ENDOMETRIOSIS. a Leuven University Fertility Centre, Department of Obstetrics and Gynaecology, University Hospital Gasthuisberg, Leuven,
|
|
- Marcus Ellis
- 5 years ago
- Views:
Transcription
1 ENDOMETRIOSIS Increased peritoneal and endometrial gene expression of biologically relevant cytokines and growth factors during the menstrual phase in women with endometriosis Cleophas M. Kyama, M.Sc., a,b Lutgart Overbergh, Ph.D., c Sophie Debrock, Ph.D., a Dirk Valckx, c Sarah Vander Perre, a Christel Meuleman, M.D., a Attila Mihalyi, Ph.D., a Jason M. Mwenda, Ph.D., b Chantal Mathieu, M.D., Ph.D., c and Thomas M. D Hooghe, M.D., Ph.D. a,b a Leuven University Fertility Centre, Department of Obstetrics and Gynaecology, University Hospital Gasthuisberg, Leuven, Belgium; b Division of Reproductive Biology, Institute of Primate Research, Karen, Nairobi, Kenya; and c Laboratory of Experimental Medicine and Endocrinology, University Hospital Gasthuisberg, Leuven, Belgium Objective: To examine differential messenger RNA (mrna) expression of relevant cytokines, metalloproteases, growth and adhesion factors in endometrium and peritoneum from women with endometriosis when compared with women without the disease during menstrual and luteal phases of the cycle. Design: Patients with endometriosis were compared with control patients. Setting: University hospital. Patient(s): A total of 35 patients (20 patients during the luteal phase and 15 patients during the menstrual phase) were selected for this study on the basis of cycle phase and presence or absence of endometriosis. Intervention(s): In this study, endometriosis was laparoscopically and histologically confirmed in 24 women with endometriosis of revised American Society for Reproductive Medicine (ASRM) stage I II (n 12) and revised ASRM stage III IV (n 12), and the presence of a normal pelvis was documented by laparoscopy in 11 control patients. The macroscopically normal peritoneum tissues were collected from lateral wall left or right, near the colon ascendens or descendens. Main Outcome Measure(s): The expression levels were determined as ratios between the target molecules and -actin as housekeeping gene. Result(s): In women with endometriosis, peritoneal mrna levels of matrix metalloproteinase (MMP) 3, transforming growth factor-, interleukin (IL)-6, and intercellular adhesion molecule-1 and endometrial mrna levels of MMP-3, tumor necrosis factor (TNF), and IL-8 were significantly higher during the menstrual phase when compared with luteal phase. During the menstrual phase of the cycle, both endometrial expression of TNF-, IL-8, and MMP-3 mrna levels and peritoneal expression of transforming growth factor-, IL-6, and intercellular adhesion molecule-1 mrna levels were significantly higher in women with endometriosis when compared with controls. Immunohistochemical staining confirmed the presence of TNF- in peritoneum and endometrium in both women with endometriosis and controls. Conclusion(s): Increased endometrial and peritoneal cytokine mrna expression during menstruation may contribute to a pelvic inflammatory microenvironment favoring the development of endometriosis. (Fertil Steril 2006;85: by American Society for Reproductive Medicine.) Key Words: Endometrium, endometriosis, cytokines, peritoneum, gene expression, real-time RT-PCR Endometriosis is a multifactorial complex disease process characterized by the ectopic presence of endometrial glands and stroma. Endometriosis can be present as peritoneal disease, endometriotic ovarian cysts, and/or deeply infiltrating rectovaginal endometriosis and is associated with pelvic pain, adhesion formation, and infertility. Endometriosis occurs in 30% 40% of women with infertility and is a progressive disease in 40% 50% of reproductive-aged women (1, 2). Received June 1, 2005; revised and accepted November 18, Supported by grants from the Leuven University Research Council and from the Flemish Fund for Scientific Research, Leuven, Belgium. Presented at the 20th Annual Meeting of the European Society for Human Reproduction and Embryology in Berlin, Germany, June 27 30, Reprint requests: Thomas M. D Hooghe, M.D., Ph.D., Leuven University Fertility Center, Herestraat 49, Department of Obstetrics and Gynaecology, University Hospital Gasthuisberg, Leuven B-3000, Belgium (FAX: ; thomas.dhooghe@ uz.kuleuven.ac.be) /06/$32.00 Fertility and Sterility Vol. 85, No. 6, June 2006 doi: /j.fertnstert Copyright 2006 American Society for Reproductive Medicine, Published by Elsevier Inc. 1667
2 The theory that has gained most supportive evidence for the pathogenesis of endometriosis is Sampson s theory (3)of retrograde menstruation. Retrograde menstruation has been reported in 83% of baboons (4) and in 70% 90% of women with spontaneous endometriosis (5). The existence of endometrial cells in the peritoneal fluid has been reported in 59% 79% of women during menses or during the early follicular phase (6, 7). According to Sampson s hypothesis (3), menstrual debris, refluxed into the peritoneal cavity, contains viable endometrial cells that can implant and develop into endometriotic lesions. However, the Sampson theory does not explain why refluxed endometrial cells survive, implant, and infiltrate in the pelvis of some but not all women. It is generally accepted that aberrant expression of cytokines and inflammation may play a role in the pathogenesis of endometriosis (8, 9), although the precise relationship between increased inflammation and the development of endometriosis is unknown. Increased peritoneal inflammation, as evidenced by increased peritoneal fluid (PF) volume and increased PF concentration of white blood cells and inflammatory cytokines, has been reported in women with endometriosis (10, 11). Several cytokines can stimulate endometrial cell adhesion to peritoneal mesothelial cell monolayers in vitro (12 14), as well as to specific extracellular matrix proteins (15). Interleukin (IL)-8 and tumor necrosis factor (TNF) are known to promote proliferation and adhesion of endometrial cells. A positive correlation has been described between PF concentrations of TNF- (8) and IL-8 (9) and size and number of active lesions and revised American Society for Reproductive Medicine (ASRM) stages of endometriosis. The increased concentration of TNF- reflects enhanced secretory activity of the peritoneal macrophages (16) and also may contribute to decreased expression of endogenous tissue inhibitors of matrix metalloproteinases (MMPs and tissue metalloproteinases) (17), resulting in increased MMP activity. However, increased levels of transforming growth factor (TGF) in PF of women with endometriosis when compared with controls have been reported (18). Interleukin-6 has been suggested to be secreted by endometriotic cells and, in concert with interferon-, may up-regulate soluble intercellular adhesion molecule 1 (sicam-1) production by macrophages in patients with endometriosis (19). In a study performed in baboons (20), it was shown that intrapelvic injection of menstrual endometrium induces endometriosis to a more severe degree when compared with intrapelvic injection of endometrium obtained during luteal phase of the cycle. But it is not known whether proinflammatory cytokines that act in concert with MMPs and are present in eutopic endometrium and peritoneum at the