Robert A. Kaufmann, M.D. Robert Nathan Slotnick, M.D., Ph.D. Gary D. Hodgen, Ph.D.

Transcription

1 FERTILITY AND STERILITY Copyright 1995 American Society for Reproductive Medicine Vol. 63, No.4, April 1995 Printed on acid-free paper in U. s. A. Preimplantation genetic diagnosis for lay-sachs disease: successful pregnancy after pre-embryo biopsy and gene amplification by polymerase chain reaction William Edward Gibbons, M,D.* Susan A. Gitlin, M,S. Susan E. Lanzendorf, Ph.D. Robert A. Kaufmann, M.D. Robert Nathan Slotnick, M.D., Ph.D. Gary D. Hodgen, Ph.D. Department of Obstetrics and Gynecology, The Jones Institute of Reproductive Medicine, Eastern Virginia Medical School, Norfolk, Virginia Objective: To determine the ability to apply pre implantation genetic diagnostic techniques to screen for and prevent Tay-Sachs disease (TSD). Design: A couple, both carriers for the 4 base pair (bp) insertion in exon 11 of the {3-hexosaminidase A gene, which results in TSD, underwent IVF, pre-embryo biopsy, polymerase chain reaction (per) DNA amplification of the biopsied blastomeres, and pre-embryo transfer. One to two blastomeres were aspirated using a biopsy pipette that was inserted through an opening in the zona formed with acidified phosphate buffer. Polymerase chain reaction was performed on the individual blastomeres for 20 cycles followed by an additional 30 cycles using nested primers. This yielded amplified DNA products of 272 and 276 bp for the normal and mutant gene, respectively. Heteroduplex formation was used for identification of normal, homozygous affected, and heterozygous preembryos. Results: Seven of 13 oocytes fertilized normally and were biopsied at the four- to eight-cell stages. Deoxyribonucleic acid amplification occurred in four of seven pre-embryos (one homozygous affected and three homozygous normal pre-embryos). The three normal pre-embryos that continued to cleave after biopsy were transferred on the evening of day 3 after retrieval. Subsequently, a single gestational sac was observed and the genetic diagnosis was confirmed at amniocentesis. Conclusion: A successful pregnancy and birth were accomplished after preimplantation genetic diagnostic screening for the prevention of TSD. Fertil Steril 1995;63:723-8 Key Words: Preimplantation genetic diagnosis, pre-embryo biopsy, polymerase chain reaction, IVF The ability to screen the DNA content of preembryos for lethal genetic diseases before implantation is now a reality (1). It has resulted from the evolution of the assisted reproductive techniques, as well as the development of sensitive genetic tools to probe the nucleus for a single gene. However, Received September 7, 1994; revised and accepted November 25,1994. * Reprint requests: William E. Gibbons, M.D., The Jones Institute of Reproductive Medicine, Department of Obstetrics and Gynecology, Eastern Virginia Medical School, Norfolk, Virginia (FAX: ). preimplantation genetic diagnosis does, at present, stress the limits of genetic testing techniques because of the time restraints of the implantation window as well as having very few cells from which to obtain a diagnosis. Thus, the practical sensitivity of the techniques must equal their theoretical sensitivity' i.e., the ability to accurately evaluate a single copy of a gene within a single cell. It was not until 1990 that the first successful pregnancies occurred in which pre-embryos at risk for an X-linked disease were evaluated for their genetic sex and the females implanted (1). This was followed by the birth of a child screened for cystic fibrosis (2). Vol. 63, No.4, April 1995 Gibbons et al. Preimplantation genetic diagnosis for Tay-Sachs 723

2 We report here the first successful attempt to screen the pre-embryos of a couple who are carriers for Tay-Sachs disease (TSD) by preimplantation genetic diagnosis. Tay-Sachs disease was chosen by our clinical investigative team because its genetic basis was known and, therefore, appropriate genetic probes were available and could be tested. Furthermore, the outcome for affected TSD children is uniformly devastating with progressive motor and mental deterioration occurring before death at the age of 3 to 5 years. Clinical Protocol MATERIALS AND METHODS Under the guidelines of a protocol approved by the Eastern Virginia Medical School Institutional Review Board, a couple, both carriers of a recessive gene for TSD who previously had had an affected child expire, was brought to The Jones Institute