Polymerase Chain Reaction for Detection of Mycoplasma genitalium

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1991, p /91/ $02.00/0 Copyright X) 1991, American Society for Microbiology Vol. 29, No. 1 Polymerase Chain Reaction for Detection of Mycoplasma genitalium in Clinical Samples J. SKOV JENSEN,'* S. A. ULDUM,1 J. S0NDERGARD-ANDERSEN,1 JENS VUUST,2 AND KLAUS LIND' Mycoplasma Laboratory' and Department of Treponematoses,2 Statens Seruminstitut, Artillerivej 5, DK-2300 Copenhagen S, Denmark Received 4 June 1990/Accepted 8 October 1990 We have used the polymerase chain reaction to detect Mycoplasma genitalium in artificially seeded human throat swab samples as well as in clinical material. On the basis of the published nucleotide sequence of the M. genitalium 140-kDa adhesin gene, primers were chosen to produce an amplified fragment of 281 bp. Five different previously isolated strains, including the type strain of M. genitalium, could all be detected by the polymerase chain reaction, and DNAs from other mycoplasmal and bacterial species yielded negative results. The detection limits were estimated to be approximately 50 organisms by inspection of ethidium bromidestained agarose gels and 4 organisms when a biotinylated oligonucleotide probe was used in filter hybridization. The amplified DNA fragments were subjected to restriction enzyme analysis. DNAs from the five different isolates all possessed EcoRI, SspI, AluI, Sau3AI, and DdeI restriction sites, as predicted from the published sequence. A total of 150 urogenital swabs collected from 100 patients for culturing of Chiamydia trachomatis were tested for the presence of M. genitalium DNA. Ten samples from eight patients were found positive. The amplified DNA fragments from all of our clinical samples possessed the AluI, Sau3AI, and DdeI restriction sites, but three samples from two patients did not contain the SspI site and none of the samples contained the EcoRI site. In 1980, a new mycoplasma species distinct from all other known mycoplasmas was isolated from urethral specimens from two men with nongonococcal urethritis (12, 13). Because of its derivation, it was named Mycoplasma genitalium (13). This mycoplasma has several properties in common with the well-known human respiratory pathogen M. pneumoniae. Both species share traits of pathogenic mycoplasmas, and both possess a terminal tip structure and the capability to adhere to erythrocytes, various tissue cells, glass, and plastic surfaces. Furthermore, M. genitalium and M. pneumoniae share antigens, giving rise to extensive cross-reactions in most serological tests (5). Although M. genitalium was originally isolated from urogenital tract specimens, no other isolates have been reported from this site. A serological indication that M. genitalium could be involved in pelvic inflammatory disease has been controversial (4, 7). Despite experimental data indicating that M. genitalium could induce genital tract infections in nonhuman primates (11), direct evidence linking M. genitalium to human urethritis is lacking. On the other hand, a DNA probe hybridization assay has indicated that M. genitalium might be present in urogenital specimens collected from as many as 60% of male homosexual patients with recurrent or persistent nongonococcal urethritis and in 22% of heterosexual men with recurrent urethritis, compared with 9% of men without urethritis (3). The recent observation that M. genitalium could be found in respiratory tract specimens from patients with pneumonia and isolated from a mixture with M. pneumoniae (1) has raised new, interesting questions as to the main tissue tropism and the possible pathogenicity of M. genitalium. This report describes the use of the polymerase chain reaction (PCR) (9) for the detection of M. genitalium DNA in * Corresponding author. 