time of menstruation may contribute to development of endometriosis. Therefore, this study was performed to test the hypothesis that the messenger RNA (mrna) for biologically relevant molecules TNF-, IL-8 and -6, TGF-, vascular endothelial growth factor (VEGF), ICAM-1, and MMP-1 and -3 is quantitatively and differentially expressed in menstrual endometrium and menstrual peritoneum from women with endometriosis when compared with women without the disease or when compared with endometrium and peritoneum obtained during the luteal phase of the cycle. MATERIALS AND METHODS Patients and Tissue Collection This study was performed on 60 samples from women; the samples were selected from the tissue bank at the Leuven University Fertility Centre tissue bank, where tissue samples of women undergoing laparoscopies for infertility and pain have been stored since All patients had signed a written informed consent before recruitment, and the study protocol was approved by the institutional ethical and review board of University Hospital Gasthuisberg for the protection of human subjects. Samples from 35 patients (20 patients during the luteal phase and 15 patients during the menstrual phase) were selected for this study on the basis of cycle phase and presence or absence of endometriosis. Paired samples of either endometrium and/or normal peritoneum were available in 25 women (9 controls and 16 with endometriosis). Unpaired samples of either endometrium (n 3) or normal peritoneum (n 7) were available in 10 women (2 controls, 8 with endometriosis; Table 1). In this study, endometriosis was laparoscopically and histologically confirmed in all 24 women with endometriosis of revised ASRM stage I II (n 12) and revised ASRM stage III IV (n 12) (21), and the presence of a normal pelvis was documented by laparoscopy in 11 control patients. Tissue samples of endometrium and of macroscopically normal peritoneum were collected from women with endometriosis (n 40; endometrium [n 18] and peritoneum [n 22]) and from controls (n 20; endometrium [n 10] and peritoneum [n 10]) via endometrial biopsy and laparoscopic biopsy, respectively, snap-frozen in liquid nitrogen, and then stored at 80 C until use (Table 1). The macroscopically normal peritoneum tissues were collected from lateral wall left or right, near the colon ascendens or descendens. The selected samples for immunohistochemistry included endometrium obtained during menstrual (n 10) or luteal phase (n 10) and normal peritoneum obtained during menstrual (n 11) or luteal (n 12) phase (Table 1). Isolation of RNA and complimentary DNA Synthesis Total RNA was extracted from deep-frozen endometrial and peritoneal tissues with the Promega SV RNA Isolation System Z3100 (Promega Corp, Madison, WI). Briefly, RNA concentration was determined spectrophotometrically (Pharmacia, Uppsala, Sweden) by absorption at 260 nm. Target RNA was reverse transcribed by using the Superscript II reverse transcriptase (Life Technologies, Gaithersburg, MD). In the first step, 5 M Oligo(dT) 16 (Applied Biosystems, Foster City, CA) was added to 500 ng of total RNA and annealed at 70 C for 10 minutes. Then, 100 U of Superscript II reverse transcriptase was added in the pres Kyama et al. Cytokine mrna levels in women with endometriosis Vol. 85, No. 6, June 2006
3 TABLE 1 Overview of endometrial and peritoneal tissue samples collected during menstrual and luteal phases of the cycle that were used for real-time RT-PCR analysis and immunohistochemistry in women with and without endometriosis. Cycle phase by group Total Controls Endometriosis Endometriosis (ASRM I II) Endometriosis (ASRM III IV) Patients Total Menstrual Luteal Endometrium (n 28) Menstrual 14 5 a (2 a ) 9 5 a (4 a ) c 4 a (4 a ) Luteal 14 4 a 1 b (3 a ) 9 4 a (3 a ) 3 a 2 b (3 a 1 b ) Normal peritoneum (n 32) Menstrual 15 5 a (2 a 2 b ) 10 5 a (4 a ) 4 a 1 b (3 a ) Luteal 17 4 a 1 b (3 a 1 b ) 12 4 a 3 b (4 a ) 3 a 2 b (3 a 1 b ) Note: Samples used in immunohistochemistry are indicated in parentheses. ASRM revised ASRM stages. a Paired tissue samples (endometrial and normal peritoneal biopsies were obtained from same patient). b Unpaired tissue samples (endometrial and normal peritoneal biopsies obtained from different patients). ence of 50 mm Tris-HCL, ph 8.3; 75 mm KCL; 3 mm MgCl 2 ; and 5 mm unlabeled deoxynucleotides and was incubated at 42 C for 80 minutes. Reverse-transcriptionminus controls (i.e., RNA samples that were treated similarly but without addition of Superscript II RT enzyme) were included as negative controls for subsequent polymerase chain reactions (PCRs). Real-Time RT-PCR All amplification of primers and TaqMan probes used (Table 2) were designed with Primer Express software (Applied Biosystems, Foster City, CA). 6-Carboxyfluorescein was used as the reporter dye, and 6-carboxytetramethylrhodamine was used as the quencher dye. Real-time PCR was performed for TNF-, IL-8, IL-6, TGF-, VEGF, ICAM-1, MMP-1, -actin, and MMP-3 as described elsewhere (22). Briefly, realtime PCR amplification was performed in duplicate by using 96-well microtiter plates on the ABI Prism 7700 detection System, which contains a Gene-Amp PCR system 9600 (Applied Biosystems, Foster City, CA). The reactions were performed in a total volume of 25 L, containing 0.5 L of cdna sample, 1 real-time PCR buffer, 0.5 mm deoxynucleotides, 5 mm MgCl 2, 5 pmol each primer, 5 pmol dual-labeled probe, and U of Hot Gold Star (Eurogentec, Liege, Belgium). Reaction conditions were 10 minutes at 94 C, followed by 45 cycles (15 seconds at 94 C and 1 minute at 60 C). To correct for variations linked to differences in amount of input RNA, or for different levels of inhibition during reverse transcription (RT) or PCR, we normalized the expression levels by using -actin as a housekeeping gene (Applied Biosystems, Foster City, CA). All experiments were performed with negative controls. Immunohistochemistry Immunohistochemistry was performed to confirm the presence of TNF- in endometrium and peritoneum. Paraffinembedded biopsies of endometrium and peritoneum were cut in 5- m sections and put on silane-coated glass slides. Tissue sections were preheated for 1 hour at 55 C. The tissue sections were deparaffinized in toluene twice for 5 minutes and rehydrated in ethanol twice for 5 minutes. To quench the endogenous peroxidase activity, sections were blocked for 30 minutes by using an endoperoxidase solution of 0.5% hydrogen peroxide (H 2 O 2 ) and 0.1% sodium azide (NaN 3 )in methanol. After washing in 0.01 M tris(hydroxymethyl)aminomethane buffered saline (TBS), the tissue sections were retrieved in 0.01 M Tris buffer, ph 9, with 0.5 M ethylenediaminetetraacetic acid for 2 hours at 80 C. Tissue sections were rinsed again in 0.01 M TBS, then incubated for 15 minutes at room temperature with 0.2% bovine serum albumin, 0.1% nonfat dried milk, and 0.1% Tween-80 with addition of normal goat serum (1/30) in 0.01 M TBS. The primary antibody was added and incubated overnight at 4 C. A mouse monoclonal antibody raised against human TNF- (1:10 dilution; R and D Systems, Minneapolis, MN) was used at 50 g/ml. Then tissue sections were washed in TBS and blocked again with 0.2% bovine serum albumin, 0.1% nonfat dried milk, and 0.1% Tween-80 with addition of normal goat serum (1/30) for 15 minutes at room temperature. Then a secondary antibody peroxidase-conjugated goat anti-mouse IgG (1/100, 30 minutes; Jackson ImmunoResearch Lab Inc, West Grove, PA) was added, supplemented with normal human serum (1: 25). Peroxidase activity was detected by 3,3=-diaminobenzidine tetrahydrochloride DAB (Sigma Chemical Co., St. Louis, MO), and slides were counterstained with Harris hematoxylin. Fertility and Sterility 1669
