phosphorylation status of mtor Ser2448. abdefghijk Columns with unommon letters differ, P = (C) Phosphorylation status of S6K1 Thr389. abde Columns with unommon letters differ, P =.376. (D) Phosphorylation status of 4E-BP1 Thr37/46. abdefgh Columns with unommon letters differ, P <.1. (E) Phosphorylation status of ribosomal protein S6 Ser24/244. abdefghi Columns with unommon letters differ, P =.775. Resulting images are displayed from a representative experiment above eah graph. For arrangement of samples in gels for eletrophoresis, all time points for two samples were run on a single gel. Thus, all samples were not run on a single gel/blot. Data are mean SEM and are presented as phospho/ total made relative to baseline. E a a a b b b 5 g g e h h f i i 5 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 3

4 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. tions for 3, 6, and 12 min. For experiment 2 (Fig. 2), myotubes were inubated with.5 nmol/l insulin for 3 min with and without a low (2.5 nmol/l) and high (5 nmol/l) dose of rapamyin. Rapamyin was preinubated with myotubes 3 min prior to reeiving insulin. The rapamyin onentration of 2.5 nmol/l (low) was used to represent the peak onentration reorded in plasma when 16 mg rapamyin was administered to subjets (Dikinson et al. 211) and 5 nmol/l (high) was used to represent a higher dose used in ell ulture experiments (Guertin et al. 26; Wen et al. 213). For experiment 3 (Fig. 3),.5 and.5 nmol/l insulin were A B C D E Figure 2. The effet of rapamyin on.5 nmol/l insulin-stimulated inreases in Akt and mtorc1 signaling. Cells reeiving rapamyin were pretreated with either 2.5 or 5 nmol/l rapamyin (in HBS) for 3 min prior to reeiving insulin. Then insulin (.5 nmol/l) in HBS was inubated with ells with or without 2.5 or 5 nmol/l rapamyin for 3 min. Myotubes were lysed and protein extrats were analyzed using western blotting. ab Columns with unommon letters differ, main effet of treatment, (A) P =.246 for Akt Ser38 ; (B) P =.24 for mtor Ser2448 ; (C) P =.4 for S6K1 Thr389 ; (D) P <.1 for 4E-BP1 Thr37/46 ; (E) P =.19 for ribosomal protein S6 Ser24/244. Resulting images are displayed from a representative experiment above eah graph. For arrangement of samples in gels for eletrophoresis, samples from two experiments were run on a single gel. Thus, all samples were not run on a single gel/blot. Data are mean SEM and are presented as phospho/total made relative to baseline. 214 Vol. 2 Iss. 3 e238 Page 4 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

5 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent Figure 3. The effet of.5 nmol/l insulin on amino aid transporter mrna abundane myotubes reeived,.5, or.5 nmol/l onentrations of insulin (in HBS) for 3, 6, 12, and 24 min. Myotubes were lysed, RNA isolated, DNA synthesized, and analyzed using real-time qpcr for mrna abundane of (A) SLC38A2/SNAT2, (B) SLC7A5/LAT1, (C) SLC7A1/CAT1, (D) SLC36A1/PAT1. *Different from, P <.5. # Different from.5, P <.5. Data are mean SEM and alulated using the ΔΔCt method with GAPDH used as the referene gene. inubated with myotubes for 3, 6, 12, and 24 min. For experiment 4 (Fig. 4), myotubes were inubated with or without 2.5 or 5 nmol/l rapamyin 3 min prior to inubation with.5 or.5 nmol/l insulin for 24 min. In all experiments, myotubes inubated with insulin and/or rapamyin were inluded and referred to as baseline. RNA isolation and real-time qpcr Following treatments, myotubes were rinsed with PBS three times and myotubes were srapped in 1 ml TRI Reagent for RNA isolation. The RNA was separated into an aqueous phase using.2 ml hloroform and preipitated from the aqueous phase using.5 ml of isopropanol. The resultant RNA pellet was washed with 1 ml of 75% ethanol, air dried, and then suspended in a known amount of nulease-free water. RNA onentration was determined using the NanoDrop 2 spetrophotometer (Thermo Fisher Sientifi, Wilmington, DE). A total of 1 lg of RNA was reverse transribed into DNA aording to the manufaturer s protool (isript; BioRad, Herules, CA). Real-time qpcr was arried out with an iq5 multiolor Real-Time PCR yler (BioRad) using SYBR green fluoresene (iq SYBR green supermix; Bio- Rad). Primer sequenes are presented in Table 1. GAPDH was utilized as a housekeeping gene and relative fold hanges were determined from the Ct values using the ΔΔCt method. Protein isolation and western blotting Following treatments, myotubes were rinsed with PBS three times. Myotubes were srapped in ie-old extration buffer (5 mmol/l Tris-HCl, 25 mmol/l mannitol, 5 mmol/l NaF, 5 mmol/l Na pyrophosphate, 1 mmol/l ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 5

