EFFECTS OF HORMONES ON EXPRESSION OF ANGIOGENIN IN GRANULOSA CELLS IN BOVINE OVARIAN FOLLICLES JENNIFER LYNN DENTIS

Transcription

1 EFFECTS OF HORMONES ON EXPRESSION OF ANGIOGENIN IN GRANULOSA CELLS IN BOVINE OVARIAN FOLLICLES By JENNIFER LYNN DENTIS Bachelor of Science in Agricultural Sciences and Natural Resources Oklahoma State University Stillwater, Ok 2008 Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE May, 2010

2 EFFECTS OF HORMONES ON EXPRESSION OF ANGIOGENIN IN GRANULOSA CELLS IN BOVINE OVARIAN FOLLICLES Thesis Approved: Dr. L. J. Spicer Thesis Adviser Dr. R. P. Wettemann Dr. U. Desilva Dr. A. Gordon Emslie Dean of the Graduate College ii

3 ACKNOWLEDGMENTS I would like to acknowledge Dr. Spicer, my advisor and mentor for accepting me as a Gates Millennium Scholar and a student with outside funding into the graduate research program. Dr. Leon Spicer has provided guidance, assistance, and encouragement throughout my journey as a graduate student. Dr. Spicer understood that I needed to continue my part time job while pursuing my degree and worked with me to meet all the deadlines and requirements for this program. I would also like to thank Dr. Robert Wettemann and Dr. Udaya Desilva for providing me with a greater understanding into science and their suggestions about my research and the graduate program. I would also like to acknowledge Bill and Melinda Gates from the Gates Millennium Scholarship program. Without their financial assistance my graduate degree would have not been possible. I would also like to thank Nicole Fry and Amanda Burress for their assistance in the laboratory and their guidance and understanding during my journey. I would also like to thank my fellow graduate students, my mother and family and to all my friends I have made during my graduate career. iii

4 DEDICATIONS I would like to dedicate this manuscript to my mother, Debbie, for always being there for me in my time of need and for always being there to talk or just to listen about my day. I owe so many things in this life to you and would not be the woman I am today without you. You do not know how much you truly mean to me. I love you. iv

5 TABLE OF CONTENTS Chapter Page I. INTRODUCTION...1 II. REVIEW OF LITERATURE Development of follicles and ovarian folliculogenesis 4 2. Cystic ovarian disease/cystic ovarian follicles and pathogenesis Angiogenesis in the ovary Angiogenin a homolog of bovine pancreatic ribonuclease A References...14 III. EFFECTS OF HORMONES ON EXPRESSION OF ANGIOGENIN IN GRANULOSA CELLS IN BOVINE OVARIAN FOLLICLES Abstract Introduction Materials and Methods...25 Reagents and Hormones...25 Cell Culture...26 RNA Extraction...27 Primer and Probe Design...28 Experimental Design...29 Statistical Analysis Results...31 Experiment 1: Effect of FSH, E2, FGF9 and IHH on small-follicle and large-follicle granulosa cell angiogenin mrna...31 Experiment 2: Effect of P4 and E2 on large-follicle granulosa cell angiogenin mrna...31 Experiment 3: Effect of IGF1 and TNFα on large-follicle granulosa cell angiogenin mrna...31 v

6 Chapter Page 5. Discussion References...49 IV. CONCLUSION...53 vi

7 LIST OF TABLES Table Page 1. Quantitative real-time RT-PCR analysis of angiogenin mrna expression in small-follicle and large-follicle granulosa cells treated with IGF1, FSH, E2, FGF9 and IHH (Experiment 1) Quantitative real-time RT-PCR analysis of angiogenin mrna expression in large follicle granulosa cells treated with IGF1, P4, and E2 (Experiment 2) Quantitative real-time RT-PCR analysis of angiogenin mrna expression in small- and large-follicle granulosa cells treated with IGF1 and TNFα (Experiment 3)...48 vii

8 LIST OF FIGURES Figure Page 1. Effect of FSH, E2, FGF9, and IHH on small-follicle granulosa cell Angiogenin mrna in experiment Effect of IGF1, FSH, E2, FGF9, and IHH on large-follicle granulosa cell angiogenin mrna in experiment Effect of P4, and E2 on large-follicle granulosa cell angiogenin mrna in experiment in Effect of IGF1 and TNFα on small-follicle granulosa cell angiogenin mrna in experiment Effect of IGF1 and TNFα on large-follicle granulosa cell angiogenin mrna in experiment viii

9 CHAPTER I Introduction In beef and dairy cattle operations, percentage of cattle that become pregnant during the breeding season has a direct impact on profitability. Cystic follicles are one of the most common reproductive failures and are a major cause of poor pregnancy rates (Peter, 2004). Thus, cystic follicles can cause a detrimental economical loss in the dairy industry due to an increase in calving to conception and calving intervals (Peter, 2004). In sexually mature nonpregnant cattle, an estrous cycle occurs every 21 days during which follicles develop in a wavelike pattern and are controlled by the release of certain hormones such as luteinizing hormone (LH) and follicle stimulating hormone (FSH) (Adams, 1999; Mihm et al., 2006). During this wavelike pattern a dominant follicle can fail to ovulate and continue to grow and become cystic. In the dairy industry, follicular cysts are reported in 5 to 18% of the cattle (Garverick, 1997). However, this incidence may be underestimated because cattle that develop ovarian cysts before first postpartum ovulation could recover before being detected and therefore these cattle are not reported. A process that is thought to play a role in cystic ovarian disease in cattle is angiogenesis (Grado-Ahuir, 2008). Angiogenesis occurs in the adult ovary during normal 1

10 estrous cycle (Redmer and Reynolds,, 1996; Macchiarelli et al., 2006 ). Angiogenesis is the formation of new blood vessels from preexisting blood vessels and is thought to be controlled by angiogenic and anti-angiogenic factors (Redmer and Reynolds, 1996; Lee et al., 1999). Angiogenesis starts with endothelial cell proliferation and finishes with the formation of a new microcirculatory bed of capillaries, venules and arterioles. The new blood vessels formed from angiogenesis help aid in the transportation of nutrients, oxygen and specific hormones to particular cells. One important angiogenic factor that plays a role in angiogenesis is angiogenin. Angiogenin was first isolated from human tumor cells in conditioned media and then from normal human serum (Fett et al., 1985; Shapiro et al., 1987). Angiogenin is also found in bovine milk and other mammal serum (Bond et al., 1993; Maes et al., 1988). Angiogenin mrna is expressed in the bovine corpus luteum (Koga et al., 2000). Bovine angiogenin is in the ribonuclease superfamily and is 64% identical to human angiogenin with most differences being the result of conservative replacements (Bond and Strydom, 1989). Bovine angiogenin is a homolog of the bovine pancreatic ribonuclease A with conservation of active site residues (Bond and Strydom, 1989). Bovine angiogenin has the same ribonucleolytic activity as human angiogenin but differs in that human angiogenin has an extra disulfide bridge and six cystine residues located at the same position as the angiogenin molecule (Maes et al., 1988). Angiogenin is involved in the growth of follicles in the ovary and corpus luteum growth and is thought to play a role in vasculature development of cystic follicles. (Lee et al., 1999; Grado-Ahuir, 2008). This review will emphasize the control mechanisms of angiogenesis in the bovine ovary, as well as describe some of the angiogenic factors such as angiogenin and vascular 2