4 TABLE 2 Primer and probe sequences for real-time RT-PCR of human cytokines, chemokines, adhesion molecules, and metalloproteinases. Substance Sequence (5= 3=) Amplicon length (bp) Accession number a TNF- FW TCTTCTCGAACCCCGAGTGA 151 NM_ RV CCTCTGATGGCACCACCAG NT_ TAGCCCATGTTGTAGCAAACCCTCAAGCT TGF- FW CAGCAACAATTCCTGGCGATA 136 NM_ RV AAGGCGAAAGCCCTCAATTT NT_ CTGCTGGCACCCAGCGACTCG IL-6 FW CACCGGGAACGAAAGAGAAG 97 NM_ RV CCCAGGGAGAAGGCAACTG NT_ CCTTCTCCACAAGCGCCTTCGGT IL-8 FW TGGCAGCCTTCCTGATTTCT 61 NM_ RV TTAGCACTCCTTGGCAAAACTG NT_ CAGCTCTGTGTGAAGGT ICAM-1 FW CGGCTGACGTGTGCAGTAAT 127 NM_ RV CACCTCGGTCCCTTCTGAGA NT_ CATCTACAGCTTTCCGGCGCCCA VEGF FW ACCAAGGCCAGCACATAGAGA 134 NM_ RV CTTGCGCTTTCGTTTTTGC NT_ CAGCACAACAAATGTGAATGCAGACCAA MMP-1 FW GGGAGATCATCGGGACAACTC 80 NM_ RV CAATACCTGGGCCTGGTTGA NT_ CCTTTTGATGGACCTGGAGGAAATCTTGC MMP3 FW TTCCGCCTGTCTCAAGATGAT RV ATCACAGTTGGCTGGCGTC 129 NM_ CCTCCCCCTGACTCCCCTGAGACC NT_ Note: FW forward primer; RV reverse primer; TaqMan probe, dual-labeled with 5=FAM and 3=TAMRA. a Genbank accession number of cdna and corresponding gene, available at Sections incubated without the primary antibody were included as negative control, whereas breast cancer tissue was used as a positive-control tissue. All tissue sections were examined with a light microscope (DMLB; Leica, Wetzlar, Germany). Statistical Analysis In the real-time RT-PCR part of the study, comparisons were made regarding the endometrial and peritoneal mrna expression of all the above-mentioned cytokines between menstrual and luteal phases of women with and without endometriosis and between women with and without endometriosis during the menstrual phase and the luteal phase. Results are expressed as mean SEM. Statistical analysis was performed by using t tests and analysis of variance. A P value of.05 was considered to be statistically significant. Statistical analysis was performed by using the prism3 software (GraphPad, San Diego, CA). RESULTS Menstrual Phase versus Luteal Phase In women with endometriosis, both the endometrial mrna expression of IL-8, TNF-, and MMP-3 (Fig. 1A, C, and F) 1670 Kyama et al. Cytokine mrna levels in women with endometriosis Vol. 85, No. 6, June 2006
5 FIGURE 1 Women with endometriosis: menstrual phase vs. luteal phase. Endometrial IL-8 (A), TNF- (C), and MMP-3 (F) mrna expression and peritoneal TGF- (B), IL-6 (D), ICAM-1 (E), and MMP-3 (F) mrna expression were significantly higher during the menstrual phase when compared with the luteal phase. Intercellular adhesion molecule-1 mrna (E) and TGF- (B) levels were significantly lower in endometrium when compared with the peritoneum during the menstrual phase and the luteal phase, respectively. Red bars, endometrium; blue bars, peritoneum. *P.05. **P.01. and the peritoneal mrna expression of TGF-, IL-6, ICAM-1, and MMP-3 (Fig. 1B, D, E, and F) were significantly higher during the menstrual phase when compared with the luteal phase of the cycle. In women with endometriosis, the expression levels of ICAM-1 mrna and TGF- mrna also were significantly lower in endometrium than in peritoneum during the menstrual phase (Fig. 1E) and luteal phase (Fig. 1B), respectively. No significant differences were observed for MMP-1 and VEGF mrna in any of the above comparisons (data not shown). In women without endometriosis, peritoneal expression of ICAM-1 mrna was significantly higher during the menstrual phase when compared with the luteal phase (data not Fertility and Sterility 1671
6 shown). There were no significant differences observed for TNF-, IL-8, TGF-, IL-6, MMP-3, MMP-1, and VEGF mrna, either in endometrium or peritoneum, during the menstrual phase when compared with the luteal phase (data not shown). Women With Endometriosis versus Controls During the menstrual phase of the cycle, both endometrial expression of IL-8, TNF-, and MMP-3 mrna (Fig. 2A, C, and F) levels and peritoneal expression of IL-6, TGF-, and ICAM-1 (Figs. 2B, D, and E) mrna levels were significantly higher in women with endometriosis when compared with controls. No significant differences were observed for MMP-1 and VEGF mrna levels in any of the comparisons described (data not shown). During the luteal phase, increased peritoneal expression of MMP-3 and TNF- (Fig. 3B and C) mrna levels but decreased peritoneal expression of ICAM-1 mrna was FIGURE 2 Women with endometriosis vs. controls: menstrual phase. Increased endometrial mrna levels for IL-8 (A), TNF- (C), and MMP-3 (F) and increased peritoneal mrna levels of IL-6 (B), TGF- (D), and ICAM-1 (E) in women with endometriosis when compared with controls. Red bars, endometrium; blue bars, peritoneum. *P Kyama et al. Cytokine mrna levels in women with endometriosis Vol. 85, No. 6, June 2006
7 FIGURE 3 Women with endometriosis vs. controls: luteal phase. Increased peritoneal mrna levels for TNF- and MMP-3 (B, C) and decreased peritoneal mrna levels of ICAM-1 (A) in women with endometriosis when compared with controls. Red bars, endometrium; blue bars, peritoneum. *P.05, **P.01. observed in women with endometriosis when compared with controls (Fig. 3A). No significant differences were observed for TGF-, MMP-1, IL-6, IL-8, and VEGF mrna in any of the above comparisons (data not shown). Immunohistochemistry Immunohistochemical staining confirmed the presence of TNF- in peritoneum and endometrium (Fig. 4). Only a few positive cells were identified in peritoneum (Fig. 4A and B), whereas cell-specific staining was observed in some epithelial and stromal cells in endometrium (Fig. 4C and D). DISCUSSION Real-time RT-PCR has been used previously to quantify and compare mrna levels of estrogen receptor alpha (ER- ) and estrogen receptor beta (ER- ) in ovarian endometriotic cysts and in certain endometriotic lesions (23, 24). However, to the best of our knowledge, we have used for the first time real-time RT-PCR technology to evaluate differential gene expression of cytokines and growth factors in endometrium and peritoneum from women with and without endometriosis during the menstrual and luteal phases. The data from our study suggest for the first time that menstrual endometrium from women with endometriosis has more pronounced inflammatory and proteolytic properties than that of women without the disease. In women with endometriosis, the endometrial mrna expressions of TNF-, IL-8, and MMP-3 were significantly higher during the menstrual phase compared with the luteal phase, whereas such a difference was not present in women without endometriosis. Furthermore, endometrial mrna expression of TNF-, IL-8, and MMP-3 was significantly higher in women with endometriosis when compared with the case in women without endometriosis during the menstrual phase. In contrast, there were no significant differences between the two groups in the luteal phase. Therefore, we hypothesize that only menstrual endometrium expressing increased levels of in- Fertility and Sterility 1673