6 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. Figure 4. The effet of rapamyin on.5 nmol/l insulin-stimulated inrease in amino aid transporter mrna abundane. Cells reeiving rapamyin were pretreated with either 2.5 or 5 nmol/l rapamyin (in HBS) for 3 min prior to reeiving insulin. Then,.5, or.5 nmol/l insulin in HBS was inubated with ells with or without 2.5 or 5 nmol/l rapamyin for 24 min. Myotubes were lysed, RNA isolated, DNA synthesized, and analyzed using real time qpcr for mrna abundane of (A) SLC38A2/SNAT2, (B) SLC7A5/LAT1, (C) SLC7A1/CAT1, (D) SLC36A1/PAT1. *Different from, P <.5. # Different from.5, P <.5. Data are mean SEM and alulated using the ΔΔCt method with GAPDH used as the referene gene. EDTA, 1 mmol/l EGTA, 1% Triton X-1, 1 mmol/l DTT, 1 mmol/l benzamidine,.1 mmol/l PMSF, 5 lg/ ml soybean trypsin inhibitor, ph 7.4) then snap frozen in liquid nitrogen and thawed to failitate ell lyses. Cell lysates were vortexed three times and soniated for 15 se. Protein onentrations were determined using a Bradford Protein Assay (Smartspe Plus, Bio-Rad, Herules, CA). Cell lysates were diluted (1:1) in a 29 sample buffer mixture (125 mmol/l Tris, ph 6.8, 25% glyerol, 2.5% SDS, 2.5% b-meraptoethanol, and.2% bromophenol blue) and then boiled for 3 min at 1 C. Equal amounts of total protein (7 lg) were loaded into eah lane and the samples were separated by eletrophoresis at 15 V for 6 min on a 7.5% or 15% polyarylamide gel (Criterion, Bio-Rad). Eah sample was loaded in dupliate and eah gel ontained an internal loading ontrol and moleular weight ladder (Preision Plus, Bio-Rad). Following eletrophoresis, protein was transferred to a polyvinylidene difluoride membrane (Bio-rad) at 5 V for 6 min. Blots were bloked in 5% nonfat dry milk for 1 h and then inubated with primary antibody overnight at 4 C (see below). The following morning, blots were inubated in seondary antibody for 1 h at room temperature. Blots were then inubated in a hemiluminesent 214 Vol. 2 Iss. 3 e238 Page 6 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

7 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent Table 1. Mouse primer sequenes used for real-time qpcr. Protein Gene Aession # Primer sequene (5 to 3 ) GAPDH GAPDH NM_884 Forward CCAGCAAGGACACTGAGCAAGA Reverse TCCCTAGGCCCCTCCTGTTAT SNAT2 SLC38A2 NM_ Forward GGCATTCAATAGCACCGCAG Reverse ACGGAACTCCGGATAGGGAA LAT1 SLC7A5 NM_1144 Forward CTTCGGCTCTGTCAATGGGT Reverse TTCACCTTGATGGGACGCTC CAT1 SLC7A1 NM_7513 Forward GTCTATGTCCTAGCCGGTGC Reverse GAGCCTAGGAGACTGGTGGA PAT1 SLC36A1 NM_ Forward CCGCTACCATGTCCACACAG Reverse GGCCACGATACCAATCACCA solution (ECL plus, Amersham BioSienes, Pisataway, NJ) for 5 min and optial density measurements were made using a digital imager (ChemiDo, Bio-Rad) and densitometri analysis was performed using Quantity One software (Bio-Rad). Membranes ontaining phospho-deteted proteins were stripped of primary and seondary antibodies using Restore Western Blot Stripping buffer (Piere Biotehnology, Rokford, IL) and were reprobed for total protein with the speifi antibody of interest. Phospho and total density values were normalized to the internal loading ontrol and the phospho:total protein ratios were determined. Immunoblot data are expressed as phospho divided by total protein and adjusted to represent fold hange from baseline ( insulin and/or rapamyin). Antibodies The phospho and total antibodies used for immunoblotting were purhased from Cell Signaling (Beverly, CA): phospho-akt (Ser 38 ; 1:1), phospho-mtor (Ser 2448 ; 1:5), phospho-s6k1 (Thr 389 ;1: 5), phospho-4e-bp1 (Thr 37/46 ; 1:1), and phospho-rps6 (Ser 24/244 ; 1:25). Total protein was deteted for Akt (1:1), mtor (1:5), S6K1 (1:5), 4E-BP1 (1:1), and rps6 (1:25). Anti-rabbit IgG HRP-onjugated seondary antibody was purhased from Amersham Biosiene (1:2). Statistial analysis Data were analyzed using the MIXED proedure of SAS System for Windows Release 9.3 (SAS Institute In., Cary, NC). Data were analyzed as a ompletely randomized design. For insulin and time titration experiments for protein expression data, the model ontained the effets of insulin and time, along with their interation; to aount for nononstant variane in the data, all values were log transformed before being modeled. Eah representative was modeled as a random bloking fator with a Kenwood-Rodgers degrees of freedom adjustment. For insulin 9 rapamyin experiments for protein expression data and AAT mrna abundane data, the model ontained the effets of insulin and rapamyin, and along with an interation term. Eah representative was modeled as a random bloking fator. For insulin and time titration experiments for AAT mrna abundane data, the model ontained the effets