11 endothelial growth factor. Also, a section of this review will focus on the hormones that may impact angiogenin production such as progesterone and tumor necrosis factor-α. 3

12 CHAPTER II Literature Review 1. Development of follicles and ovarian folliculogenesis The development of follicles in the bos taurus species is established during fetal development (Webb et al., 2003). Ovarian folliculogenesis in cattle and other species contains many phases that can be very extensive and complex and be regulated by the proliferation and differentiation of the somatic cell and germ cell components (Webb and Campbell, 2007). Folliculogenesis in the terminal stages is controlled by the pituitary gonadotropins such as follicle stimulating hormone (FSH) and luteinizing hormone (LH) (Goodman et al., 1977; Webb and Campbell, 2007). In cattle the development and recruitment of follicles occur in a wave-like pattern, usually two to three waves, during the estrous cycle. Townson et al. (2002) stated that cattle with two follicular waves per cycle are less fertile and tend to ovulate bigger and older follicles than cattle that have three waves per cycle. Postpartum cattle and cattle around time of puberty can have a short estrous cycle which consists of only one wave (Savio et al., 1990; Evans et al., 1994). A follicular wave is comprised of a timely recruitment and growth of a group of 5-4

13 10 follicles after which one follicle is selected and continues to grow while the other follicles (subordinate follicles) undergo atresia (Driancourt, 2001; Evans, 2003). This process takes approximately three days to complete for dominance and is determined when the follicle reaches a certain size and then undergoes deviation from the other follicles and ultimately ovulates or undergoes atresia (Ginther et al., 1997). Follicular selection occurs when the follicle is about 4-6 mm in diameter and is stimulated by an increase in circulating levels of FSH which act as a survival factor for antral follicles at the stage when most follicles undergo atresia and aids in the recruitment of the next group of follicles for the next follicular way (Aerts et al., 2008). Subsequently, the dominant follicle becomes LH dependent in cattle (Evans, 2003). Some studies indicate that the dominant follicle appears to be more vascular in the theca layer than other antral follicles in the group (McNatty et al., 1981) and will be discussed in a more detail in a subsequent section. 2. Cystic ovarian disease/cystic ovarian follicles and pathogenesis The failure of the dominant follicle to ovulate and its further growth results in cystic ovarian disease (COD) or cystic ovarian follicles (COF) and causes great economic loss in the cattle industry due to increased calving intervals and calving to conception intervals (Peter, 2004; Vanholder et al., 2006). COD or COF also increases time to first insemination, decreases pregnancy rate and increases the number of services per conception (Thatcher et al., 1973; Shrestha et al., 2004). This disease showed its first clinical signs in the 1940s in which it was associated with cows displaying a bull-like behavior and nymphomania (Cassida et al., 1944; Garm, 1949). Ovarian cysts are defined as follicle structures exceeding 2.5 cm in diameter that fail to ovulate for an extended 5

14 period of at least 10 days without the presence of a corpus luteum (CL) and consequently do not regress and maintain growth and steriodogenic activity on one or both ovaries (Kesler et al., 1982; Vanholder et al., 2006). These cysts are classified into two types: follicular cysts and luteal cysts. Follicular cysts are thin walled cysts that can occur in multiples or as a single cyst on one or both ovaries. These cysts secrete minimal amounts of progesterone. Luteal cysts occur as a single thicker walled cyst on only one ovary and are believed to be follicular cysts in later stages (Peter, 2004; Vanholder et al., 2006). One method used to determine the difference between the two types of cysts is rectal ultrasonography. There are some predisposing factors linked to COD or COF, however, researchers believe that the heritability is low (0.07 to 0.12) and photoperiod does not seem to play a role (Peter, 2004; Vanholder et al., 2006). COD or COF can occur at different times throughout the year. The incidence of cysts occurring is higher around the time of first postpartum ovulation and in milking dairy cattle because of closer monitoring of the cattle but has been diagnosed in beef and dry cows as well as heifers (Lopez-Diaz et al., 1992; Laporte et al., 1994 ). The length of the anovulatory period can be due to several different factors such as body condition, breed and level of nutrition (Savio et al., 1990). One study reported a greater incidence of cysts occurring in beef cows in fall versus spring calving cattle (Savio et al., 1990). The estimated incidence of occurring in these types of cattle range from 5.6% to 18.8% but could be as high as 60% since some cattle recover spontaneously (Peter, 2004). Since cattle do not develop a cyst every lactation or every ovarian cycle this could indicate that gene expression may be promoted by certain stresses such as high milk production associated with negative energy balance (Vanholder et al., 2006). Also, it has been determined that cattle that have 6

15 cysts have a higher serum NEFA concentrations during their first weeks postpartum than cows in their ovualtory phase (Vanholder et al., 2006). These elevated NEFA levels may have direct effects on granulosa cell proliferation and steriodogenesis (Vanholder et al., 2005). However, the factors that determine whether or not a cyst will develop remain unclear. The pathogenesis of this disease is hypothesized to occur by at least two different mechanisms. The most widely accepted mechanism is the neuro-endocrinological dysfunction of the hypothalamic-pituitary axis (Peter, 2004; Vanholder et al., 2006). This dysfunction has a multiple etiology which it includes phenotypic, genetic and environmental factors (Wilbank et al., 2002; Peter, 2004).The factors that lead to this dysfunction may include a deficiency in the pre-ovualtory surge of LH, abnormal release of LH caused by a dysfunctional estradiol feedback system in cystic cattle or the LH surge occurs at an incorrect time during maturation of the dominant follicle (Day, 1991; Peter, 2004). It has also been theorized that the decline in LH pulses could be involved in anovulation (Peter, 2004). Also, progesterone at concentrations above basal levels blocks the LH surge which inhibits ovulation and increases LH pulse frequency (Duchens et al., 1994). A second mechanism that is hypothesized to cause cystic follicle dysfunction of the ovary is via the abnormal production of growth factors by the granulosa cells or the improper secretion of extra cellular matrix proteins both of which are responsible for some of the molecular and cellular changes inside the ovarian follicle during normal follicular growth (Peter, 2004). Recent findings indicate that bovine follicular cysts have increased expression of mrnas within the granulosa cell for LH receptors and 3β- 7

16 hydroxysteroid dehydrogenase Δ 4 and Δ 5 isomerase (Calder et al., 2001). Other studies suggest that alterations in steroid receptors (i.e., progestins and estrogens), cell proliferation and/or apoptosis in granulosa and theca cells could be factors in anovulation (Isobe et al., 2000; Peter, 2004). Also cystic follicles in their early stages demonstrate an increase in apoptosis and diminished cell proliferation (Vanholder et al., 2006). However, more research is needed in this area. Similar to COF in cattle, polycystic ovarian disease (PCOS) in women has been studied extensively. PCOS is a metabolic and endocrine disorder that affects about 10% of all women of reproductive age (Franks, 1995). PCOS is characterized by the arrest of follicular maturation which leads to anovulatory infertility (Woods et al., 2004). Research in PCOS in women indicates that theca cells have elevated expression of some steriodogenic enzymes such as 17α hydroxylase/17,20 lyase (CYP17) and P450 side chain cleavage enzyme (CYP11A1) (Wood et al., 2004). These steriodogenic enzymes play a key role in increased androgen production by 3β-hydroxysteriod dehydrogenase in theca cells of women with PCOS (Wood et al., 2004). Wood et al. (2004) conducted an oligonucleotide microarray analysis and subtractive hybridization and concluded that approximately 2% of the genes expressed in the theca cells show signs of altered mrna abundance in PCOS. It has also been documented the GATA6 that regulates the promoter activity of CYP17 and CYP11A1 which is increased in theca cells of PCOS (Wood et al., 2004). Woods et al. (2004) also concluded that theca cells related to PCOS had increased production of progesterone, 17α-hydroxyprogesterone and dehydroepiandrosterone when compared to normal theca cells. Wood et al. (2003) used gene expression profiles for theca cells that were normal and PCOS and determined that 8