8 FIGURE 4 Immunohistochemical staining for TNF- showing cell-specific staining in normal peritoneum from a patient without endometriosis (A) and with endometriosis (B) and in both epithelial (C) and stromal (D) compartments of luteal phase endometrium from two different women with moderate to severe endometriosis. Arrowheads show positive staining of TNF-. All bars 50 m. flammatory cytokines and MMPs like TNF-, IL-8, and MMP-3 is capable of implanting ectopically and of leading to the development of endometriosis. We also hypothesize that the natural progression and the stage of endometriosis could be predicted by the levels of expression of inflammatory cytokines and MMPs in menstrual endometrium. Our hypothesis appears to be biologically plausible. Cytokines such as IL-8 and TNF- are known to promote proliferation and adhesion of endometrial cells and angiogenesis. Tumor necrosis factor modulates the stimulation of other cytokines and chemokines such as IL-8 and Regulated upon Activation, Normal T-Cell Expressed and Secreted (25). The increased mrna levels of TNF- also may contribute to increased MMP-3 mrna expression. Indeed, the increased mrna levels of MMP-3 in menstrual endometrium from women with endometriosis observed in our study may explain the increased invasiveness of endometrial fragments in women with endometriosis (26, 27). To the best of our knowledge, our study is the first report illustrating that normal peritoneum is immunologically more active during the menstrual phase than during the luteal phase and that normal peritoneum is biologically different in women with endometriosis when compared with that of controls during both the menstrual and the luteal phases. During the menstrual phase, peritoneal expression of ICAM-1, TGF-, and IL-6 mrna was up-regulated in women with endometriosis when compared with controls. Furthermore, during the luteal phase, peritoneal expression of TNF- and MMP-3 mrna was up-regulated, and ICAM-1 mrna was down-regulated, in women with dis Kyama et al. Cytokine mrna levels in women with endometriosis Vol. 85, No. 6, June 2006
9 ease when compared with controls. These observations may be very relevant with respect to the pathogenesis of endometriosis, and important roles may be played by TGF-, ICAM-1, and IL-6. Our results suggest that the peritoneal production of TGF- may contribute to the reportedly increased levels of TGF- in PF of women with endometriosis when compared with controls (18). Intercellular adhesion molecule-1 is expressed at the surface of numerous cells, including endometrial cells, endothelial cells, and leukocytes (28), and could be involved in endometrial peritoneal adhesion and in the protection of endometrial cells from natural-killer cell mediated cytotoxicity (19, 29). Interleukin-6 also may be involved in this process because IL-6 can be secreted by endometriotic cells and, in concert with interferon-, may up-regulate sicam-1 production of macrophages from patients with endometriosis (30). We hypothesize that the upregulation of IL-6 gene expression in the peritoneum of women with endometriosis also may promote increased production of sicam-1 by endometriotic lesions. In conclusion, increased endometrial and peritoneal cytokine mrna expression during menstruation in patients with endometriosis may contribute to a pelvic inflammatory microenvironment that favors endometrial peritoneal adhesion and leads to the development of endometriosis. REFERENCES 1. Taylor RN, Lundeen SG, Giudice LC. Emerging role of genomics in endometriosis research. Fertil Steril 2002;78: D Hooghe TM, Hill JA. Endometriosis. In: Berek JS, ed. Novak s gynecology. 13th ed. Philadelphia, PA: Williams and Wilkins, 2002: Sampson JA. Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the pelvic cavity. Am J Obstet Gynecol 1927;14: D Hooghe TM, Bambra CS, Raeymaekers BM, Koninckx PR. Increased incidence and recurrence of retrograde menstruation in baboons with spontaneous endometriosis. Hum Reprod 1996;11: Blumenkrantz MJ, Gallaagher N, Bashore RA, Tenckhoff H. Retrograde menstruation in women undergoing chronic peritoneal dialysis. Obstet Gynecol 1981;142: Koninckx PR, De Moor P, Brosens IA. Diagnosis of the luteinized unruptured follicle syndrome by steroid hormone assays on peritoneal fluid. Br J Obstet Gynaecol 1980;87: Kruitwagen RF, Poels LG, Willemsen WN, de Ronde IJ, Jap PH, Rolland R. Endometrial epithelial cells in peritoneal fluid during the early follicular phase. Fertil Steril 1991;55: Rana N, Braun DP, House R, Gebel H, Rotman C, Dmowski WP. Basal and stimulated secretion of cytokines by peritoneal macrophages in women with endometriosis. Fertil Steril 1996;65: Harada T, Enatsu A, Mitsunari M, Nagano Y, Ito M, Tsudo T, et al. Role of cytokines in progression of endometriosis. Gynecol Obstet Invest Suppl 1999;47: Halme J, Becker S, Hammond MG, Raj S. Pelvic macrophages in normal and infertile women: the role of patent tubes. Am J Obstet Gynecol 1982;142: Oral E, Olive DL, Arici A. The peritoneal environment in endometriosis. Hum Reprod Update 1997;2: Iwabe T, Harada T, Tsudo T, Nagano Y, Yoshida S, Tanikawa M, et al. Tumor necrosis factor-alpha promotes proliferation of endometriotic stromal cells by inducing interleukin-8 gene and protein expression. J Clin Endocrinol Metab 2000;85: Witz CA, Monotoya-Rodriguez IA, Schenken RS. Whole explants of peritoneum and endometrium: a novel model of the early endometriosis lesion. Fertil Steril 1999;71: Debrock S, Vander Perre S, Meuleman C, Moerman P, Hill JA, D Hooghe TM. In-vitro adhesion of endometrium to autologous peritoneal membranes: effect of the cycle phase and the stage of endometriosis. Hum Reprod 2002;17: Sillem M, Prifti S, Monga B, Arslic T, Runnebaum B. Integrin-mediated adhesion of uterine endometrial cells from endometriosis patients to extracellular matrix proteins is enhanced by tumor necrosis factor alpha (TNF alpha) and interleukin-1 (IL-1). Eur J Obstet Gynecol Reprod Biol 1999; 87: Bullimore DW. Endometriosis is sustained by tumour necrosis factoralpha. Med Hypotheses 2003;60: Gottschalk C, Malberg K, Arndt M, Schmitt J, Roessner A, Schultze D, et al. Matrix metalloproteinases and TACE play a role in the pathogenesis of endometriosis. Adv Exp Med Biol 2000;477: Oosterlynck DJ, Meuleman C, Waer M, Koninckx PR. Transforming growth factor-beta activity is increased in peritoneal fluid from women with endometriosis. Obstet Gynecol 1994;83: Somigliana E, Vigano P, Gaffuri B, Guarneri D, Busacca M, Vignali M. Human endometrial stromal cells as a source of soluble intercellular adhesion molecule (ICAM)-1 molecules. Hum Reprod 1996; 11: D Hooghe TM, Bambra CS, Raeymaekers BM, De Jonge I, Lauweryns JM, Koninckx PR. Intrapelvic injection of menstrual endometrium causes endometriosis in baboons (Papio cynocephalus, Papio anubis). Am J Obstet Gynecol 1995;173: American Society for Reproductive Medicine. Revised American Society for Reproductive Medicine classification of endometriosis: Fertil Steril 1997;67: Overbergh L, Giulietti A, Valckx D, Decallonne R, Bouillon R, Mathieu C. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. J Biomol Tech 2003;14: Matsuzaki S, Murakami T, Uehara S, Canis M, Sasano H, Okamura K. Expression of estrogen receptor alpha and beta in peritoneal and ovarian endometriosis. Fertil Steril 2001;75: Matsuzaki S, Uehara S, Murakami T, Fujiwara J, Funato T, Okamura K. Quantitative analysis of estrogen receptor alpha and beta messenger ribonucleic acid levels in normal endometrium and ovarian endometriotic cysts using a real-time reverse transcription-polymerase chain reaction assay. Fertil Steril 2000;74: Altman GB, Gown AM, Luchtel DL, Baker C. RANTES production by cultured primate endometrial epithelial cells. Am J Reprod Immunol 1999;42: Sillem M, Prifti S, Koch A, Neher M, Jauckus J, Runnebaum B. Regulation of matrix metalloproteinases and their inhibitors in uterine endometrial cells of patients with and without endometriosis. Eur J Obstet Gynecol Reprod Biol 2001;95: Osteen KG, Bruner-Tran KL, Keller NR, Eisenberg E. Progesteronemediated endometrial maturation limits matrix metalloproteinase (MMP) expression in an inflammatory-like environment: a regulatory system altered in endometriosis. Ann NY Acad Sci 2002;955: Steff AM, Gagne D, Page M, Hugo P, Gosselin D. Concentration of soluble intercellular adhesion molecule-1 in serum samples from patients with endometriosis collected during the luteal phase of the menstrual cycle. Hum Reprod 2004;19: Vigano P, Gaffuri B, Somigliana E, Busacca M, Di Blasio AM, Vignali M. Expression of intercellular adhesion molecule (ICAM)-1 mrna and protein is enhanced in endometriosis versus endometrial stromal cells in culture. Mol Hum Reprod 1998;4: Fukaya T, Sugawara J, Yoshida H, Murakami T, Yajima A. Intercellular adhesion molecule-1 and hepatocyte growth factor in human endometriosis: original investigation and a review of literature. Gynecol Obstet Invest 1999;47:11 6. Fertility and Sterility 1675
Vascular endothelial growth factor and matrix metalloproteinase-2 expedite formation of endometriosis in the early stage ICR mouse model
Vascular endothelial growth factor and matrix metalloproteinase-2 expedite formation of endometriosis in the early stage ICR mouse model Xiu-E Lu, M.D., Wei-Xuan Ning, M.D., Min-Yue Dong, M.D., Ai-Xia
More informationVascular endothelial growth factor (VEGF) in endometriosis
Human Reproduction vol.13 no.6 pp.1686 1690, 1998 Vascular endothelial growth factor (VEGF) in endometriosis Jacques Donnez 1, Pierre Smoes, Stéphane Gillerot, Françoise Casanas-Roux and Michelle Nisolle
More informationExpression of estrogen receptor alpha and beta in peritoneal and ovarian endometriosis
FERTILITY AND STERILITY VOL. 75, NO. 6, JUNE 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Expression of estrogen
More informationStem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD
Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna
More informationMatrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1: a possible role in the pathogenesis of endometriosis
Human Reproduction Vol.17, No.2 pp. 284 288, 2002 Matrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1: a possible role in the pathogenesis of endometriosis J.Szamatowicz 1,3,
More informationDeeply infiltrating pelvic endometriosis: histology and clinical significance
FERTILITY AND STERILITY Copyright 1990 The American Fertility Society Printed an acid-free paper in U.S.A. Deeply infiltrating pelvic endometriosis: histology and clinical significance Freddy J. Cornillie,
More informationEndometrio ed endometriosi: the same tissue?
Endometrio ed endometriosi: the same tissue? Valentino Remorgida Clinica Ostetrica e Ginecologica IRCCS Azienda Ospedaliera Universitaria San Martino IST Istituto Nazionale per la Ricerca sul Cancro, Università
More informationResearch Article Investigation of Tenascin Expression in Endometriosis
International Scholarly Research Network ISRN Pathology Volume 2012, Article ID 873759, 5 pages doi:10.5402/2012/873759 Research Article Investigation of Tenascin Expression in Endometriosis Zehra Sema
More informationThe effect of endometriosis, cycle stage, lymphocyte suppression and pregnancy on CA-125 levels in peritoneal fluid and serum in baboons
Human Reproduction Vol.20, No.11 pp. 3033 3038, 2005 Advance Access publication July 21, 2005. doi:10.1093/humrep/dei181 The effect of metriosis, cycle, lymphocyte suppression and pregnancy on CA-125 levels
More informationnovel in vitro model to study endometriosis
FERTILITY AND STERILITY VOL. 79, SUPPL 1, MARCH 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Adhesion of endometrial
More informationEndometrial tissue in peritoneal fluid
FERTILITY AND STERILITY Copyright c 1986 The American Fertility Society Printed in UBA. Endometrial tissue in peritoneal fluid Delphine Bartosik, M.D. *t Samuel L. Jacobs, M.D.* Lynda J. Kelly, C.T.:J:
More informationThe natural killer activity of peritoneal fluid lymphocytes is decreased in women with endometriosis*
FERTILITY AND STERILITY Copyright 1992 The American Fertility Society Printed on ocid-free paper in U.S.A. The natural killer activity of peritoneal fluid lymphocytes is decreased in women with endometriosis*
More informationme LUTEINIZED UNRUPTURED FOLLICLE SYNDROME AND ENDOMETRIOSIS
FERTILITY AND STERILITY Copyright c 980 The American Fertility Society Vol. 33,, JanuaEY 980 Printed in U.S.A. me LUTEINIZED UNRUPTURED FOLLICLE SYNDROME AND ENDOMETRIOSIS W. PAULDMOWSKI, M.D.,.PH.D.*
More informationArticle Effect of ovarian involvement on peritoneal fluid cytokine concentrations in endometriosis patients
RBMOnline - Vol 14. No 5. 2007 620-625 Reproductive BioMedicine Online; www.rbmonline.com/article/2742 on web 19 March 2007 Article Effect of ovarian involvement on peritoneal fluid cytokine concentrations
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSurgical Management of Endometriosis associated Infertility
Surgical Management of Endometriosis associated Infertility Dr. Ingrid Lok Specialist in Obstetrics and Gynaecology (Honorary Clinical Associate Professor, CUHK) HA commission training 24.2.2014 Endometriosis
More informationEndometriosis is a complex disease characterized
MINERVA GINECOL 2006;58:527-51 Serum and peritoneal abnormalities in endometriosis: potential use as diagnostic markers S. GUPTA 1, 2, A. AGARWAL 1, 2, L. SEKHON 1, 2, N. KRAJCIR 1, 2, M. COCUZZA 1, 2,
More informationTohoku University School of Medicine, Sendai, Japan
FERTILITY AND STERILITY VOL. 74, NO. 4, OCTOBER 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. REPRODUCTIVE BIOLOGY
More informationChapter 3 Theories on Endometriosis
Chapter 3 Theories on Endometriosis Sajal Gupta, Avi Harlev, Ashok Agarwal, and Elizabeth Pandithurai 3.1 Sampson s Theory There are several theories as to how endometriosis develops, but the most widely
More informationPre and post surgical medical therapy. Mauro Busacca M.D. Dept of Obstetrics and Gynecology University of Milan- Italy
Pre and post surgical medical therapy Mauro Busacca M.D. Dept of Obstetrics and Gynecology University of Milan- Italy introduction A disease is an open problem when two conditions are nor satisfied: The
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationDecreased Expression of Angiogenin in the Eutopic Endometrium from Women with Advanced Stage Endometriosis
J Korean Med Sci 2008; 23: 802-7 ISSN 1011-8934 DOI: 10.3346/jkms.2008.23.5.802 Copyright The Korean Academy of Medical Sciences Decreased Expression of Angiogenin in the Eutopic Endometrium from Women
More informationMedical Management of Endometriosis: Novel Targets and Future Treatments Erkut Attar, M.D. PhD.