of insulin and time, and along with an interation term. Eah representative was modeled as a random bloking fator with a Kenwood- Rodgers degrees of freedom adjustment. Treatment means were omputed using the LSMEANS option, and pairwise t-tests were used to separate means and signifiane was determined at P <.5. All data are presented at the original sale with standard errors. Results Insulin inreases phosphorylation of Akt and mtorc1 signaling To investigate whether varying onentrations of insulin would stimulate Akt and mtorc1 signaling, inreasing onentrations of insulin were inubated with C2C12 myotubes for 3, 6, and 12 min. Insulin onentrations of.5 nmol/l and.25 nmol/l did not alter phosphorylation of Akt relative to baseline aross all time points (Fig. 1A; effet of insulin, P <.1). However, inubation of myotubes with.5 and 1 nmol/l insulin signifiantly inreased Akt phosphorylation above baseline,.5, and.25 nmol/l insulin and inubation with 1 and 5 nmol/l insulin signifiantly inrease Akt phosphorylation above baseline,.5,.25,.5, and 1 nmol/l insulin. No signifiant insulin 9 time interation was deteted (P =.99). Phosphorylation of mtor was elevated at 3 and 6 min ompared to 12 min (Fig. 1B; effet of time, P =.3). Inubation of myotubes with.5,.25,.5, ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 7

8 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. and 1 nmol/l insulin inreased mtor phosphorylation above baseline whereas 1 and 5 nmol/l insulin inreased mtor phosphorylation above baseline,.5,.25,.5, and 1 nmol/l (effet of insulin, P <.1). No signifiant insulin 9 time interation was deteted (P =.312). Inubation of myotubes with.5 and.25 nmol/l insulin did not hange S6K1 phosphorylation relative to baseline. However,.5, 1, 1, and 5 nmol/l insulin inreased S6K1 phosphorylation above baseline,.5, and.25 nmol/l insulin at 3 min, to a lesser extent at 6 min, but not at 12 min (Fig. 1C; insulin 9 time interation, P =.38). Phosphorylation of ribosomal protein S6 was greatest at 6 min ompared to 3 and 12 min (Fig. 1E; effet of time, P =.3). Inubation of myotubes with.5 and 1 nmol/l insulin inreased ribosomal protein S6 phosphorylation above baseline,.5, and.25 whereas 1 and 5 nmol/l insulin inreased ribosomal protein S6 phosphorylation above all other insulin onentrations (effet of insulin, P =.3). At 3 and 6 min of inubation,.5 and.25 nmol/l insulin inreased phosphorylation of 4E-BP1 above baseline and.5, 1, 1, and 5 nmol/l insulin inreased phosphorylation of 4E-BP1 above baseline and.5 (and.25 nmol/l at 3 min) whereas only 1, 1, and 5 nmol/l insulin inreased 4E-BP1 phosphorylation above baseline at 12 min (Fig. 1D; insulin 9 time interation, P <.1). Rapamyin inhibits insulin-indued mtorc1 signaling To determine whether rapamyin an redue insulin (.5 nmol/l; whih approximates human postprandial insulin onentrations) indued upregulation of mtorc1 signaling, myotubes were inubated with a low (2.5 nmol/ L) and high (5 nmol/l) onentration of rapamyin for 3 min prior to the addition of.5 nmol/l insulin to ultures. Inubation of myotubes with.5 nmol/l insulin and.5 nmol/l insulin plus low rapamyin did not hange Akt phosphorylation above baseline (Fig. 2A; P.76) whereas the addition of high rapamyin with.5 nmol/l insulin inreased Akt phosphorylation above baseline and insulin alone (P.36; effet of treatment, P =.25). mtor phosphorylation was inreased above baseline with.5 nmol/l insulin and.5 nmol/l insulin plus low rapamyin (P.13); however, inubation with.5 nmol/l insulin plus high rapamyin did not hange phosphorylation of mtor relative to baseline,.5 nmol/l insulin and.5 nmol/l insulin plus low rapamyin (Fig. 2B; P.54; effet of treatment, P =.24). Phosphorylation of S6K1 was inreased above baseline by.5 nmol/l insulin (P =.2), and by.5 nmol/l insulin plus low rapamyin (P =.41) whereas S6K1 phosphorylation was not different than baseline when.5 nmol/l insulin plus high rapamyin were added (Fig. 2C; P =.544; effet of treatment, P =.4). S6K1 phosphorylation was less with.5 nmol/l insulin plus low rapamyin ompared to.5 nmol/l insulin (P =.1) and was less with.5 nmol/l insulin plus high rapamyin ompared to.5 nmol/l insulin plus low rapamyin (P =.17). Phosphorylation of ribosomal protein S6 was inreased above baseline by.5 nmol/l insulin (P =.7) and by.5 nmol/l insulin plus low rapamyin (P =.42) whereas ribosomal protein S6 phosphorylation was not different than baseline when.5 nmol/l insulin plus high rapamyin were added (Fig. 2E; P =.936; effet of treatment, P =.2). Ribosomal protein S6 phosphorylation was less with.5 nmol/l insulin plus low rapamyin ompared to.5 nmol/l insulin (P =.8) and was less with.5 nmol/l insulin