17 445 of the 15,606 genes expressed on the 45,000 interrogated transcripts were differentially expressed on the microarray in women with PCOS and had altered mrna abundance. It is thought that theca cells of PCOS women have a very unique fingerprint which suggests some type of a genetic alteration. 3. Angiogenesis in the ovary Angiogenesis is the formation of new blood vessels from preexisting blood vessels to aid in reproduction and fertility as well as ordinary tissue growth in organs (Redmer and Reynolds, 1996; Lee et al., 1999). Angiogenesis is thought to be controlled by angiogenic and anti-angiogenic factors, starting with endothelial cell proliferation and finishing with the formation of a new microcirculatory bed of capillaries, venules and arterioles. Endothelial cell proliferation, the initial step of angiogenesis, occurs in three stages: 1) fragmentation of the basement membrane of the preexisting blood vessel 2) migration of endothelial cells from the existing vessel towards the angiogenic stimulus, and 3) proliferation of the endothelial cells (Redmer and Reynolds, 1996). The new blood vessels formed from angiogenesis aid in the transportation of nutrients, oxygen and specific hormones to particular cells. In the primate ovary, angiogenesis within follicles measured using CD31 combined with dual staining for BrdU to co-localize proliferating endothelial cells, increases and reaches a peak in the late antral stage of development (Fraser et al., 2001). One of the angiogenic factors that has an important role is vascular endothelial growth factor (VEGF) which is produced by ovarian follicles and corpus luteum (Redmer and Reynolds, 1996). Blocking VEGF expression can alter follicular angiogenesis, reduce the development and growth of mature antral follicles and cause a decline in granulosa cell proliferation (Kaczmarek et al., 2005; Fraser et al., 2001). 9

18 Capillary growth or angiogenesis is uncommon in most adult organs and only normally occurs in repairing tissue such as wound repairs and fractures. However, the growth of capillaries is common in female reproductive organs such as the uterus, ovary and placenta (Redmer and Reynolds, 1996; Lee et al., 1999). In uterine and placental tissues, growth of capillaries is most common during gestation (Redmer and Reynolds, 1996). It has been shown in some studies that the dominant follicle is more vascular in the theca layer and is reflected by a uptake of serum gonadotropins than other surrounding antral follicles (McNatty et al., 1981). Using vascular corrosion cast techniques, Jiang et al. (2003) demonstrated a dramatic increase in theca capillary branching during follicular development. In reproductive organs the vascular endothelial cells demonstrate mitotic rates greater than most destructive tumors (Redmer and Reynolds, 1996). Normal angiogenesis has been associated with blood clotting in adults as well. In some cases improper capillary growth occurs and this could be associated with many different pathological conditions such as rheumatoid arthritis, haemangiomas, and tumor growth (Redmer and Reynolds, 1996). Angiogenesis has some important reproductive functions such as maintaining progesterone secretion from the corpus luteum during pregnancy and increasing blood flow to the endometrium (Lee et al., 1999). 4. Angiogenin a homolog of bovine pancreatic ribonuclease A Another angiogenic factor that aids in morphological changes and angiogenesis in the ovary in angiogenin. Angiogenin was first isolated from human tumor cells in conditioned media and then from normal human serum (Fett et al., 1985; Shapiro et al., 1987). Angiogenin is also found in bovine milk and other mammal serum (Maes et al., 1988; Bond et al., 1993). Angiogenin mrna is expressed in ovarian tissue (Lee et al., 10

19 1999; Koga et al., 2000). Bovine angiogenin is in the ribonuclease superfamily, its amino acid sequence is 64% identical to human angiogenin, with most differences being the result of conservative replacements (Bond and Strydom, 1989). Bovine angiogenin is a homolog of the bovine pancreatic ribonuclease A with conservation of active site residues (Bond and Strydom, 1989). Bovine angiogenin has the same ribonucleolytic activity as human angiogenin but differs in that human angiogenin has an extra disulfide bridge and six cystine residues located at the same position as the angiogenin molecule (Maes et al., 1988).The two regions that are believed to be highly conserved between the angiogenins are 6-22 and but are different than the other ribonucleases (Bond and Strydom, 1989). Angiogenin ribonuclease superfamily is attributed to a group of enzymes that have inherent substrate specificity and differing functional capacities (Tellos-Montoliu et al., 2006). When angiogenin contains 123 amino acids in a single chain protein configuration it is often referred to as RNase 5 (Tellos-Montoliu et al., 2006; Gao and Zhengping, 2008). The gene encoding for angiogenin is proximal to the T cell receptor α/δ locus in a human haploid genome and is found as a single copy on chromosome 14q11 (Weremowicz et al., 1990). Some of the morphological changes that angiogenin is thought to assist in include corpus luteum development and ovarian follicular growth (Lee et al., 1999). Angiogenin also aids in the stimulation of the basement membrane and extracellular matrix degradation which would enhance angiogenesis after ovulation for corpus luteum formation (Gao and Zhengping, 2008). Angiogenin activates angiogenesis by initiating a response from the smooth and endothelial muscle cells which creates a response and aids in cell invasion and migration of tubular structures along with other 11

20 responses (Gao and Zhengping, 2008). Angiogenin promotes cell invasion by binding to actin on the cell surface and activating a cell associated protease system (Hu et al., 1993). Angiogenin expression is up-regulated in many types of diseases and has been correlated with breast cancer, endometrial cancer, pancreatic cancer as well as many other human cancers (Tello-Montoliu et al., 2006). Since angiogenin is expressed in these types of cancers, angiogenin may stimulate angiogenesis in these cells and in cancer cell proliferation. Angiogenin is also expressed in many other diseases that are not cancerous such as endometriosis, diabetes and inflammatory bowel disease (Gao and Zhengping, 2008). In women with endometriosis, angiogenin is increased in peritoneal fluid and blood serum with advanced stages of this disease (Bourlev et al., 2010). Studies have also detected angiogenin in the ovary. Lee et al. (1999) found that angiogenin protein and mrna were localized in both ovarian follicles and corpus lutea in cattle. Angiogenin mrna changes with follicular growth and development. During the development of follicles, angiogenin mrna is decreased in primary follicles and increases as the follicle develops (Lee et al., 1999). In the corpus luteum, angiogenin mrna increases during its growth and decreases during its regression (Lee et al., 1999). Koga et al. (2000) was first to report that angiogenin is found in follicular fluid and produced by granulosa cells in humans. In further support of ovarian follicular angiogenin production, Kawano et al. (2003) reported that angiogenin concentrations were greater in follicular fluid than those in serum, and that granulosa cells contained angiogenin mrna. Interestingly, follicular fluid angiogenin concentrations are greater in those follicles with mature verses immature oocytes from women undergoing IVF treatments (Malamitsi-Puchner et al., 2001). Because angiogenin concentrations are 12