Medical Management of Endometriosis: Novel Targets and Future Treatments Erkut Attar, M.D. PhD. Istanbul University Istanbul Medical School Department of Obstetrics & Gynecology Division of Reproductive
More informationInduction of endometriosis in the mouse inhibits spleen leukocyte function
Acta Obstet Gynecol Scand 2001; 80: 200 205 Copyright C Acta Obstet Gynecol Scand 2001 Printed in Denmark All rights reserved Acta Obstetricia et Gynecologica Scandinavica ISSN 0001-6349 ORIGINAL ARTICLE
More informationTreatment with anti-tnf monoclonal antibody (c5n) reduces the extent of induced endometriosis in the baboon
Human Reproduction Vol.21, No.7 pp. 1856 1862, 26 Advance Access publication March 3, 26. doi:1.193/humrep/del44 Treatment with anti-tnf monoclonal antibody (c5n) reduces the extent of induced endometriosis
More informationDrug-induced apoptosis was markedly attenuated in endometriotic stromal cells
Human Reproduction Page 1 of 5 Hum. Reprod. Advance Access published October 27, 2005 doi:10.1093/humrep/dei372 Drug-induced apoptosis was markedly attenuated in endometriotic stromal cells Masao Izawa
More information: 0 0: 770 years yeas of history stoy
Siena, Piazza del Campo 1240-2010: 0 0: 770 years yeas of history stoy Siena, Policlinico Universitario Santa Maria alle Scotte Endometriosis: symptoms Infertility Pain Endometriosis and infertility: possible
More informationComparative immunohistochemical studies of endometriosis lesions and endometriotic cysts
FERTILITY AND STERILITY VOL. 78, NO. 4, OCTOBER 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Comparative immunohistochemical
More informationEndometriosis and oxidative stress?
Endometriosis and oxidative stress? Pietro Santulli MD, PhD Université Paris Descartes, Sorbonne Paris Cité, Faculté de médecine, AP-HP, Cochin Saint Vincent de Paul, Department of Gynecology Obstetrics
More informationPeritoneal fluid concentrations of interleukin-8 in women with endometriosis: relationship to stage of disease
Human Reproduction vol.13 no.7 pp.1957 1961, 1998 Peritoneal fluid concentrations of interleukin-8 in women with endometriosis: relationship to stage of disease M.Rafet Gazvani 1,3, Stephen Christmas 2,
More informationPrediction of endometriosis with serum and peritoneal fluid markers: a prospective controlled trial
Human Reproduction Vol.17, No.2 pp. 426 431, 2002 Prediction of endometriosis with serum and peritoneal fluid markers: a prospective controlled trial M.A.Bedaiwy 1,2,3, T.Falcone 1,2,3,6, R.K.Sharma 1,3,4,
More informationThe macrophage stimulating protein/ron system: a potential novel target for prevention and treatment of endometriosis
Molecular Human Reproduction Vol., No.5 pp. 5 9, 5 Advance Access publication March, 5 doi:.9/molehr/gah6 The macrophage stimulating protein/ron system: a potential novel target for prevention and treatment
More informationPathological evaluation of the rat endometriosis model. Tochigi Institute of Clinical Pathology, Tochigi, Japan
REPRODUCTIVE BIOLOGY FERTILITY AND STERILITY VOL. 78, NO. 4, OCTOBER 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A.
More informationThe Egyptian Journal of Hospital Medicine (April 2013) Vol. 51, Page
The Egyptian Journal of Hospital Medicine (April 2013) Vol. 51, Page 306 316 Diagnostic Validity of erum and -alpha, high sensitivity CRP and Plasma Cell-Free Nuclear DNA (ccf ndna) as Biomarkers of Pelvic
More informationDefinition Endometriosis is the presence of functioning endometrial tissue outside the cavity of the uterus.
Dept. of Obstetrics t and Gynecology Faculty of Medicine University of Sumatera Utara Endometriosis Definition Endometriosis is the presence of functioning endometrial tissue outside the cavity of the
More informationIs the endometriosis recurrence rate increased after ovarian hyperstimulation?
Is the endometriosis recurrence rate increased after ovarian hyperstimulation? Thomas M. D Hooghe, M.D., Ph.D., Bénédicte Denys, M.D., Carl Spiessens, Ph.D., Christel Meuleman, M.D., and Sophie Debrock,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationThe Correlation between Serum and Peritoneal Fluid CA125 Level in Women with Pelvic Endometriosis
Original Article The Correlation between Serum and Peritoneal Fluid CA125 Level in Women with Pelvic Saghar Salehpour, M.D.* 1, Azadeh Akbari Sene, M.D. 1, Ebrahim Kalantarian Mehrjerdi, Ph.D., M.T. 2,
More informationEkaterina Miltiadovna Aleksanova and Victor Alekseevich Aksenenko. Stavropol State Medical University, Mira street, 310, Stavropol, , Russia
World Journal of Medical Sciences 10 (3): 326-331, 2014 ISSN 1817-3055 IDOSI Publications, 2014 DOI: 10.582/idosi.wjms.2014.10.3.1141 The Peculiarities of Local Immunity, the Level of Cytokines and Growth
More informationEndometriosis is an enigmatic disease of unknown origin.
The Depolarized Expression of the Alpha-6 Integrin Subunit in the Endometria of Women With Endometriosis María del Mar Vernet-Tomás, MD, PhD, Carlos Tomás Pérez-Ares, MD, PhD, Núria Verdú, MD, María Teresa
More informationWhat is the Pathogenesis of Endometriosis?
Endometriosis Epigenetics and Stem Cells Hugh S. Taylor, MD Director of Reproductive Endocrinology and Infertility Yale University School of dicine What is the Pathogenesis of Endometriosis? Theories for
More informationEDITOR S CORNER. Altered gene expression and secretion of interleukin-6 in stromal cells derived from endometriotic tissues
FERTILITY AND STERILITY VOL. 73, NO. 2, FEBRUARY 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. EDITOR S CORNER Altered
More informationResults of implication of aromatase inhibitors in therapy of genital endometriosis Yarmolinskaya M. (Speaker), Bezhenar V., Molotkov A.