plus high rapamyin ompared to.5 nmol/l insulin plus low rapamyin (P =.38). Phosphorylation of 4E-BP1 was inreased by.5 nmol/l insulin (P <.1),.5 nmol/l insulin plus low rapamyin (P <.1), and.5 nmol/l insulin plus high rapamyin (P <.1) whereas 4E-BP1 phosphorylation by.5 nmol/l insulin plus low rapamyin was not different ompared to.5 nmol/l insulin (P =.636) and was dereased by.5 nmol/l insulin plus high rapamyin ompared to.5 nmol/l insulin plus low rapamyin (Fig. 2D; P =.32; effet of treatment, P <.1). Insulin inreases mrna abundane of SLC38A2/SNAT2, SLC7A5/LAT1, and SLC36A1/ PAT1, but not SLC7A1/CAT1 Next, we wanted to determine if.5 nmol/l insulin would inrease mrna abundane of speifi AAT in C2C12 myotubes. When myotubes were inubated with.5 and.5 nmol/l insulin, no hanges in the mrna abundane of SLC38A2/SNAT2 (Fig. 3A) and SLC7A5/LAT1 (Fig. 3B) were noted at 3, 6, and 12 min (insulin 9 time interation, P =.529 for SLC38A2/SNAT2 and P =.549 for SLC7A5/LAT1); however, at 24 min SLC38A2/SNAT2 (P.43) and SLC7A5/LAT1 (P.21) were inreased by.5 nmol/l insulin as ompared to baseline and.5 nmol/l insulin. Aross all times,.5 nmol/l insulin inreased SLC7A5/LAT1 mrna abundane relative to baseline and.5 nmol/l insulin (effet of insulin, P =.31). No differenes were noted in SLC7A1/CAT1 mrna abundane (Fig. 3C; insulin 9 time interation, P =.897). Insulin (.5 nmol/l) inreased SLC36A1/PAT1 mrna abundane at 3 min relative to.5 nmol/l insulin (P =.39), tended to inrease SLC36A1/PAT1 at 3 min relative to baseline (P =.77), and tended to inrease SLC36A1/PAT1 at 24 min relative to baseline 214 Vol. 2 Iss. 3 e238 Page 8 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

9 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent (P =.86) and.5 nmol/l insulin (Fig. 3D; P =.19; insulin 9 time interation, P =.998). Aross all time points,.5 nmol/l insulin inreased SLC36A1/PAT1 mrna abundane relative to baseline and.5 nmol/l insulin (effet of insulin, P =.2). Rapamyin inhibits the insulin-indued inrease in SLC7A5/LAT1 mrna abundane We next wanted to determine if inubation of myotubes with a low and high onentration of rapamyin would redue the inreases in AAT mrna abundane demonstrated by.5 nmol/l insulin in C2C12 myotubes at 4 h. Sine the mrna abundane of SLC38A2/SNAT2 and SLC7A5/LAT1 were inreased and SLC36A1/PAT1 was numerially inreased at 4 h, we onsidered this time point to be optimal for stimulation by insulin. Inubation of myotubes with.5 nmol/l insulin inreased SLC7A5/LAT1 mrna abundane relative to baseline (P =.1) and.5 nmol/l insulin (P =.14) whereas this inrease was not seen when inubating myotubes with.5 nmol/l insulin plus low rapamyin (P =.9) and with high rapamyin (Fig. 4B; P.226; insulin 9 rapamyin interation, P =.26). Similarly, SLC7A5/LAT1 mrna abundane with.5 nmol/l insulin was not different than.5 nmol/l insulin plus low or high rapamyin (P.11). Inubation of myotubes with.5 nmol/l insulin inreased SLC38A2/SNAT2 mrna abundane relative to baseline (P =.31) and.5 nmol/l insulin (P =.27) with and without low rapamyin (Fig. 4A; insulin 9 rapamyin interation, P =.15). However, SLC38A2/SNAT2 mrna abundane was unhanged in myotubes when inubated with.5 nmol/l insulin plus high rapamyin relative to baseline (P =.75) and.5 nmol/l insulin (P =.493). SLC7A1/CAT1 mrna abundane was not affeted by the addition of.5 and.5 nmol/l (P.92) insulin with and without low and high rapamyin (P.182; Fig. 4C; insulin 9 rapamyin interation, P =.589). SLC36A1/ PAT1 mrna abundane was inreased by.5 nmol/l insulin relative to baseline (P =.42) and was not different with.5 nmol/l insulin relative to.5 nmol/l insulin (P =.15) whereas.5 nmol/l insulin inubated with low rapamyin tended to inrease SLC36A1/PAT1 mrna abundane relative to baseline (P =.63). No hanges were noted when.5 and.5 nmol/l insulin were inubated with high rapamyin relative to baseline (P.3) and.5 nmol/l insulin alone (P.587; Fig. 4D; insulin 9 rapamyin interation, P =.221). Disussion The oupling of insulin signaling, amino aid sensing and transport, and the initiation of protein translational initiation are of biologial importane for the ontrol of musle mass. Eluidating the mehanisms oupling eah of these events is limited in human in vivo studies and, therefore in vitro experiments are more appealing to unover these mehanisms. However, for several substrates and hormones inluding insulin, there are disrepanies among onentrations observed in humans and those ommonly used in ell ulture studies to determine biologial ation and/or mehanism. From a linial perspetive, these studies may be limited in their appliability to human physiology. Therefore, the intent of this study was to examine