21 positively associated with follicle growth and maturity of the oocyte, angiogenin s biological role may go beyond neovascularization with the ovary. There are a few hormones that are associated with angiogenin production such as progesterone and tumor necrosis factor-α (TNFα). Progesterone is an ovarian steroid that aids in many important functions related to reproduction, and with other steroids produced locally act on follicles and the corpus luteum via specific intracellular receptors (Berisha et al., 2002). Koga et al. (2000) determined that follicular fluid levels of progesterone and angiogenin are positively correlated in the human ovary and granulosa cell production of both is stimulated by hcg in vitro. TNFα has been identified in ovarian follicles in cattle and many other species such as the rat, rabbit and human (Sakumoto et al., 2003). TNFα inhibits basal and FSH- induced steroidogenesis in the granulosa cells and has a crucial physiological role in the regulation of ovarian function (Spicer and Alpizar, 1994; Sakumoto et al., 2003). TNFα is also present in the corpus luteum and it is more intensely expressed at the time of luteolysis due to infiltration of macrophages (Skarzynski et al., 2005). Interestingly, TNFα increases abundance of angiogenin mrna in HT-29 cells (colon adenocarcinoma of high metastatic potential) and IL-6 induced synthesis and secretion of angiogenin in human HepG2 cells ( Verselis et al., 1999; Tsuyoshi et al., 2000). Whether cytokines or steriods alter angiogenin production by granulosa cells remains to be determined. In conclusion, dominant follicle development, recruitment and selection are complex processes and likely involve increased angiogenesis. Many factors play direct or indirect roles in angiogenesis such as angiogenin, VEGF, TNFα, and progesterone. An 13

22 imbalance in any of these factors may induce cystic ovarian disease or cystic ovarian follicles. 5. References Adams, G.P Comperative patterns of follicular development and selection in ruminants. J. Reprod. Fertil. Suppl. 54: Aerts, J.M.J., and P.E.J. Bols Ovarian follicular dynamics: a review with emphasis on the bovine species. Part II: antral development, exogenous influence and future prospects. Reprod. Dom. Anim. 10: 1-8. Berisha B., M. W. Pfaffl, and D. Schams Expression of estrogen and progesterone receptors in the bovine ovary during estrous cycle and pregnancy. Endocrine 17: Bond, M.D., and D. J. Strydom Amino Acid sequence of bovine angiogenin. Biochemistry 28: Bond, M.D., D. J. Strydom, and B.L. Vallee Characterization and sequencing of rabbit pig and mouse angiogenins. Biochim. Biophys. Acta. 1162: Bourlev, V., N. Iljasova, L. Adamyan, A. Larsson, and M. Olovsson Signs of reduced angiogenic activity after surgical removal of deeply infiltrating endometriosis. Ferti.l Steril. 93: ( In Press). 14

23 Calder, M.D., M. Manikkam, B.E. Salfen, R.S. Youngquist, D.B. Lubahn, W.R. Lamberson, and H.A. Gaverick. Dominant bovine ovarian follicular cysts express increased levels of messenger RNAs for luteinizing hormone receptor and 3βhydroxysteriod dehydrogenase Δ 4 and Δ 5 isomerase compared to normal dominant follicles. Biol. Reprod. 65: Cassida, L.E. W.H. McShan, and R.K. Meyer Effects of an unfractionated pituitary extract upon cystic ovaries and nymphomania in cows. J. Anim. Sci. 3: Day, N The diagnosis, differentiation, and pathogenesis of cystic ovarian disease. Vet. Med. 86: Driancourt, M.A Regulation of ovarian follicular dynamics in farm animals. Implications for manipulation of reproduction. Theriogenology 39: Duchens, M., M. Forsberg, L-E Edqvist, H. Gastafsson, H. Rodriguez-Martinez Effect of induced suprabasal progesterone levels around estrus on plasma concentrations of progesterone, estradiol-17β and LH in heifers. Theriogenology 42: Evans, A.C.O., G.P. Adams, and N.C. Rawlings Endocrine and ovarian follicular changes leading to the first ovulation in prepubertal heifers. J. Reprod. Fertil. 100: Evans, A.C.O Characteristics of ovarian follicular development in domestic animals. Reprod. Dom. Anim.38:

24 Fett, J. W., D.J. Strydom, R.R. Lobb, E.M. Alderman, J.L. Bethune, J.F. Riordan, and B.L. Vallee Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells. Biochemistry 24: Franks, S Polycystic ovarian syndrome. N. Engl. J. Med. 333: Fraser, H.M., and C. Wulff Angiogenesis in the primate ovary. Reprod. Fertil. Dev. 13: Gao, X., and X. Zhengping Mechanisms of action of angiogenin. Acta. Biochim. Biophys. Sin. 40:619. Garm, O A study of bovine nymphomania. Acta Endocrinol. Suppl. 3: Garverick, H.A Ovarian follicular cysts in dairy cows. J. Dairy Sci. 80: Ginther, O.J., K. Kot, L.J. Kulick, and M.C. Wiltbank Emergence and deviation of follicles during development of follicular waves in cattle. Theriogenology 48: Goodman, A.L., W.E. Nixon, D.K. Johnson, and G.D. Hodgen Regulation of folliculogenesis in the cycling rhesus monkey: selection of the dominant follicle. Endocrinology 100: Grado-Ahuir, J.A Detection of differential gene expression in ovarian granulosa cells from swine and cattle using microarray technology. PhD Diss. Oklahoma State Univ., Stillwater. Hu G.F., S.I. Chang, J.F. Riordan, and B.L. Vallee An angiogenin binding protein from endothelial cells. Proc. Natl. Acaf. Sci. USA. 88:

25 Isobe N., and Y. Yoshimura Localization of apoptotic cells in cystic ovarian follicles of cows: a DNA-end labeling histochemical study. Theriogenology 53: Jiang, J.Y., G. Macchiarelli, B.K. Tsang, and E. Sato Capillary angiogenesis and degeneration in bovine ovarian antral follicles. Reproduction.125: Kawano, Y., H.K. Zeineh, J. Fukuda, S. Mine, and I. Miyakawa Production of vascular endothelial growth factor and angiogenic factor in human follicular fluid. Mol. Cell. Endocrinol. 202: Kaczmarek, M.M., D. Schams, and A.J. Ziecik Role of vascular endothelial growth factor in ovarian physiology- an overview. Reprod. Bio. 5: Kelser, D.J., and H.A. Garverick Ovarian cysts in dairy cattle: a review. J. Anim. Sci. 55: Koga, K., Y. Osuga, O. Tsutsumi, M. Momoeda, A. Suenaga, K. Kuga, T. Fujiwara, Y. Takai, T. Yano, and Y. Taketani Evidence for the presence of angiogenin in human follicular fluid and the up-regulation of its production by human chorionic gonadotropin and hypoxia. J. Clin. Endocrinol. Metab. 85: Laporte, H.M., H. Hogeveen, Y.H. Schukken, and J.P.T.M. Noordhuizen Cystic ovarian disease in Dutch dairy cattle I incidence, risk factors, and consequences. Livest. Prod. Sci. 38:

26 Lee, H.S., I.-S. Lee, T.-C. Kang, G.B. Jeong, and S.-I. Chang Angiogenin is involved in morphological changes in the ovary. Biochem. Biophys. Res. Commun. 257: Lopez-Diaz, M.C, and W.T.K. Bosu A review of cystic ovarian degeneration in ruminants. Theriogenology 37: Maes, P., D. Damart, C. Rommens, J. Montreuil, G. Spik, and A Tartar The complete amino acid sequence of bovine milk angiogenin. FEBS. Lett. 241: Macchiarelli, G, J.Y. Jiang, S.A. Nottola,and E. Sato Morphological patterns of angiogenesis in ovarian follicle capillary networks. A scanning electron microscopy study of corrosion cast. Microsc. Res. Tech. 69: Malamitsi-Puchner, A., A. Sarandakou, S.G. Baka, J. Tziotis, D. Rizos, D. Hassiakos, and G. Creatsas Concentrations of angiogenic factors in follicular fluid and oocyte- cumulus complex culture medium from women undergoing in vitro fertilization: association with oocyte maturity and fertilization. Fertil. Steril. 76: Malamitsi-Puchner, A., A. Sarandakou,S. Baka, D.Hasiakos, E. Kouskouni, and G. Creatsas In vitro fertilization: angiogenic, proliferative, and apoptotic factors in the follicular fluid. Ann. N. Y. Acad. Sci. 997: McNatty, K.P., A.E. Fidler, J.L. Juengel, L.D. Quirke, and D.C. Thurley Accumulation of luteinizing hormone, oestradiol and androstenedione by sheep ovarian follicles in vivo. J. Endocrinol. 91:

27 Mihm, M., P.J. Baker, J.L. Ireland, G.W. Smith, P.M. Coussens, A.C. Evans, and J.J. Ireland Molecular evidence that growth of dominant follicles involves a reduction in follicle-stimulating hormone dependence and an increase in luteinizing hormone dependence in cattle. Biol. Reprod. 74: Peter, A.T An update on cystic ovarian degeneration in cattle. Reprod. Dom. Anim. 39: 1-7. Redmer, D.A., and L.P. Reynolds Angiogenesis in the ovary. Rev. Reprod. 1: Sakumoto, R., B. Bershia, N. Kawate, D. Schams, and K. Okuda TNFα and its receptors in bovine corpus luteum sampled by continuous-flow microdialysis during luteolysis in vivo. Biol. Reprod. 62: Savio, J.D., M.P. Boland, N. Hynes, and J.F. Roche Resumption of follicular activity in the early post-partum period of dairy cows. J. Reprod Fertil. 88: Shapiro, R, D.J. Strydom, K.A Olson, and B.L. Vallee Isolation of angiogenin from normal human plasma. Biochemistry 26: Shrestha, H.K. T. Nakao, T. Higaki, T. Suzuki, and M. Akita Effects of abnormal ovarian cycles during pre-service period postpartum on subsequent reproductive performance of high producing Holstein cows. Theriogenology 61: Skarzynski, D.J., J.J. Jaroszewski, and K. Okuda Role of tumor necrosis factor-α and nitric oxide in luteolysis in cattle. Domest. Endocrinol. Anim. 29:

28 Spicer, L.J., and P.Y. Aad Insulin-like growth factor (IGF)2 stimulates steriodogenesis and mitosis of bovine granulosa cells through IGF1 receptor: role of follicle stimulating hormone and IGF2 receptor. Biol. Reprod. 77: Spicer, L.J. and E. Alpizar Effects of cytokines on FSH-induced estradiol production by bovine granulosa cells in vitro: dependence on size of follicle. Domest. Anim. Endocrinol. 11: Tello-Montoliu, A., J.V. Patel, and G.Y.H. Lip Angiogenin: a review of the pathophysiology and potential clinical applications. J. Thromb. Haemost. 4: Thatcher, W.W,. and C.J. Wilcox Postpartum estrus as an indicator of reproductive status in the dairy cow. J. Dairy Sci. 56: Townson, D.H., P.C. Tsang, W.R. Butler, M. Frajblat, L.C. Jr. Griel, C.J. Johnson, R.A. Milvae, G.M. Niksic, and J.L. Pate Relationship of fertility to ovarian follicular waves before breeding in dairy cows. J. Anim. Sci. 80: Tsuyoshi, E., S. Kenji, G.F. Barnard, S. Kitano, and M. Mori Angiogenin expression in human colorectal cancer: the role of focal macrophage infiltration. Clin. Cancer Res. 6: Vanholder, T. J.L. Leroy, A.V. Soom, G. Opsomer, M. Maes, D. Coryn, and A. de Kruif Effect of non-esterified fatty acids on bovine granulosa cell steriodogenesis and proliferation in vitro. Anim. Reprod. Sci. 87:

29 Vanholder, T., G. Opsomer, and A.D. Kruif Aetiology and pathogenesis of cystic ovarian follicles in dairy cattle: a review. Reprod. Nutr. Dev. 46: Verselis, S.J., K.A. Olsen, and J.W. Fett Regulation of angiogenin expression in human HepG2 hepatoma cells by mediators of the acute-phase response. Biochem. Biophys. Res. Commun. 259: Webb, R., B. Nicholas, J.G. Gong. B.K. Campbell, C.G. Gutierrez, H.A. Garerick, and D.G. Armstrong Mechanisms regulating follicular development and selection of the dominant follicle. Reproduction Suppl. 61: Webb, R., and B.K. Campbell Development of the dominant follicle: Mechanism of selection and maintenance of oocyte quality. Soc. Reprod. Fertil. Suppl. 64: Weremowicz, S., E.A. Fox, C.C. Morton, and B.L. Vallee Localization of the human angiogenin gene to chromosome band 14q11, proximal to the T cell receptor α /Δ locus. Am. J. Gent. 47: Wiltbank, M.C., A. Gumen, and R. Sartori Physiological classification of anovulatory conditions in cattle. Theriogenology 57: Wood, J.R., Nelson V.L., Ho C., Jansen E., Wang C.Y., Urbanek M., McAllister J.M., Mosselman S., and Strauss III J.F The molecular phenotype of polycystic ovarian syndrome (PCOS) theca cells and new candidate PCOS genes defined by microarray analysis. J. Biol. Chem. 278:

30 Wood, J.R., Ho C., Nelson V.L. McAllister J.M., and Strauss III J.F The molecular signature of polycystic ovarian syndrome (PCOS) theca cells defined by gene expression profiling. J. Repro. Immun. 63:

31 CHAPTER III EFFECTS OF HORMONES ON EXPRESSION OF ANGIOGENIN IN GRANULOSA CELLS IN BOVINE OVARIAN FOLLICLES 1. Abstract Ovarian follicular angiogenesis increases during follicular development but which hormones control production of angiogenic factors is unknown. The objective of this study was to determine the effect of insulin-like growth factor 1 (IGF1), estradiol (E2), fibroblast growth factor 9 (FGF9), Indian hedgehog (IHH), progesterone (P4), and tumor necrosis factor α (TNFα) on ovarian angiogenin mrna gene expression in cattle. Granulosa cells from small and large follicles were collected from bovine ovaries and cultured for 48 h in medium containing 10% fetal calf serum and then treated with various hormones in serum-free medium for either 24 or 48 h. In experiment 1, smalland large-follicle granulosa cells were cultured for 24 h with IGF1 (100 ng/ml) and contained the following treatments: Control, FSH (30 ng/ml), E2 (300 ng/ml), FSH (30 ng/ml) plus E2 (300 ng/ml), FSH (30 ng/ml) plus FGF9 (10 ng/ml), and FSH (30 ng/ml) plus IHH (1 µg/ml). In experiment 2, large follicle granulosa cells were cultured for 48 h with the following treatments: Control, P4 (300 ng/ml) or P4 (300 ng/ml) plus E2 (300 ng/ml). In experiment 3, large-follicle granulosa cells were cultured for 24 h 23

32 with IGF1 (0 or 30 ng/ml), and/or TNFα (0 or 30 ng/ml). Angiogenin mrna abundance in granuloa cells was quantified using real-time RT-PCR. In small-follicle granulosa cells, 100 ng/ml of IGF1 increased (P < 0.05) angiogenin mrna abundance, and TNFα decreased the IGF-1 induced angiogenin mrna abundance (P < 0.01). In large-follicle granulosa cells, IGF-1 increased (P < ) angiogenin mrna abundance, and TNFα decreased basal and IGF-1 induced angiogenin mrna abundance. Treatment of small- and large-follicle granulosa cells with E2, FSH, FGF9 or IHH did not affect (P > 0.10) abundance of angiogenin mrna. We conclude that angiogenin gene expression is differentially regulated in small- and large-follicle granulosa cells, and that IGF1 increases whereas TNFα decreases granulosa angiogenin mrna abundance. Keywords: Angiogenin (ANG); granulosa cells; insulin- like growth factor 1 (IGF1); angiogenesis; ovary 2. Introduction Angiogenesis or the formation of blood vessels from pre-existing blood vessels is controlled by many different angiogenic factors (Verselis et al., 1999; Lee et al., 1999; Ucuzian et al., 2010). Angiogenesis is involved in a varirty of physiological processes such as wound repair and embryological development (Redmer and Reynolds, 1996; Verselis et al., 1999; Przybylski, 2009; Appelam et al., 2010), and is under the influence of anti-angiogenic and pro-angiogenic molecular mediators. One of the pro-angiogenic factors is angiogenin. Angiogenin was first isolated from medium conditioned by colon carcinoma (HT-29) cells ( for review see: Tello- Montoliu et al., 2006) and induces endothelial cell proliferation (Hu et al., 1997) and tumor cell adhesion (Soncin et al., 1994). In the ovary, localization of angiogenin was first reported by Lee et al. (1999). 24

33 Both granulosa cells and luteal cells are capable of producing angiogenin (Lee et al., 1999; Koga et al., 2000). Some hormones have been associated with angiogenin production such as tumor necrosis factor-α (TNFα) and progesterone. TNFα stimulates angiogenin mrna in HT- 29 cells (colon adenocarcinoma of high metastatic potential) (Tsuyoshi et al., 2000). Although TNFα inhibits basal and FSH-induced steroidogenesis in granulosa cells and is thought to play a role in the regulation of ovarian function (Spicer and Aplizar, 1994; Sakumoto et al., 2003), the effect of TNFα on ovarian angiogenin production is unknown. Koga et al. (2000) reported a positive correlation between progesterone and angiogenin levels in human ovarian follicular fluid and that production of both are stimulated by hcg, but whether other hormones such as IGF1 alters ovarian angiogenin production is unknown. Investigation of the hormonal control of angiogenin mrna expression in large- and small-follicle granulosa cells may reveal possible regulatory mechanisms in the ovarian angiogenin/angiogenesis system. The objective of this study was to determine the hormonal control of ovarian angiogenin mrna gene expression in cultured bovine granulosa cells. We hypothesized that both TNFα and P4 would stimulate angiogenin mrna in granulosa cells. 3. Materials and Methods Reagents and Hormones: The reagents that were used in cell culture were the following: Ham s F-12, sodium bicarbonate, Dulbecco modified Eagle medium (DMEM), fetal calf serum (FCS), gentamicin, sodium bicarbonate, trypan blue, ovine testes hyalurondidase, clostridium 25

34 histolyticum collagenase, streptomyces griseus protease, and bovine pancreas DNase from Sigma Chemical Company (St. Louis, MO). The reagents used in RNA extraction were: Ambion Tri Reagent from Applied Biosystems (Foster City, CA), isopropyl alcohol from Pierce Chemical Company (Rockford, IL) and chloroform from Sigma Chemical Co., (St. Louis, MO). The hormones used in cell culture were: Recombinant human FGF9, recombinant human Indian Hedgehog (IHH) amino peptide, and recombinant human insulin like growth factor 1 (IGF1) from R&D Systems (Minneapolis, MN), ovine follicle stimulating hormone (FSH) ( FSH activity, 175X NIH-oFSH-S1; AFP 7028D) and ovine luteinizing hormone (LH)( LH activity, 1X NIH-LH-S1; AFP 11743B) from National Hormone & Peptide Program (Torrance, CA), recombinant bovine TNFα from CIBA-GEIGY(Basle, Switzerland), progesterone (P4) and estradiol (E2) from Sigma Chemical Co. (St. Louis, MO). Cell Culture: Ovaries from beef cattle were collected from Creekstone Slaughter House (Arkansas City, KS) and Ralph s Slaughter House (Perkins, OK). The ovaries were rinsed with 0.9% saline solution and then 70% EtOH. The ovaries were transported back to the laboratory in 0.9% saline-bactrim solution on ice. Follicular fluid from small (1-5 mm) and large follicles (8-22 mm) was aspirated using 20 gauge needles and 3 ml syringes. The follicular fluid was then centrifuged at 1000 rpm (220 x g) for 7 min to isolate granulosa cells as previously described by (Spicer and Chamberlin, 1998). 26

35 Granulosa cells were then resuspended in serum-free media containing collagenase and DNase (Sigma Chemical Co., St. Louis, MO) to prevent cell clumping. Viability of granulosa cells from the small and large follicles was determined by trypan blue exclusion method (Spicer et al., 1993) on a 0.1 mm deep hemacytometer. Between 2 and 5 x10 5 viable cells were plated on a 24-well Falcon multiwell plates in 1 ml of mixture of a 1:1 Dulbecco modified Eagle medium and Ham s F-12 containing 0.12 mm and 2.0 mm of gentamycin and glutamine, respectively and 35.8 mm sodium bicarbonate. Cells were cultured in an environment of 95% air and 5% CO 2 at 38.5 C in 10% fetal calf serum (FCS), and media was changed every 24 h. The FCS allowed the cells to obtain optimal attachment. Cells were washed twice with serum-free medium after 48 h of culture and hormonal treatments were applied according to the experimental design described below. RNA Extraction: At termination of cell culture, medium from each well was aspirated and cells from two replicated wells were lysed in 0.5 ml of Trizol reagent (Life Technologies Inc., Garthersburg, MD) and pooled. Briefly, 0.5 ml of Trizol was added to the first well and the cells were lysed by repeat pipetting and then transferred to the replicate well. The 1 ml of sample was then transferred to a 1.5 ml eppendorf tube and stored frozen at - 80 C. Each treatment was applied to four wells that generated two duplicate samples. For RNA extraction, samples were thawed and 80 µl of chloroform was added to each sample and vortexed for 15 sec. Samples were then incubated at room temperature for 2-3 min, and centrifuged at 6000 rpm (3500 x g) at 4 C for 30 min using an eppendorf 27