Results of implication of aromatase inhibitors in therapy of genital endometriosis Yarmolinskaya M. (Speaker), Bezhenar V., Molotkov A. Ott's Research Institute of Obstetrics, Gynecology and Reproductology,
More informationEarly-stage endometriosis: adhesion and growth of human menstrual endometrium in nude mice
FERTILITY AND STERILITY VOL. 74, NO. 2, AUGUST 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Early-stage endometriosis:
More informationLaboratory of Tumor and Development Biology, University of Liège, Liège, Belgium
ENDOMETRIOSIS FERTILITY AND STERILITY VOL. 82, NO. 1, JULY 2004 Copyright 2004 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. Reduction of apoptosis
More informationEndometriosis. *Chocolate cyst in the ovary
Endometriosis What is endometriosis? Endometriosis is a common condition in young women. It's chronic, painful, and it often progressively gets worse over the time. *Chocolate cyst in the ovary Normally,
More informationLH (Rodent) ELISA Kit
LH (Rodent) ELISA Kit Catalog Number KA2332 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationExpression of interleukin-10 in patients with adenomyosis
Expression of interleukin-10 in patients with adenomyosis Fei Wang, M.D., Ph.D., Hui Li, Ph.D., Zhongli Yang, M.D., Xuelian Du, M.D., Ph.D., Min Cui, M.D., Ph.D., and Zeqing Wen, M.D. Department of Obstetrics
More informationJoin us to stay tuned!
Join us to stay tuned! The World Endometriosis Society is a non profit society registered in Canada with a mission to foster research and promote the exchange of information, through: Professor Rodolphe
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationInflammatory changes of the endometrium in patients with minimal-to-moderate endometriosis*t
FERTILITY AND STERILITY Vol. 62, No.5, November 1994 Copyright e 1994 The American Fertility Society Printed on acid.. free paper in U. S. A Inflammatory changes of the endometrium in patients with minimal-to-moderate
More informationImmunohistochemical detection of type I, III, and IV collagen in endometriosis implants*t
FERTILITY AND STERILITY Vol. 57, No.5, May 1992 Copyright 1992 The American Fertility Society Printed on acid-free paper in U.S.A. Immunohistochemical detection of type I, III, and IV collagen in endometriosis
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationFDG-PET value in deep endometriosis
Gynecol Surg (2011) 8:305 309 DOI 10.1007/s10397-010-0652-6 ORIGINAL ARTICLE FDG-PET value in deep endometriosis A. Setubal & S. Maia & C. Lowenthal & Z. Sidiropoulou Received: 3 December 2010 / Accepted:
More informationEffects of hormones on upa, PAI-1 and supar from cultured endometrial and ovarian endometriotic stromal cells
Acta Obstet Gynecol Scand 2002: 81: 389 397 Copyright C Acta Obstet Gynecol Scand 2002 Printed in Denmark. All rights reserved Acta Obstetricia et Gynecologica Scandinavica ISSN 0001-6349 ORIGINAL ARTICLE
More informationABSTRACT. Key words: ovulation, ovary, human, follicle, collagen, MMP and TIMP. ISBN-10: ISBN-13:
HUMAN OVULATION Studies on collagens, gelatinases and tissue inhibitors of metalloproteinases Anna Karin Lind Department of Obstetrics and Gynecology Institute of Clinical Sciences Sahlgrenska University
More informationFuture of endometriosis research
For reprint orders, please contact: reprints@futuremedicine.com PERSPECTIVE Future of endometriosis research Peter Simsa 1,3, Attila Mihalyi 1, Cleophas M Kyama 1,2, Jason M Mwenda 2, Vilmos Fülöp 3 &
More informationClinical evaluation of endometriosis and differential response to surgical therapy with and without application of Oxiplex/AP* adhesion barrier gel
ENDOMETRIOSIS Clinical evaluation of endometriosis and differential response to surgical therapy with and without application of Oxiplex/AP* adhesion barrier gel Gere S. dizerega, M.D., a James Coad, M.D.,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: van Seters M, van Beurden M, ten Kate FJW, et al. Treatment
More informationSee external label 2 C 8 C 96 tests B-HCG (Total) Cat #
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationFSH (Rodent) ELISA Kit
FSH (Rodent) ELISA Kit Catalog Number KA2330 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationThe diagnostic role of cervico-vaginal fluid interleukins-1α in endometriosis: A case-control study
Original Article The diagnostic role of cervico-vaginal fluid interleukins-1α in endometriosis: A case-control study Farahnaz Mardanian, Zahra Sheikh-Soleimani Department of Obstetrics and Gynecology,
More informationIntroduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats
Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationInterleukin 1a and tissue-lytic matrix metalloproteinase-1 are elevated in ectopic endometrium of patients with endometriosis
Human Reproduction Vol.20, No.6 pp. 1695 1701, 2005 Advance Access publication March 3, 2005 doi:10.1093/humrep/deh794 Interleukin 1a and tissue-lytic matrix metalloproteinase-1 are elevated in ectopic
More informationManaging infertility when adenomyosis and endometriosis co-exist
Managing infertility when adenomyosis and endometriosis co-exist Jinhua Leng Beijing,China Endometriosis Endometriosis (EM) is a common, benign, ovary hormone-dependent gynecologic disorder which affects
More informationMANAGEMENT OF REFRACTORY ENDOMETRIOSIS
(339) MANAGEMENT OF REFRACTORY ENDOMETRIOSIS Serdar Bulun, MD JJ Sciarra Professor and Chair Department of Ob/Gyn Northwestern University ENDOMETRIOSIS OCs Teenager: severe dysmenorrhea often starting
More informationThe Soil Test for Your Endometrium : the Endometrial Function Test (EFT )
The Soil Test for Your Endometrium : the Endometrial Function Test (EFT ) Harvey J. Kliman, MD, PhD Yale University School of Medicine A healthy pregnancy is like a successful garden. The successful garden
More informationENDOMETRIOSIS: ROLE OF OVARIAN STEROIDS IN INITIATION, MAINTENANCE, AND SUPPRESSION
FERTILITY AND STERILITY Copyright e 1980 The American Fertility Society Vol. 33, No.6, June 1980 Printed in U.SA. ENDOMETRIOSIS: ROLE OF OVARIAN STEROIDS IN INITIATION, MAINTENANCE, AND SUPPRESSION GERE
More informationCancer cells in vitro
Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par
More informationTheFormationofaScoringSystemtoDiagnoseEndometriosis. The Formation of a Scoring System to Diagnose Endometriosis
Global Journal of Medical Research: E Gynecology and Obstetrics Volume 18 Issue 1 Version 1.0 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Online ISSN: 49-4618
More informationNeutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury
Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to
More informationStage 4 - Ovarian Cancer Symptoms
WELCOME Stage 4 - Ovarian Cancer Symptoms University of Baghdad College of Nursing Department of Basic Medical Sciences Overview of Anatomy and Physioloy II Second Year Students Asaad Ismail Ahmad,
More informationImpact of Ovarian Endometrioma Per Se and Surgery on Ovarian Reserve and Pregnancy Rate in in Vitro Fertilization Cycles