for a 2-day orientation. They met with a geneticist, genetic counselor, embryologist, the IVF group, and the genetic diagnostic team. This orientation was tailored to provide the couple with a complete description of the pre implantation genetic diagnosis process from which the clinical team would judge the adequacy of the informed consent. Blood was obtained to confirm the nature of the type of TSD mutation, a 4 base pair (bp) insertion in exon 11 of the /3-hexosaminidase A gene. Using a protocol described previously (3), a GnRH agonist was initiated in the preceding cycle followed by the administration of 150 to 225 IU Metrodin on menstrual cycle day 3. When two or more follicles had reached> 15 mm in size, a dose of 5,000 U hcg was administered. Ovum retrieval was accomplished 36 hours later. Embryo transfer was performed on the evening of the 3rd day after oocyte aspiration by transvaginal uterine cannulation. Supplemental P (50 mg 1M daily) was administered for luteal support. Pre-Embryo Biopsy Biopsies were performed on a Nikon Diaphot inverted microscope (Nikon, Inc., Melville, NY) equipped with Hoffman optics (Modulation Optics, Inc., Greenvale, NY) and Narishige manipulators (Narishige USA, Inc., Greenvale, NY). Three sets of Narishige MN-2 manipulators and MO-202 micromanipulators were used to provide control of three pipettes simultaneously. Immobilization of the pre-embryo with the holding pipette was achieved with a Narishige IM-6 microinjector. Delivery of acidified medium and aspiration of blastomeres was controlled by a Narishige IM-200 Pneumatic Microinjector. Micropipettes were prepared with borosilicate glass (Sutter Instrument Company, Novato, CA; OD, 1.0 mm; ID, 0.75 mm) using a Sutter P-87 pipette puller (Sutter Instrument Company) and a Nikon MF-9 Microforge (Nikon, Inc.). Holding pipettes were fire polished to have an inner diameter between 35 and 40 ~m. Pipettes for delivery of the acidified medium (acid pipette) and blastomere aspiration (biopsy pipette) were prepared to have inner diameters of 10 and 35 to 40 ~m, respectively. Biopsies were performed in prepared micromanipulation dishes containing drops of Dulbecco's phosphate-buffered saline (PBS; Life Technologies, Inc., Grand Island, NY) supplemented with 10% human serum albumin (Irvine Scientific, Santa Ana, CA) and covered with washed equilibrated mineral oil. The acidified medium was prepared by supplementing the Dulbecco's PBS with polyvinylpyrrolidone (0.4 g/100 ml; ICN Biochemicals, Inc., Cleveland, OH; MW 360,000) and decreasing the ph to 2.5. Biopsies were performed by immobilizing each pre-embryo while an opening was created in the zona pellucida with the release of acidified medium through the acid pipette. The biopsy pipette then was introduced through the opening and one to two blastomeres were aspirated slowly. After blastomere removal, each pre-embryo was washed three times and then returned to culture. The excised blastomeres were individually washed three times in Dulbecco's PBS to remove any contaminating sperm. Separate individual blastomeres then were added to a 0.5-mL GeneAmp reaction tube (Perkin Elmer, Norwalk, CT) containing 60 ~L of water while visualized under a dissecting microscope to assure that the cells were transferred successfully. Two microliters of the last medium rinse drop of each blastomere was added to another tube to serve as a contamination control. All samples were frozen-thawed twice in liquid nitrogen and then were boiled for 10 minutes at 100 C to lyse the blastomeres. All samples were stored at ~20 C until use. Polymerase Chain Reaction (PCR) Reagents A PCR master mix was used consisting of PCR Buffer (1.5 mm MgCI 2, 10 mm Tris HCI at ph 8.3, 724 Gibbons et al. Preimplantation genetic diagnosis for Tay-Sachs Fertility and Sterility