36 centrifuge 5417C (Brinkmann Instruments, Westbury, NY). The upper aqueous phase was transferred into new tubes and 200 µl isopropanol was added to each tube. Tubes were gently inverted to initiate RNA precipitation. Samples were incubated at room temperature for 10 min and centrifuge at 6000 rpm for 10 min at 4 C to complete RNA precipitation. Supernatants were discarded and 400 µl (75%) EtOH was added, tubes vortexed and re-centrifuged for 5 min at 6000 rpm at 4 C. Supernatants were again discarded and RNA dried at room temperature until EtOH was evaporated (15-45 min). DEPC water (16.5µL) was used to solubalize RNA, and samples were stored at -80 C until target gene quantification. Prior to RT-PCR, quality of RNA was determined using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE). Primers and Probe Design: Angiogenin primers and probes for quantitative RT-PCR were designed using Primer Express software (Foster City, CA) as described by Grado-Ahuir (2008). The angiogenin (848 bp, Accession NM ) forward primer sequence was constructed between 362 to 383 bp with a Tm of 55 C and sequence of CTGCTACCAGAGCAAATCTACC, its reverse primer sequence was CTAGTCTTGTAGGCACGTTGG and was constructed between 427 and 448 bp with a Tm of 55 C, and its probe was TGCCGCGAGACAGGCAGCTCTAAGTA and was constructed between 399 and 424 bp with a Tm of 65 C (Grado-Ahuir, 2008). Using NCBI online database a BLAST ( was conducted to insure the specificity of the designed primers and probes and to insure there was no homologous regions coding for another gene. 28

37 The differential expression of the target gene angiogenin was quantified using RNA from the individual pools of granulosa cells for each experiment. One step real-time RT-PCR was conducted using Taqman Gold RT-PCR Kit (Applied Biosystems Inc., Foster City, CA) as described previously (Spicer and Aad, 2007). An ABI PRISM 7500 Sequence Detection System (PE Applied Biosystems) was used to run the 96 well plate and was located at Oklahoma State University in the DNA/Protein Core Facility Lab. Thermal cycling conditions were set to 48.8 C for 30 min for reverse transcription, 95 C for 10 min and the process finished with cycles at 95 C for 15 sec for denaturing and 60 C for 60 sec for annealing and extension. Ribosomal 18S was used to normalize samples for the variation in RNA loaded. To quantify gene expression of angiogenin, arbitrary threshold (Ct) was set on the FAM TAMRA and VIC curves in the geometric proportion of the RT-PCR amplification plot. Relative quantification of angiogenin was expressed using the comparative cycle threshold method (ABI, 1997). To determine the ΔCt the Ct value for 18S was subtracted from the target unknown value. The ΔΔCt for each experiment was determined by subtracting the higher ΔCt (the least expressed unknown) from all the other ΔCt values, and fold changes were calculated with the formula 2 - ΔΔCt. Experimental Design Experiment 1 was designed to test the effect of FSH, E2, FGF9, and/or IHH on angiogenin mrna abundance in small- and large-follicle granulosa cells. Cells were cultured for 48 h in 10% FCS and then washed twice with serum free medium (0.5 ml) and treatments applied for 24 h. All treatments contained IGF1 (100 ng/ml) and were as 29

38 follows: Control (no additions), FSH ( 30 ng/ml), E2 (300 ng/ml), FSH plus E2, FSH plus FGF9 (10 ng/ml), and FSH plus IHH (1 µg/ml). After 24 h of treatment cells were lysed in 0.5 ml of Trizol for RNA extraction as described previously. Experiment 2 was designed to test the effect of P4 and its combination with E2 on angiogenin mrna in large-follicle granulosa cells. Cells were cultured for 48 h as described for experiment 1 but treatments were applied for 48 h. All treatments contained IGF1 (30 ng/ml) and were as follows: Control, P4 (300 ng/ml) and P4 (300 ng/ml) plus E2 (300 ng/ml). After 48 h of treatment cells were lysed in 0.5 ml of Trizol for RNA extraction as described previously. Experiment 3 was designed to test the effect of IGF1 and TNFα on angiogenin mrna in small- and large-follicle granulosa cells. Cells were cultured for 48 h as described in experiment 1. Treatments were as follows: Control (no additions), IGF1 (30 ng/ml), TNFα (30 ng/ml), and TNFα (30 ng/ml) plus IGF1 (30 ng/ml). After 24 h of treatment cells were lysed in 0.5 ml of Trizol for RNA extraction as described previously. Statistical Analysis There were at least 2 to 6 individual pools of large- and small-follicle granulosa cells used as experimental replicates. Each of the large-follicle granulosa cell pools was obtained from 5 to 10 follicles. Small-follicle granulosa cells were obtained from 10 to 20 ovaries within each experimental replicate. The treatments were applied to four different wells on the 24 well plates and duplicate samples for each pool was obtained by combining RNA from the two wells. The effect of the treatments on angiogenin mrna 30

39 abundance (dependent variable) was determined using ANOVA and the GLM procedure of SAS for Windows (version 8.02, SAS Institute Inc). To detect any outliers that may exist, the procedure described by Grubbs was used (Grubbs, 1950). 4. Results Experiment 1: Effect of IGF1, FSH, E2, FGF9, and IHH on small- and large-follicle granulosa cell Angiogenin mrna. Angiogenin mrna was detectable in small- and large-follicle granulosa cells, but there were no effects of E2, FSH, FGF9 or IHH (P > 0.70) on angiogenin mrna abundance (Figure 1 and 2). The Ct and ΔCt values are summarized in table 1. Experiment 2: Effect of P4 and its combination with E2 on large-follicle granulosa cell angiogenin mrna. As in experiment 1, angiogenin mrna was detected in the large-follicle granulosa cells, but there were no effects of P4 or E2 (P > 0.50) on angiogenin mrna abundance (Figure 3). The Ct and ΔCt values are summarized in table 2. Experiment 3: Effect of IGF1 and TNFα on small- and large-follicle granulosa cell angiogenin mrna. For small-follicle granulosa cells, main effect of TNFα was significant but not IGF1 or TNFα by IGF1. In the absence of IGF1, TNFα had no effect (P > 0.10) on angiogenin mrna abundance (Figure 4). In the presence of IGF1, TNFα suppressed (P < 0.05) angiogenin mrna (Figure 4). 31