the effet of a range of insulin onentrations on mtorc1 signaling in C2C12 myotubes and additionally, to determine whether the mrna abundane of SLC38A2/SNAT2, SLC7A5/LAT1, SLC7A1/ CAT1, and SLC36A1/PAT1 are dependent on mtorc1 signaling. Our data show for the first time that a low dose of insulin effetively stimulates downstream mtorc1 signaling and mrna abundane of SLC38A2/SNAT2, SLC7A5/LAT1, and SLC36A1/PAT1. Furthermore, the addition of a low and high dose of rapamyin prevented an inrease in SLC7A5/LAT1 mrna abundane. These data provide insight into the role of insulin in the regulation of AAT mrna abundane. Examining the dose and duration of insulin on signal transdution in this study showed that insulin (.5 nmol/l) stimulated a prolonged inrease in Akt, mtor, and ribosomal protein S6 phosphorylation whereas S6K1 and 4E- BP1 phosphorylation were transiently inreased. The transient inrease in S6K1 and 4E-BP1 remains unlear; however, it has been reported that inreased yli adenosine monophosphate (AMP) levels lead to phosphorylation of mtor at multiple sites inluding Ser2448 and results in inhibition of downstream phosphorylation of S6K1 and 4E-BP1 (Mothe-Satney et al. 24). Beause AMP is inreased under ATP defiient onditions, it is plausible that prolonged exposure to insulin (without gluose) would inrease AMP levels leading to redued phosphorylation of the downstream targets, S6K1 and 4E-BP1. Colletively, these data demonstrate that insulin (.5 nmol/l) effetively stimulates Akt phosphorylation and mtorc1 signaling ativation in myotubes. To our knowledge, this is the first study to demonstrate mtorc1 ativation with a low level of insulin as previous ell ulture studies have shown hanges (albeit to a larger magnitude) using higher levels of insulin (MDowell et al. 1998; Peyrollier et al. 2; Kashiwagi et al. 29; Liu et al. 21; Luo et al. 213). The inhibitory ations of rapamyin on the mtor signaling pathway are well established (Conejo and Lorenzo 21; Shen et al. 25; Luo et al. 213). In a previous in vivo study onduted in our laboratory, 16 mg of rapamyin was administered to subjets that resulted in (1) plasma ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 9

10 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. rapamyin onentrations of approximately 2.5 nmol/l and (2) inhibition of the amino aid-indued upregulation of mtor signaling and musle protein synthesis (Dikinson and Rasmussen 211). These data show that the level of rapamyin ahieved in human subjets an effetively attenuate mtor signaling. Subsequently, we examined the effet of this dose of rapamyin along with a higher dose of rapamyin on insulin-stimulated Akt and mtor signaling in C2C12 myotubes. Our results show that this (low) dose of rapamyin did not alter Akt, mtor, and 4E-BP1 phosphorylation. However, the lower dose of rapamyin redued the insulin-(.5 nmol/l) stimulated inrease in S6K1 and ribosomal protein S6 phosphorylation. Rommel et al. (21) demonstrated a omplete inhibition of S6K1 phosphorylation in C2C12 myotubes when administered 2 nmol/l rapamyin prior to the addition of insulin-like growth fator I (albeit at a level of 1 ng/ml) for 15 min. Our initial rapamyin experiments were arried out for 3 min due to greater ativation of downstream mtor signaling omponents relative to 6 and 12 min. It is possible that further inubation with rapamyin would lead to hanges in mtor phosphorylation. Notably, the effets of high-dose rapamyin inreased Akt phosphorylation, whih has been suggested as a feedbak mehanism originating from downregulated S6K1 (Wan et al. 27). Furthermore, mtor was partially redued while S6K1 and ribosomal protein S6 were ompletely inhibited by high rapamyin. On the ontrary, phosphorylation of 4E-BP1 was not redued by high rapamyin indiating that a mtorindependent pathway may be responsible for the inrease in 4E-BP1 phosphorylation (Wang and Proud 22; Thoreen et al. 29). Our data are in line with previous reports demonstrating rapamyin attenuation of the insulin-indued inrease in mtor downstream targets (Byfield et al. 25; Shen et al. 25; Luo et al. 213), but also suggest that mtor-independent pathways may be playing a role in the ativation of 4E-BP1 and a potential feedbak loop that leads to elevated phosphorylation of Akt. AATs provide a ruial link between the availability of intraellular amino aids and protein metabolism. Notably, SNAT2 and LAT1 were shown to ooperate in order to inrease intraellular leuine and stimulate mtorc1 kinase ativity (Hyde et al. 25; Evans et al. 28; Drummond et al. 21). Reent researh has demonstrated that AAT are upregulated by amino aids in human musle. For instane, Drummond et al. (21) reported an