3 Table 1 The Oligonucleotide Sequences for the Outer and Internal (Nested) PCR Primer Pairs Oligonucleotide sequences Size of amplification products (bp) Normal gene Abnormal gene Outer primers 5'-3' CAACAACAGTCTGGTGATGG GCCAGACACAATCATACAGG Nested primers 5'-3' AAGGAGCTGGAACTGGTCC CTCTCAACCACCTTCCCAAT mm KCI, 0.01 % wt/vol gelatin), 200 ~M dntp (USB, Cleveland, OH), 0.2 ~M primers (Genosys, The Woodlands, TX), and 0.5 U Taq polymerase (Perkin-Elmer). The reagent concentrations and conditions were performed as described and optimized previously by Morsy et al. (4), except that a "nested" primer (second amplification step using a second set of primers that are internal to the first primer set) procedure was used. The primers were designed using PRIMER DESIGNER software (S&E Software, Stateline, PA) using selection criteria as outlined by Saiki (5). The primers sets are shown in Table 1. The initial 100 ~L reaction volume containing DNA and the master mix was placed into a DNA thermal cycler (Perkin Elmer Cetus, Norwalk, CT). After an initial denaturation of 94 C for 3 minutes, 20 cycles were carried out using 94 denaturation, 61 annealing, and 72 extension steps of 1 minute each. Two microliters of this amplified product were removed and added to a reaction mix of nested primers. The above thermal cycler protocol was followed for 30 cycles, except for a reduction in the annealing temperature to 54. The sizes of the amplified products are shown in Table 1. In addition to the tubes containing DNA from the samples being tested, reaction tubes containing the master mix reagents plus water and oil without added DNA were prepared and run simultaneously with the samples through the PCR process as negative controls against possible contamination from extraneous DNA. Because these controls contain no added DNA, no amplification signal should be seen. Amplification in these tubes indicates a contaminating DNA source of unknown origin. Evidence of contamination would invalidate an experimental set. In addition to these controls, aliquots of the third rinse of each blastomere were also placed in reaction tubes and PCR was performed along with the samples as another contamination control. Heteroduplex Formation The size difference (4 bp) between the amplified DNA product of the normal or abnormal gene is too small to differentiate on a short-duration polyacrylamide gel. To allow for specific identification of the amplification products, mixing experiments were performed to produce a PCR artifact-heteroduplex formation. In the heterozygous condition, one allele has the deletion-insertion whereas the other allele does not. During the simultaneous amplification of thousands of copies ofthese two alleles, the similarity of their complementary single strands allows them to anneal except for the segment where there are extra (insertion) or missing (deletion) base pairs, which theoretically forms a "loop." During electrophoresis, the loop causes the complex to run slower on the gel than the "homozygous" complexes, resulting in a characteristic band pattern, i.e., heteroduplex formation (Fig. 1). To detect a difference in the normal versus the affected conditions, the unknown DNA sample is "mixed" with previously amplified product obtained from a known homozygous normal cell and separately with a homozygous affected DNA source obtained from the Human Mutant cell repository (repository number GM normal cells, GM TSD heterozygous cells, GM TSD homozygous affected-abnormal cells; The Coriell Institute, Camden, NJ). Ten microliters of amplified product from both the known and unknown DNA samples are placed in a reaction tube with 10 ~L of the PCR product from the blastomere. The mixture is denatured at 95 C for 5 minutes, and then the temperature is lowered (65 C for 5 minutes) to allow for reannealing of the products and is stored at 4 C until use. The amplified product of the sample cell with an unknown DNA status is run on three lanes of the gels, alone, and one each with the known homozygous normal and homozygous affected-mutant DNA products. The pattern of heteroduplex formation will allow a diagnosis of the unknown sample. If the unknown sample run by itself forms the heteroduplex banding pattern, then the unknown DNA sample contains both a normal and abnormal allele and, therefore, the IoIcell" is a heterozygote-carrier. If the unknown lane alone forms a single band, then the unknown is either Vol. 63, No.4, April 1995 Gibbons et al. Pre implantation genetic diagnosis for Tay-Sachs 725