46 simulated positive specimens and demonstrates its use with clinical material. MATERIALS AND METHODS Organisms and growth conditions. M. genitalium G-37T and four M. genitalium isolates from the human respiratory tract, designated R 32 G, Tw 10-6 G, Tw 10-5 G, and Tw 48-5 G (kindly provided by J. G. Tully), were grown at 37 C in 150 ml of SP-4 medium (14) in 800-ml NUNCLON disposable polystyrene culture flasks (NUNC AIS, Roskilde, Denmark). Adherent mycoplasmas were harvested by centrifugation in the late log phase. The following species (strains) were grown in modified Hayflick's medium (5) and harvested by centrifugation in the late log phase: M. pneumoniae (FH, Mac, M129-B8, M129-B170, and five clinical isolates), M. hominis (PG21, H34, H27, and three clinical isolates), M. salivarium (PG 20), M. buccale (CH 20247), M. orale (Patt and one clinical isolate), M. fermentans (G, S38, and one clinical isolate), M. faucium (DC 333), M. primatum (Navel), M. pirum (HRC and one tissue culture isolate), M. arginini (G230), M. hyorhinis (BTS-7 and GDL), M. arthritidis (S16), M. pulmonis (PG 34), and Acholeplasma laidlawii (A). Ureaplasma urealyticum (serotypes I [F. Black 7] and VIII [F. Black 960]) was grown in U10C medium (8). In addition, the following bacteria, including some species shown to be related to the mollicutes, were investigated: Bacillus subtilis, Bacteroidesfragilis, Bacteroides melaninogenicus, Clostridium innocuum, Clostridium ramosum, Chlamydia trachomatis, Enterococcus faecalis, Erysipelothrix rhusiopathiae, Gardnerella vaginalis, Haemophilus influenzae, Klebsiella pneumoniae, Lactobacillus species, Peptostreptococcus anaerobius, Pseudomonas aeruginosa, Streptococcus agalactiae, Streptococcus cremoris, and Streptococcus pneumoniae. Clinical specimens. For the evaluation of sensitivity and specificity, throat swab samples from 20 healthy persons

2 VOL. 29, 1991 PCR FOR DETECTION OF M. GENITALIUM 47 TABLE 1. Sequences of oligonucleotide primers and probes Namea Sequence Use MgPa-1 5'AGTTGATGAAACCTTAACCCC7TGG3' Forward primer MgPa-2 5'GACCATCAAGGTATTTCTCAACAGC3' Probe or reverse primer MgPa-3 5'CCGTTGAGGGGTTTTCCATTTTTGC3' Reverse primer a MgPa-1 corresponds to the sequence of bases 179 to 206 of the coding strand of the gene coding for the 140-kDa adhesin of M. genitalium (2). complementary to bases 348 to 373 and MgPa-3 is complementary to bases 435 to 460 of the same sequence. MgPa-2 is were collected in 1.8 ml of 100 mm NaCi-10 mm Tris hydrochloride (ph 8.0)-i mm EDTA. Urogenital samples were randomly chosen from samples submitted for culturing of C. trachomatis. They were collected in 1.8 ml of a medium containing 0.2 M sucrose in 0.02 M phosphate buffer (ph 7.2), 10% heat-treated fetal calf serum, vancomycin (25 jig/mi), gentamicin (20,ug/ml), and amphotericin B (2.5,ug/ml). The samples were frozen at -80 C within 24 h and thawed within 1 week for culturing of C. trachomatis. The PCR analysis was performed on refrozen samples within 14 days. We have no clinical information about the patients. DNA extraction. Mycoplasma cells from 300 ml of culture were resuspended in 0.75 ml of phosphate-buffered saline, lysed by the addition of 30 jil of 25% sodium dodecyl sulfate (SDS), and incubated with 50 jig of RNase A (Boehringer GmbH, Mannheim, Federal Republic of Germany) for 30 min at 37 C. After the addition of EDTA (ph 8.0) (final concentration, 50 mm) and proteinase K (Boehringer) (final concentration, 50 jig/ml), the mixture was incubated for 45 min at 37 C. The preparation was made 1 M in sodium perchlorate by the addition of a 5 M solution and extracted three times with chloroform-isoamyl alcohol (24:1). The DNA was precipitated with ethanol