inrease in the mrna abundane of SLC28A2/SNAT2, SLC7A5/LAT1, and PAT1/SLC36A1 1 h following ingestion of essential amino aids in young adults. In addition to amino aids, insulin has been shown to regulate protein metabolism and therefore it is oneivable that insulin may regulate the mrna abundane of AAT and ultimately inward flux of amino aids. A number of studies have demonstrated the regulatory effets of insulin on AAT mrna abundane. For example, SLC38A2/SNAT2 and SLC7A5/LAT1 mrna abundane have been demonstrated to inrease in L6 myotubes inubated with 1 nmol/l insulin for 3 min (Luo et al. 213), in human trophoblast myotubes inubated with 1 nmol/l insulin for 4 h (Jones et al. 21), and in L6 myotubes inubated with 1 nmol/l insulin for 8 h (Kashiwagi et al. 29). Therefore, our goal was to inubate myotubes with a lower dose of insulin suh as seen in vivo in humans. We determined that after 4 h of insulin exposure, mrna abundane of SLC38A2/ SNAT2 and SLC7A5/LAT1 were elevated by.5 nmol/l insulin. Interestingly, in human skeletal musle myotubes, mrna abundane of SLC38A2/SNAT2 and SLC7A5/ LAT1 was not hanged after 3 min, 3 and 24 h of exposure to 1 nmol/l insulin (Gran and Cameron-Smith 211). Suryawan et al. (213) demonstrated in neonatal pigs that SNAT2, SNAT3, LAT1, LAT2, PAT1, PAT2 protein abundane was unhanged when pigs were administered amino aids or insulin for 2 h. Similarly, we observed no hanges in SLC38A2/SNAT2 and SLC7A5/ LAT1 mrna abundane prior to 4 h and this is likely due to the low dose of insulin (.5 nmol/l) given in our study. In our study, we observed no hanges in SLC7A1/ CAT1 mrna abundane after and up to 4 h of insulin exposure although SLC7A1/CAT1 mrna abundane has been shown to be inreased in ardia myoytes after 24 h exposure to 1 nmol/l insulin (Simmons et al. 1996). CAT1 is an AAT that plays a role in arginine transport in whih mrna abundane of SLC7A1/CAT1 has been shown to be influened by the addition of amino aids (Lopez et al. 27). Our data suggest that the dose of.5 nmol/l insulin was insuffiient to elevate mrna abundane of SLC7A1/CAT1 or the response from SLC7A1/CAT1 mrna is substantially delayed beyond 4 h when exposed to insulin. On the ontrary, SLC36A1/ PAT1 mrna abundane, in our study, was elevated by.5 nmol/l insulin at 3 min and numerially elevated at 24 min. PAT1 has been suggested to be a ruial link in the ativation of mtor through PI3K/Akt signaling (Ogmundsdottir et al. 212) and, therefore, it is possible that insulin ould immediately affet regulation of SLC36A1/PAT1 mrna abundane. Colletively, our data demonstrate that.5 nmol/l insulin stimulates mrna abundane of the SLC38A2/SNAT2, SLC7A5/LAT1, and SLC36A1/PAT1. Our next objetive was to determine if rapamyin treatment ould redue the insulin-stimulated inrease in AAT mrna abundane. Using two different onentrations of rapamyin (low and high), we show that low rapamyin does not prevent an inrease in SLC38A2/SNAT2 mrna 214 Vol. 2 Iss. 3 e238 Page 1 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

11 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent abundane; however, a low dose of rapamyin was able to prevent the inrease in the mrna abundane of SLC7A5/ LAT1 and, to some extent, SLC36A1/PAT1 mrna. High rapamyin redued mrna abundane of SLC7A5/LAT1 and SLC36A1/PAT1 in addition to SLC38A2/SNAT2. Similar results in SNAT2 and LAT1 mrna abundane have been demonstrated with high rapamyin when using higher levels of insulin in vitro (Adams 27; Roos et al. 29; Luo et al. 213). Using RNAi, Rosario et al. (213) showed that knokdown of mtorc1 or mtorc2 partially inhibited transport ativity of SNAT2 and LAT1 in human trophoblasts whereas simultaneous knokdown of mtorc1 and mtorc2 ompletely inhibited transport ativity. With high onentrations and/or prolonged exposure to rapamyin, it is suggested that mtorc2 ativity and abundane beomes limited (Sarbassov et al. 26). Based on our findings, it appears that mtorc1 may play a role in SLC7A5/LAT1 and perhaps SLC36A1/PAT1 transription regulation. With the lak of amino aids in this study, it is oneivable that the general ontrol nonrepressed (GCN2) pathway may be involved in the regulation of AAT mrna abundane; however, a reent report indiated that the regulation of AAT by insulin involves a GCN2-independent pathway (Luo et al. 213). In summary, we speifially demonstrate that a low onentration of insulin effetively ativates Akt and mtorc1 signaling. Insulin-indued mtorc1 signaling is redued by exposure to a high-rapamyin dose and by a smaller dosage used in human studies. Furthermore,.5 nmol/l insulin inreases the mrna abundane of SLC38A2/SNAT2, SLC7A5/LAT1, and SLC36A1/PAT1. The insulin-indued