4 Ox: EMBRYO! +N +A Normal EMBRYO 3! +N +A Affected -heterl[)duplex bp Figure 1 Ten percent polyacrylamide gel ofpcr DNA amplification products from two human blastomeres obtained from embryos 1 and 3. The primer sequences were for the specific locus surrounding the 4 bp insertion mutation on exon 11 of ;3-hexosaminidase A-TSD. -, negative master mix (contamination) control, amplification of buffer without added DNA; N, normal, homozygous genomic DNA; R, amplification of final blastomere rinse droplet (contamination control); H, heterozygous genomic DNA for TSD; t, lane containing blastomere DNA only; + N, lane containing DNA plus known normal homozygous DNA; +A, lane containing blastomere DNA plus known homozygous affected DNA; pgem, lane containing reference size markers. The heteroduplex band pattern (doublet) observed in embryo 1 only when TSD DNA was added indicates that the embryo DNA content is homozygous normal. The pattern seen with the addition of normal DNA in embryo 3 indicates that the embryo is homozygous affected for TSD. homozygous normal or homozygous affected-abnormal. If the sample mixed with the known homozygous normal DNA forms a heteroduplex pattern, this would mean that the unknown DNA is homozygous affected. If the heteroduplex formation occurs with mixing of the unknown with the known abnormal DNA, then the "diagnosis" for the unknown is that it is homozygous normal. Gel Electrophoresis Twenty microliters of amplified product was mixed with bromophenol blue dye and loaded onto a 10% polyacrylamide gel. Gel electrophoresis was run at 175 V (Fisher Biotech power supply; Fisher Scientific, Pittsburgh, PA) for 90 minutes. The gel was stained with 0.5 mg/ml ethidium bromide for 15 minutes, destained with water for 5 minutes, and then photographed under ultraviolet transillumination. The time required for the process from initiation of the per amplification procedure to fluorescence of the gel and diagnosis is approximately 8 hours. RESULTS Thirteen oocytes were obtained at egg retrieval. Seven oocytes fertilized normally. To maximize the amount of time available to perform per, blastomere biopsy was performed, when possible, on the evening of day 2. At 7:00 P.M. on day 2, pre-embryos were evaluated on the inverted microscope. At this time, four pre-embryos (three six cell and one eight cell) were biopsied. The remaining three pre-embryos were four-cells or less and were returned to culture. At 9:00 A.M. on day 3, the remaining three pre-embryos were biopsied at the four-, six-, and eight-cell stages. Whenever possible, an effort was made to remove two blastomeres from each pre-embryo. However, it can be difficult technically to remove more than one blastomere without jeopardizing the entire pre-embryo. In some cases, the blastomeres were adhered strongly to one another making it difficult to remove additional blastomeres. Only one blastomere was removed from the four-cell pre-embryo. The results of the DNA amplification are shown in Table 2. Amplification was obtained in four of seven pre-embryos. Three pre-embryos were determined by heteroduplex formation (Fig. 1) to be homozygous-normal and were transferred into the uterine cavity on the evening of day 3 after oocyte aspiration. All three pre-embryos demonstrated continued cleavage after biopsy by the time of transfer. The fourth pre-embryo was homozygousaffected and was not transferred. The pre-embryos in which amplification did not occur were cryopreserved for future evaluation. None of the contamination controls demonstrated DNA amplification. The blastomeres of the homozygous-affected preembryo were separated and per was performed; the diagnosis was confirmed. Table 2 The Results of the PCR Amplification in the Seven Biopsied Pre-embryos Embryo code Amplification Genetic Clinical number status finding decision 1 Yes Normal Transferred 2 No amplification Cryopreserved 3 Yes Homozygous Evaluated for affected confirmation of the diagnosis 4* No amplification Cryopreserved No amplification 5* Yes Normal Transferred No amplification 6 Yes Normal Transferred 7* No amplification Cryopreserved No amplification * Designates more than one blastomere biopsied and tested. 726 Gibbons et al. Preimplantation genetic diagnosis for Tay-Sachs Fertility and Sterility

5 Two weeks after embryo transfer, serially rising titers of hcg were ascertained. At 7 weeks gestation, a single sac with cardiac activity was observed by ultrasound evaluation. At 13 weeks gestation, an amniocentesis was performed and the initial genetic diagnosis was confirmed in our laboratory and that of Dr. Mark Hughes at the Baylor College of Medicine. Additionally, routine karyotypic analysis demonstrated a 46XX karyotype. A healthy female infant was delivered on January 26,1994. DISCUSSION Preimplantation genetic diagnosis is a labor-intensive process using the resources of an IVF program (nursing, physicians, monitoring personnel, embryologists, and others) in addition to those of a genetic testing facility. The effort required to produce a clinical pre implantation