1 st SEUD Meeting, 9 May 2015, Paris, France Impact of Ovarian Endometrioma Per Se and Surgery on Ovarian Reserve and Pregnancy Rate in in Vitro Fertilization Cycles ENDOMETRIOSIS ovarian endometrioma
More informationInduction of Endometriosis by implantation of endometrial fragments in female rats
Iranian Journal of Reproductive Medicine Vol.4. No.2. pp:63-67, Nov 2006 Induction of Endometriosis by implantation of endometrial fragments in female rats Afsaneh Mohammadzadeh 1 M.D., Mahnaz Heidari
More informationExpression of interleukin-8 receptors in endometriosis
Hum. Reprod. Advance Access published December 23, 2004 Human Reproduction Page 1 of 8 doi:10.1093/humrep/deh675 Expression of interleukin-8 receptors in endometriosis Murat Ulukus 1,3, E.Cagnur Ulukus
More informationEpidemiology of endometriosis: is there an association with cancer? Endometriosis and Ovarian Cancer. Endometriosis Similarities to Cancer
Epidemiology of endometriosis: is there an association with cancer? Daniela Hornung, MD PhD Department of Obstetrics and Gynecology University of Schleswig-Holstein, Campus Lübeck ESHRE guidelines for
More informationDivision of Reproductive Endocrinology, Department of Obstetrics and Gynecology, College of Medicine, Seoul National University, Seoul, Korea
FERTILITY AND STERILITY VOL. 73, NO. 5, MAY 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Insulin-like growth factors
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationSmita Jain, M.B., M.S.* and Maureen E. Dalton, F.R.C.O.G. Sunderland Royal Hospital, Sunderland, Tyne and Wear, United Kingdom
ENDOMETRIOSIS FERTILITY AND STERILITY VOL. 72, NO. 5, NOVEMBER 1999 Copyright 1999 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Chocolate
More informationHormonal Control of Human Reproduction
Hormonal Control of Human Reproduction Bởi: OpenStaxCollege The human male and female reproductive cycles are controlled by the interaction of hormones from the hypothalamus and anterior pituitary with
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationIron overload in the peritoneal cavity of women with pelvic endometriosis
FERTILITY AND STERILITY VOL. 78, NO. 4, OCTOBER 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Iron overload in the
More informationSurgical treatment of endometriosis: location and patterns of disease at reoperation
Surgical treatment of endometriosis: location and patterns of disease at reoperation Elizabeth Taylor, M.D., and Christina Williams, M.D. Division of Reproductive Endocrinology and Infertility, Department
More informationADENOMYOSIS CHRONIC PELVIC PAIN IN WOMEN IMAGING CHRONIC PELVIC PAIN IN WOMEN CHRONIC PELVIC PAIN IN WOMEN ADENOMYOSIS: PATHOLOGY ADENOMYOSIS
CHRONIC PELVIC PAIN IN WOMEN IMAGING CHRONIC PELVIC PAIN IN WOMEN MOSTAFA ATRI, MD Dipl. Epid. UNIVERSITY OF TORONTO Non-menstrual pain of 6 months Prevalence 15%: 18-50 years of age 10-40% of gynecology
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) This manuscript presents an engineering system designed to culture and maintain living tissue from female reproductive organs. The modular capacity, reconfigurability,
More informationHistologic study of peritoneal endometriosis in infertile women
FERTILITY AND STERILITY Copyright" 1990 The American Fertility Society Printed on acid-free paper in U.S.A. Histologic study of peritoneal endometriosis in infertile women Michelle Nisolle, M.D. Benedicte
More informationDevelopment of an experimental model of endometriosis using mice that ubiquitously express green fluorescent protein
Human Reproduction Vol.20, No.8 pp. 2092 2096, 2005 Advance Access publication April 14, 2005 doi:10.1093/humrep/dei012 Development of an experimental model of endometriosis using mice that ubiquitously
More informationSALPINGITIS IN OVARIAN ENDOMETRIOSIS
FERTILITY AND STERILITY Copyright 1978 The American Fertility Society Vol. 30, No. 1, July 1978 Printed in U.S.A. SALPINGITIS IN OVARIAN ENDOMETRIOSIS BERNARD CZERNOBILSKY, M.D.*t ALAN SILVERSTEIN, M.D.
More informationPROLIFERATIVE ACTIVITIES OF ECTOPICAL ENDOMETRIAL CELLS IN PATIENTS WITH PRIMARY AND RECURRENT ENDOMETRIOMAS
Federal State Institute «Rostov-on-Don Scientific Research Institute of Obstetrics and Pediatrics», Rostov State Medical University PROLIFERATIVE ACTIVITIES OF ECTOPICAL ENDOMETRIAL CELLS IN PATIENTS WITH
More informationovarian hyperstimulation (COH) and intrauterine
No difference in cycle pregnancy rate and in cumulative live-birth rate between women with surgically treated minimal to mild and women with unexplained infertility after controlled ovarian hyperstimulation
More informationAltered expression of a cell-cycle suppressor gene, Tob-1, in endometriotic cells by cdna array analyses
FERTILITY AND STERILITY VOL. 78, NO. 4, OCTOBER 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Altered expression
More information(BMI)=18.0~24.9 kg/m 2 ;
33 10 Vol.33 No.10 2013 10 Oct. 2013 Reproduction & Contraception doi: 10.7669/j.issn.0253-357X.2013.10.0672 E-mail: randc_journal@163.com - ( 400013) : () GnRH-a - () : IVF- ET 233 A (I~II 102 ) B (III~IV
More informationWT1, Estrogen Receptor, and Progesterone Receptor as Markers for Breast or Ovarian Primary Sites in Metastatic Adenocarcinoma to Body Fluids
Anatomic Pathology / WT1, ESTROGEN RECEPTOR, AND PROGESTERONE RECEPTOR IN CYTOLOGY OF BODY FLUIDS WT1, Estrogen Receptor, and Progesterone Receptor as Markers for Breast or Ovarian Primary Sites in Metastatic
More informationReduction of apoptosis and proliferation in endometriosis
Reduction of apoptosis and proliferation in endometriosis Aude Béliard, M.D., Ph.D., Agnès Noël, Ph.D., and Jean-Michel Foidart, M.D., Ph.D. Laboratory of Tumor and Development Biology, University of Liège,
More informationThe Use of GnRH Agonists in the Treatment of Endometriomas With or Without Drainage
The Use of GnRH Agonists in the Treatment of Endometriomas With or Without Drainage Pages with reference to book, From 30 To 32 Sertac Batioglu, Havva Celikkanat, Mustafa Ugur, Leyla Mollamahmutoglu, Huseyin
More informationR. Scott Lucidi, M.D., Craig A. Witz, M.D., Michelle Chrisco, M.S., Peter A. Binkley, M.S., Sydney A. Shain, Ph.D., and Robert S. Schenken, M.D.
A novel in vitro model of the early endometriotic lesion demonstrates that attachment of endometrial cells to mesothelial cells is dependent on the source of endometrial cells R. Scott Lucidi, M.D., Craig
More informationInterleukin 1, interleukin-6, and tumor necrosis factor- in endometriotic tissue and in endometrium
FERTILITY AND STERILITY VOL. 75, NO. 3, MARCH 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Interleukin 1, interleukin-6,
More informationSayako Horie, M.D., Tasuku Harada, M.D., Masahiro Mitsunari, M.D., Fuminori Taniguchi, M.D., Tomio Iwabe, M.D., and Naoki Terakawa, M.D.
Progesterone and progestational compounds attenuate tumor necrosis factor alpha induced interleukin-8 production via nuclear factor kappab inactivation in endometriotic stromal cells Sayako Horie, M.D.,
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More information