inrease in SLC7A5/LAT1 mrna abundane is prevented with the addition of a low (and high) dose of rapamyin. Colletively, we report here two novel findings that (1) a low insulin onentration (similar to in vivo postprandial levels) inreases mtorc1 signaling and SLC38A2/SNAT2, SLC7A5/SLC7A5/LAT1, and SLC36A1/PAT1 mrna abundane; and (2) the insulin-indued inrease in SLC7A5/ LAT1 mrna abundane is mtorc1 dependent. Aknowledgment We thank Junfung Hao for tehnial assistane. Conflit of Interest None delared. Referenes Adams, C. M. 27. Role of the transription fator ATF4 in the anaboli ations of insulin and the anti-anaboli ations of gluoortioids. J. Biol. Chem. 282: Baird, F. E., K. J. Bett, C. MaLean, A. R. Tee, H. S. Hundal, and P. M. Taylor. 29. Tertiary ative transport of amino aids reonstituted by oexpression of system A and L transporters in Xenopus ooytes. Am. J. Physiol. Endorinol. Metab. 297:E822 E829. Byfield, M. P., J. T. Murray, and J. M. Baker. 25. hvps34 is a nutrient-regulated lipid kinase required for ativation of p7 S6 kinase. J. Biol. Chem. 28: Conejo, R., and M. Lorenzo. 21. Insulin signaling leading to proliferation, survival, and membrane ruffling in C2C12 myoblasts. J. Cell. Physiol. 187: Dikinson, J. M., and B. B. Rasmussen Essential amino aid sensing, signaling, and transport in the regulation of human musle protein metabolism. Curr. Opin. Clin. Nutr. Metab. Care 14: Dikinson, J. M., C. S. Fry, M. J. Drummond, D. M. Gundermann, D. K. Walker, E. L. Glynn, et al Mammalian target of rapamyin omplex 1 ativation is required for the stimulation of human skeletal musle protein synthesis by essential amino aids. J. Nutr. 141: Drummond, M. J., and B. B. Rasmussen. 28. Leuine-enrihed nutrients and the regulation of mammalian target of rapamyin signalling and human skeletal musle protein synthesis. Curr. Opin. Clin. Nutr. Metab. Care 11: Drummond, M. J., E. L. Glynn, C. S. Fry, K. L. Timmerman, E. Volpi, and B. B. Rasmussen. 21. An inrease in essential amino aid availability upregulates amino aid transporter expression in human skeletal musle. Am. J. Physiol. Endorinol. Metab. 298:E111 E118. Evans, K., Z. Nasim, J. Brown, E. Clapp, A. Amin, B. Yang, et al. 28. Inhibition of SNAT2 by metaboli aidosis enhanes proteolysis in skeletal musle. J. Am. So. Nephrol. 19: Fry, C. S., M. J. Drummond, E. L. Glynn, J. M. Dikinson, D. M. Gundermann, K. L. Timmerman, et al Aging impairs ontration-indued human skeletal musle mtorc1 signaling and protein synthesis. Skeletal Musle 1:11. Gran, P., and D. Cameron-Smith The ations of exogenous leuine on mtor signalling and amino aid transporters in human myotubes. BMC Physiol. 11:1. Guertin, D. A., K. V. Guntur, G. W. Bell, C. C. Thoreen, and D. M. Sabatini. 26. Funtional genomis identifies TOR-regulated genes that ontrol growth and division. Curr. Biol. 16: Haegens, A., A. M. Shols, A. L. van Essen, L. J. van Loon, and R. C. Langen Leuine indues myofibrillar protein aretion in ultured skeletal musle through mtor dependent and -independent ontrol of myosin heavy hain mrna levels. Mol. Nutr. Food Res. 56: Huang, Y., B. N. Kang, J. Tian, Y. Liu, H. R. Luo, L. Hester, et al. 27. The ationi amino aid transporters CAT1 and ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 11

12 AAT mrna Expression is mtorc1 Dependent D. K. Walker et al. CAT3 mediate NMDA reeptor ativation-dependent hanges in elaboration of neuronal proesses via the mammalian target of rapamyin mtor pathway. J. Neurosi. 27: Hyde, R., E. Hajduh, D. J. Powell, P. M. Taylor, and H. S. Hundal. 25. Ceramide down-regulates system A amino aid transport and protein synthesis in rat skeletal musle ells. Faseb J. 19: Jones, H. N., T. Jansson, and T. L. Powell. 21. Full-length adiponetin attenuates insulin signaling and inhibits insulin-stimulated amino aid transport in human primary trophoblast ells. Diabetes 59: Kashiwagi, H., K. Yamazaki, Y. Takekuma, V. Ganapathy, and M. Sugawara. 29. Regulatory mehanisms of SNAT2, an amino aid transporter, in L6 rat skeletal musle ells by insulin, osmoti shok and amino aid deprivation. Amino Aids 36: Liu, M., S. A. Wilk, A. Wang, L. Zhou, R. H. Wang, W. Ogawa, et al. 21. Resveratrol inhibits mtor signaling by promoting the interation between mtor and DEPTOR. J. Biol. Chem. 285: Lopez, A. B., C. Wang, C. C. Huang, I. Yaman, Y. Li, K. Chakravarty, et al. 27. A feedbak transriptional mehanism ontrols the level of the arginine/lysine transporter at-1 during amino aid starvation. Biohem. J. 42: Luo, J. Q., D. W. Chen, and B. Yu Upregulation of amino aid transporter expression indued by L-leuine availability in L6 myotubes is assoiated with ATF4 signaling through mtorc1-dependent mehanism. Nutrition 29: MaKenzie, M. G., D. L. Hamilton, J. T. Murray, P. M. Taylor, and K. Baar. 29. mvps34 is ativated following high-resistane ontrations. J. Physiol. 