genetic diagnosis program is substantial. Our genetic research teams began this project in 1988 (4, 6-8). This effort is in contrast to the alternative to preimplantation genetic diagnosis, which is for a couple to conceive, undergo a genetic amniocentesis or chorionic villus sampling procedure, and then abort an affected fetus. This suggests that the candidates for preimplantation genetic diagnosis would be those for whom therapeutic abortion would be an extremely difficult or unacceptable option, such that they would agree to undergo the emotional and physical rigors of the preimplantation genetic diagnosis process. At the time of this writing, the preimplantation genetic diagnosis study candidates at The Jones Institute incur no medically related financial expense. Howev~r, it is expected that preimplantation genetic diagnosis will add approximately $2,500 to the cost of an IVF treatment in our center. The high psychological cost of termination for these couples emphasizes the need for an extensive patient education-informed consent process. It is imperative that the couple understand the limitations of this complex process and its risks, which include mistaken genetic diagnoses, which can and have occurred in other centers, and that there may be no pre-embryos available for transfer because of inadequate oocyte recruitment, lack of fertilization, or failure of genetic techniques to amplify the desired gene. In addition, many of these couples have not experienced infertility, and so are not prepared emotionally for the constant blood and ultrasound monitoring, injections, as well as the unexpected low human fecundability-ivf success rates, as are the "standard" infertile IVF patients. Errors in diagnosis have been reported (9). Errors can result from research paradigms without sufficient controls or as a result of contaminating cells, i.e., sperm or granulosa cells, desquamated skin cells, or other cellular material introduced at embryo biopsy, transport, or the PCR preparation process. Polymerase chain reaction techniques will amplify any DNA present, not just the desired biopsied blastomere. In the case of a couple carrying an autosomal recessive disease such as TSD, there are one normal and one abnormal gene copies in every cell of their body except for their gametes. Thus, in a worst-case scenario, a homozygous-affected pre-embryo containing two abnormal copies of the gene could be misdiagnosed as a carrier if contaminating sperm or granulosa cells with a normal gene copy were present in the PCR reaction tube. This could result in the unfortunate transfer of an affected pre-embryo (couples are given the choice of whether or not to transfer heterozygous pre-embryos; most choose to transfer them). There are several contamination controls built into the process, which include testing the last blastomere rinse droplet, as well as processing the PCR master reagent mix by itself for the presence of DNA amplification. These steps do not always guarantee lack of contamination. No evidence of contamination was observed in any of the controls in the case presented here. Amplification failure resulted in the inability to produce a definitive diagnosis in three of seven biopsied pre-embryos. Thus, they could not be transferred until some later time when they could be re-evaluated. Failure of amplification can occur for various reasons, some of which include failure to transfer the microscopic blastomere into the reaction tube, failure of the biopsied blastomere to have a nucleus, and insufficient sensitivity of the test system (or as a result of secondary gene structure that interferes with primer, annealing, or extension) (5, 1O). Because a successful IVF outcome can be dependent upon the number of pre-embryos transferred, amplification failure can have a significant effect on the overall outcome of the preimplantation genetic diagnosis process (11). It has been our policy to attempt to obtain two blastomeres from each pre-embryo when technically possible so that there is more than one opportunity to obtain the genotype of each pre-embryo. When new technologies evolve, their financial costs are frequently questioned, and it is prudent to Vol. 63, No.4, April 1995 Gibbons et al. Pre implantation genetic diagnosis for Tay-Sachs 727