40 For large-follicle granulosa cells, main effects of TNFα and IGF1 were significant but TNFα by IGF1 was not. IGF1 increased (P < ) angiogenin mrna abundance, and this increase was completely blocked with the addition of TNFα (Figure 5). In contrast to small-follicle granulosa cells, TNFα decreased (P < 0.05) basal angiogenin mrna abundance. The Ct and ΔCt values are summarized in table Discussion The current study was conducted to characterize hormonal control of angiogenin gene expression in small- and large-follicle granulosa cells, and was first to determine the effect of IGF1, E2, FGF9, IHH, P4, FSH and TNFα on ovarian angiogenin mrna gene expression in bovine granulosa cells in vitro. In particular, results revealed that: 1) IGF1 increases angiogenin mrna abundance, 2) TNFα inhibits IGF1 induced angiogenin mrna abundance, and 3) FSH, FGF9, E2, P4 and IHH have no effect on angiogenin mrna abundance. In the current study, angiogenin mrna was detectable in small- and large-follicle granulosa cells, and IGF1 increased angiogenin mrna abundance in both cell types by several fold. IGF1 has been shown to be positively correlated with angiogenin in blood serum (Silha et al., 2005) and further supports a positive role for IGF1 in angiogenin secretion by the ovary. During follicular growth, concentrations of free IGF1 increase several fold (Spicer, 2004) and thus may assure concomitant development of the follicular vasculature via increased secretion of angiogenin. Because FSH increases the expression of vascular endothelial growth factor C (VEGF-C) and follicle-stimulating hormone C terminal peptide (FSH-CTP) enhances VEGF activity in rat ovaries 32

41 (Trousdale et al., 2007; Sapoznik et al., 2009), we hypothesized that FSH would also increase angiogenin expression in bovine granulosa cells. However, FSH alone had no effect on the stimulatory action of IGF1 on angiogenin mrna abundance. Collectively these results suggest that FSH s role in altering ovarian angiogenesis may vary among species. Alternatively, FSH may differentially regulate the various angiogenic factors produced by the ovary. Further research will be required to test these possibilities. In the present study, E2, IHH, and FGF9 did not affect angiogenin mrna production in small- and large-follicle granulosa cells. Consistent with our findings that E2 had no effect on angiogenin mrna production, Koga et al. (2001) found no differences in angiogenin mrna expression in human endometrial stromal cells treated with E2 alone for 4 to 18 days. Sonic hedgehog is an indirect angiogenic agent that upregulates some angiogenin factors including angiopoietin-1(fujii and Kuwano, 2010) and fibroblast growth factor-2 up regulates angiopoietin-2 in human endothelial cells and thus increases angiogenesis (Fujii and Kuwano, 2010). Because all the hedgehog proteins bind to the same receptor and FGF9 and FGF2 bind to the same receptor, IHH and FGF9 would have an effect on angiogenin gene expression in small- and large-follicle granulosa cells. However, our findings indicate that neither IHH nor FGF9 has an effect on angiogenin expression in bovine granulosa cells. It is likely that species and/or tissue differences exist in terms of hormonal control of angiogenin gene expression. Our research also indicated that neither P4 nor its combination with E2 affected angiogenin mrna expression in granulosa cells. Previously, Koga et al. (2000) reported that concentrations of P4 and angiogenin measured in human follicular fluid were 33

42 positively correlated and showed that this correlation was likely due to concominant hcg-induced angiogenin and P4 production by human granulosa cells. Human endometrial stromal cells treated with P4 or P4 plus E2 exhibited an increase in angiogenin after 14 days of culture (but not 4 to 8 days) compared with untreated cells (Koga et al., 2001). Although our study showed similar results in that angiogenin was not altered after 2 days of P4 treatment, it is unclear whether an increase in angiogenin mrna would have been observed after 14 days in our study. This is unlikely, since angiogenin mrna was upregulated by hcg within 24 h in cultured human granulosa cells (Koga et al., 2000). The more plausible explanation is that species differences may exist in terms of angiogenin response to P4 and gonadotropins. In the current study, TNFα decreased angiogenin mrna abundance in small- and large-follicle granulosa cells treated with IGF1. In contrast to the present findings, Etoh et al. (2000) found that TNFα induced angiogenin mrna expression in human colon cancer cells in a dose and time dependent manner. As previously suggested, perhaps species differences (i.e., human vs. bovine) exist in their angiogenin response to TNFα, and will require further elucidation. The present finding that TNFα decreased both basal and IGF1-induced angiogenin mrna abundance in large-follicle granulosa cells, and only IGF1-induced angiogenin mrna abundance in small-follicle granulosa cells indicates that angiogenin gene expression, and thus angiogenesis is under developmental and opposing control by TNFα and IGF1. The physiological content whereby TNFα inhibits angiogenin production may implicate a role for the immune system in regulating ovarian angiogenesis. For example, TNFα increases during luteal regression (Sakumoto et al., 2003), a time when blood vessel growth is reduced (Redmer and Reynolds, 1996). 34

43 Previous studies have shown developmental differences in the steriodogenic response to TNFα in bovine granulosa cells (Spicer and Alpizar, 1994). Because there were developmental differences in the angiogenin response to TNFα, changes in this response during follicular growth should be explored in further detail in cattle. In conclusion, an inhibitory effect of TNFα on angiogenin mrna implicates the immune system in regulatory ovarian angiogenin. Further research is needed to determine the role of IGF1 and TNFα in blood vessel formation (angiogenesis) during growth of ovarian follicles. 35

44 Figure 1: Effect of follicle stimulating hormone (FSH), estradiol (E2), fibroblast growth factor 9 (FGF9), and Indian hedgehog (IHH) on small-follicle granulosa cell angiogenin (ANG) mrna in experiment 1. Cells were cultured for 48 h as described in section 3, and then treated for 24 h with: Control, FSH (30 ng/ml), E2 (300 ng/ml), FSH plus E2, FSH plus FGF9 (10 ng/ml), and FSH plus IHH (1 µg/ml). Values are means ± SEM of three separate experiments. 36

45 37 Figure 1

46 Figure 2: Effect of follicle stimulating hormone (FSH), estradiol (E2), fibroblast growth factor 9 (FGF9), and Indian hedgehog (IHH) on large-follicle granulosa cell angiogenin (ANG) mrna in experiment 1. Cells were cultured for 48 h as described in section 3, and then treated for 24 h with: Control, FSH ( 30 ng/ml), E2 (300 ng/ml), FSH plus E2, FSH plus FGF9 (10 ng/ml), and FSH plus IHH (1 µg/ml). Values are means ± SEM of two separate experiments. 38

47 39 Figure 2

48 Figure 3: Effect of progesterone (P4) and its combination with estradiol (E2) on largefollicle granulosa cell angiogenin (ANG) mrna in experiment 2. Cells were cultured for 48 h as described in section 3, and then treated for an additional 48 h with 30 ng/ml of IGF1 and: Control, P4 (300 ng/ml) and P4 plus E2 (300ng/mL). Values are means ± SEM of six separate experiments. 40

49 41 Figure 3

50 Figure 4: Effect of insulin-like growth factor 1 (IGF1) and tumor necrosis factor α (TNFα) on small-follicle granulosa cell angiogenin (ANG) mrna in experiment 3. Cells were cultured for 48 h as described in section 3, and then treated for an additional 24 h with: Control (no IGF1), IGF1 (100 ng/ml), TNFα (30 ng/ml) or TNFα plus IGF1. Values are means ± SEM of three separate experiments. ab Means without a common letter differ ( P< 0.05). 42

51 43 Figure 4