587: MDowell, H. E., P. A. Eyers, and H. S. Hundal Regulation of system A amino aid transport in L6 rat skeletal musle ells by insulin, hemial and hyperthermi stress. FEBS Lett. 441: Mothe-Satney, I., N. Gautier, C. Hinault, J. C. Lawrene, Jr., and E. Van Obberghen. 24. In rat hepatoytes gluagon inreases mammalian target of rapamyin phosphorylation on serine 2448 but antagonizes the phosphorylation of its downstream targets indued by insulin and amino aids. J. Biol. Chem. 279: Ogmundsdottir, M. H., S. Heublein, S. Kazi, B. Reynolds, S. M. Visvalingam, M. K. Shaw, et al Proton-assisted amino aid transporter PAT1 omplexes with Rag GTPases and ativates TORC1 on late endosomal and lysosomal membranes. PLoS One 7:e Peyrollier, K., E. Hajduh, A. S. Blair, R. Hyde, and H. S. Hundal. 2. L-leuine availability regulates phosphatidylinositol 3-kinase, p7 S6 kinase and glyogen synthase kinase-3 ativity in L6 musle ells: evidene for the involvement of the mammalian target of rapamyin (mtor) pathway in the L-leuine-indued up-regulation of system A amino aid transport. Biohem. J. 35(Pt 2): Proud, C. G. 22. Regulation of mammalian translation fators by nutrients. Eur. J. Biohem. 269: Rommel, C., S. C. Bodine, B. A. Clarke, R. Rossman, L. Nunez, T. N. Stitt, et al. 21. Mediation of IGF-1-indued skeletal myotube hypertrophy by PI(3)K/Akt/ mtor and PI(3)K/Akt/GSK3 pathways. Nat. Cell Biol. 3: Roos, S., N. Jansson, I. Palmberg, K. Saljo, T. L. Powell, and T. Jansson. 27. Mammalian target of rapamyin in the human plaenta regulates leuine transport and is down-regulated in restrited fetal growth. J. Physiol. 582: Roos, S., Y. Kanai, P. D. Prasad, T. L. Powell, and T. Jansson. 29. Regulation of plaental amino aid transporter ativity by mammalian target of rapamyin. Am. J. Physiol. Cell Physiol. 296:C142 C15. Rosario, F. J., Y. Kanai, T. L. Powell, and T. Jansson Mammalian target of rapamyin signalling modulates amino aid uptake by regulating transporter ell surfae abundane in primary human trophoblast ells. J. Physiol. 591: Saltiel, A. R., and C. R. Kahn. 21. Insulin signalling and the regulation of gluose and lipid metabolism. Nature 414: Sarbassov, D. D., S. M. Ali, S. Sengupta, J. H. Sheen, P. P. Hsu, A. F. Bagley, et al. 26. Prolonged rapamyin treatment inhibits mtorc2 assembly and Akt/PKB. Mol. Cell 22: Shen, W. H., D. W. Boyle, P. Wisniowski, A. Bade, and E. A. Liehty. 25. Insulin and IGF-I stimulate the formation of the eukaryoti initiation fator 4F omplex and protein synthesis in C2C12 myotubes independent of availability of external amino aids. J. Endorinol. 185: Simmons, W. W., E. I. Closs, J. M. Cunningham, T. W. Smith, and R. A. Kelly Cytokines and insulin indue ationi amino aid transporter (CAT) expression in ardia myoytes. Regulation of L-arginine transport and no prodution by CAT-1, CAT-2A, and CAT-2B. J. Biol. Chem. 271: Suryawan, A., H. V. Nguyen, R. D. Almonai, and T. A. Davis Abundane of amino aid transporters involved in mtorc1 ativation in skeletal musle of neonatal pigs is developmentally regulated. Amino Aids 45: Thoreen, C. C., S. A. Kang, J. W. Chang, Q. Liu, J. Zhang, Y. Gao, et al. 29. An ATP-ompetitive mammalian target of rapamyin inhibitor reveals rapamyin-resistant funtions of mtorc1. J. Biol. Chem. 284: Timmerman, K. L., J. L. Lee, H. C. Dreyer, S. Dhanani, E. L. Glynn, C. S. Fry, et al. 21. Insulin stimulates human skeletal musle protein synthesis via an indiret mehanism 214 Vol. 2 Iss. 3 e238 Page 12 ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of

13 D. K. Walker et al. AAT mrna Expression is mtorc1 Dependent involving endothelial-dependent vasodilation and mammalian target of rapamyin omplex 1 signaling. J. Clin. Endorinol. Metab. 95: Walker, D. K., J. M. Dikinson, K. L. Timmerman, M. J. Drummond, P. T. Reidy, C. S. Fry, et al Exerise, amino aids, and aging in the ontrol of human musle protein synthesis. Med. Si. Sports Exer. 43: Wan, X., B. Harkavy, N. Shen, P. Grohar, and L. J. Helman. 27. Rapamyin indues feedbak ativation of Akt signaling through an IGF-1R-dependent mehanism. Onogene 26: Wang, L., and C. G. Proud. 22. Ras/Erk signaling is essential for ativation of protein synthesis by Gq protein-oupled reeptor agonists in adult ardiomyoytes. Cir. Res. 91: Wen, Z. H., Y. C. Su, P. L. Lai, Y. Zhang, Y. F. Xu, A. Zhao, et al Critial role of arahidoni aid-ativated mtor signaling in breast arinogenesis and angiogenesis. Onogene 32: ª 214 The Authors. Physiologial Reports published by Wiley Periodials, In. on behalf of 214 Vol. 2 Iss. 3 e238 Page 13