6 do so. Couples who find that abortion is not acceptable may, in many cases, choose not to have children. For conditions such as cystic fibrosis that are not rapidly progressively fatal, the cost of preimplantation genetic diagnosis may be much less than that of chronic care. Ultimately, the precise fit of preimplantation genetic diagnosis into the changing medical economic environment is unknown. However, in terms of preventive intervention, the potential of pre implantation genetic diagnosis in disease avoidance is significant. Each month investigators report new progress in mapping the human genome. We have expanded our preimplantation genetic diagnosis program to include known mutations for cystic fibrosis, sicklecell disease, and the X-linked recessive conditions. Because the pre implantation genetic diagnosis program is aimed at disease prevention, our current policy is not to use this technology for sex selection only to achieve "family balancing." Soon we plan to use fluorescence in situ hybridization probes for aneuploid conditions similarly to that published by Munne and co-workers (12). Fluorescence in situ hybridization technology will expand the number of potential candidates from the relatively rare singlegene defects to a much broader population needing screening for chromosomal aneuploidy. This could include infertile couples in whom the wife's age is >35 years who are undergoing IVF therapy and who, because of their ages, are at increased risk of trisomy 21 or other aneuploidies. In conclusion, a couple at risk for having a child born with TSD underwent preimplantation genetic diagnosis with the successful result of the birth of a normal healthy infant. The preimplantation genetic diagnosis process is relatively complex and has defined (and undefined) risks that require an extensive informed consent process. The benefits, however, are well defined and significant for the small but expanding list of candidates at risk for delivering children with genetic disease and for whom abortion is not an acceptable option. Acknowledgments. The authors acknowledge Suheil J. Muasher, M.D., the IVF Team of The Jones Institute for Reproductive Medicine, Norfolk, Virginia, and Dr. Mark Hughes at the Baylor College of Medicine, Houston, Texas. Further, we thank Ms. Pauline M. Clynes for her editorial assistance and Ms. Vivienne Popko for her assistance in the preparation of this manuscript. REFERENCES 1. Handyside AH, Kontogianni EH, Hardy K, Winston RM. Pregnancies from biopsied human preimplantation embryos sexed by Y -specific DNA amplification. Nature 1990;344: Handyside AH, Lesko JG, Tarin JJ, Winston RML, Hughes MR. Birth of a normal girl after in vitro fertilization and preimplantation diagnostic testing for cystic fibrosis. N Engl J Med 1992;327: Toth TL, Oehninger S, Toner SJ, Brzyski RG, Acosta AA, Muasher SJ. Embryo transfer to the uterus or the fallopian tube after in vitro fertilization yields similar results. Fertil Steril 1992;57: Morsy M, Takeuchi K, Kaufmann R, Veeck L, Hodgen G, Beebe S. Preclinical models for human embryo biopsy and genetic diagnosis. II. Polymerase chain reaction amplification of deoxyribonucleic acid from single lymphoblasts and blastomeres with mutation detection. Fertil Steril 1992; 57: Saiki RF. The design and optimization of the PCR. In: Erlich HA, editor. PCR technology: principals and applications for DNA amplification. New York: Stockton Press, 1989: Beebe SJ, Morsy M, Takeuchi K, Veeck L, Muasher SJ, Hodgen GD. Preembryo genetic diagnosis. Clin Consul Obstet Gynecol 1990;2: Kaufmann RA, Morsy M, Takeuchi K, Hodgen GD. Preimplantation genetic analysis. J Reprod Med 1992;37: Takeuchi K, Sandow B, Morsey M, Kaufmann RA, Beebe S, Hodgen GD. Preclinical models for human preembryo biopsy and genetic diagnosis. I: Efficiency and normalcy of mouse pre-embryo development after different biopsy techniques. Fertil Steril 1992;57: Handyside AH, Delhanty JDA. Cleavage stage biopsy ofhuman embryos and diagnosis of X-linked recessive disease. In: Edwards RG, editor. Preconception and preimplantation diagnosis of human genetic disease. Cambridge: Cambridge University Press, 1993: Navidi W, Arnheim N. Using PCR in preimplantation genetic disease diagnosis. Hum Reprod 1991;6: Garcia J, Acosta AA, Andrews MC, Jones GS, Jones HW Jr, Veeck L, Wright G. In vitro fertilization in Norfolk, Virginia, J In Vitro Fert Embryo Transf 1984;1: Munne S, Lee A, Rosenwaks Z, Grifo J, Cohen F. Diagnosis of major chromosomal aneuploidies in human preimplantation embryos. Hum Reprod 1993;8: Gibbons et al. Pre implantation genetic diagnosis for Tay-Sachs Fertility and Sterility