and resuspended in 10 mm Tris hydrochloride (ph 8.0)-i mm EDTA. Synthesis of oligonucleotides. On the basis of the published nucleotide sequence of the M. genitalium 140-kDa adhesion protein gene (2), three 25-mer oligonucleotides were synthesized on a Biosearch 8750 DNA synthesizer: MgPa-1 was complementary to the coding strand, and MgPa-2 and MgPa-3 were complementary to the noncoding strand; thus, MgPa-2 could be used either as a probe or as a reverse primer (Table 1 and Fig. 1). The MgPa-2 oligonucleotide was labeled with Bio-11-dUTP and terminal deoxynucleotide transferase (terminal labeling kit from Enzo Diagnostics, Inc., New York, N.Y.) in accordance with the manufacturer's instructions, except that purification was not performed. Preparation of samples. Throat swab samples or urogenital samples (150 to 200 jil) were concentrated by centrifugation and subsequent resuspension in 50 jil of lysis buffer consisting of 1 x PCR buffer (50 mm KCl-10 mm Tris hydrochloride [ph 8.3] at 25 C-4.5 mm MgCl2-0.01% gelatin) containing 0.45% Nonidet P-40, 0.45% Tween 20, and 200 jig of proteinase K per ml. The samples were incubated at 55 C for 60 min, the proteinase was inactivated at 95 C for 10 min, and the tubes were centrifuged at 10,000 x g for 10 s. The simulated positive samples were prepared either by adding 10-fold dilutions of M. genitalium in SP4 broth (14) before centrifugation or by adding purified M. genitalium DNA after centrifugation. The stock suspension of M. genitalium cells from which the dilutions were prepared was filtered through a 0.45-jim-pore-size filter to yield single cells, and the dilutions were plated onto SP4 agar for counting of colonies. Amplification. The PCR was performed with thermostable Taq DNA polymerase (Amplitaq; Perkin Elmer Cetus, Norwalk, Conn.) in an automated DNA thermal cycler (PHC-1; Techne Ltd., Cambridge, United Kingdom). The 50-jil sample to be analyzed was adjusted to a total volume of 100 jil in lx PCR buffer containing final concentrations of 125 jim each datp, dctp, dttp, and dgtp; 0.2 jim each primer; and 1 U of Taq polymerase per 100 jil. Each sample was overlaid with 4 drops of mineral oil to prevent evaporation. Samples were denatured at 95 C for 1 min, and primers were annealed at 65 C for 1 min and extended at 72 C for 1 min. A total of 35 cycles were performed. In the 35th cycle, the extension time was increased to 6 min. Analysis of amplified samples. Amplified samples (20 jil) were analyzed on a composite agarose gel consisting of 1% SeaKem agarose and 2% NuSieve agarose (both from FMC, Rockland, Maine) in 0.5x Tris-borate-EDTA buffer (6) containing 5 jig of ethidium bromide per ml. The DNA was visualized by UV fluorescence. Samples (5 jil) containing a band of the expected size were subjected to digestion for 2 h at 37 C with 5 U of EcoRI, SspI, DdeI, AluI, or Sau3AI (Bethesda Research Laboratories, Gaithersburg, Md.) (Fig. 1), each in a final volume of 20 jil of 1 x buffer recommended by the supplier. As an internal control, a small amount of the 145-bp product amplified with primers MgPa-1 and MgPa-2 on M. genitalium G-37T was added to each of the samples before digestion. The restriction digests were analyzed by gel electrophoresis. Capillary transfer of DNA was carried out by the Southern method (10) on the genital samples for further verification by hybridization analysis. Nonradioactive hybridization. Following electrophoresis, the gel was soaked in a solution containing 0.4 M NaOH and 0.6 M NaCl for 30 min to denature the DNA. Capillary 179 Sau3A I 256 Ssp I Eco RI Alu I Dde I I I FIG. 1. Positions of primers for the M. genitalium PCR and cleavage sites for the restriction enzymes used. Numbers correspond to the base positions of the published sequence (2).

3 48 JENSEN ET AL. transfer to a modified nylon membrane (GeneScreen Plus; Du Pont) was performed overnight with the denaturing solution as a transfer buffer. Following transfer, the membrane was neutralized in 0.5 M Tris hydrochloride (ph 7.5)-1.0 M NaCl. Prehybridization (1 h) was carried out in 0.5 M sodium phosphate buffer (ph 7.2)-i mm EDTA-7% SDS at 52 C. Hybridization was conducted overnight at 52 C in the same mixture but containing 1.2 pmol of the biotinylated MgPa-2 oligonucleotide per ml. After hybridization, the filters were washed at 52 C four times in 0.04 M sodium phosphate (ph 7.2)-1% SDS (15 min each) and once in 0.02 M sodium phosphate-0.5% SDS (15 min). Detection of the hybridized probe was done after the membrane was washed for 5 min at room temperature in buffer 1(100 mm Tris hydrochloride [ph 7.5], 150 mm NaCl, 0.05% Tween 20) and blocked for 1 h at 37 C in buffer 1 plus 5% nonfat dry milk (buffer 2). After a short wash in buffer 1, the membrane was incubated with alkaline phosphataselabeled streptavidin (DAKO D 396; Dakopatts A/S, Glostrup, Denmark) diluted 1:1,000 in buffer 1 for 15 min at room temperature and washed twice in buffer 1 (15 min each) and once in buffer 3 (100 mm Tris hydrochloride [ph 9.5], 100 mm NaCl, 50 mm MgCl2) (10 min). Color was developed by incubating the membrane in buffer 3 containing 5-bromo-4- chloro-3-indolylphosphate (150 ng/ml) and Nitro Blue Tetrazolium (325 ng/ml) for 30 to 90 min in the dark. The color reaction was stopped by rinsing in distilled water, and the membrane was dried. RESULTS Sensitivity of the PCR assay. In preliminary studies, amplifications were carried out with MgPa-1 and MgPa-3 as primers and purified DNA from M. genitalium G-37T, giving rise to the expected 281-bp fragment. On inspection of ethidium bromide-stained gels, a single fragment was visible when 7 fg of M. genitalium template DNA, equivalent to eight genome copies, assuming a genome size of 840 kbp, was used (Fig. 2). When purified DNA was added to 25 PCR-negative urogenital specimens and 20 throat swabs from healthy persons, the sensitivity was approximately sixfold lower, allowing 50 copies to be detected consistently by gel inspection; hybridization with the internal probe revealed DNA equivalent to four organisms. There was no significant sample-to-sample variability at the sensitivity level. When serially diluted, broth-grown M. genitalium cells were added to five throat swabs from healthy persons and five PCR-negative urogenital specimens, fewer than 20 CFU were consistently detectable on ethidium bromide-stained agarose gels. There was no significant sample-to-sample variability at the sensitivity level. Specificity of the PCR assay. Amplifications conducted with DNA from M. genitalium G-37T and the four respiratory isolates all yielded the predicted 281-bp fragment. Digestion with EcoRI gave rise to fragments of 136 and 145 bp, and the MgPa-2 probe hybridized to the 145-bp fragment, as expected (Fig. 1). Digestions with AluI, DdeI, Sau3AI, and SspI all gave rise to fragments of sizes predicted from the published sequence (Fig. 1). Amplifications carried out with the other mycoplasmas mentioned in Materials and Methods did not yield any band. Further control experiments were performed with DNAs from a variety of bacteria known to be related to the mollicutes or to be common in the human microbial flora. These microorganisms are listed in Materials and Methods. A B J. CLIN. MICROBIOL FIG. 2. (A) Electrophoretic analysis of the PCR products obtained with different isolates of M. genitalium before and after digestion with SspI (lanes 2 to 11) and with decreasing amounts of M. genitalium DNA (lanes 13 to 16). Lanes 1 and 17, Molecular weight standards (pbr322 digested with both HindlIl and Hinfl). The numbers at the left are sizes in base pairs. Lanes 2 and 3, G-37T before and after digestion with SspI, respectively. Lanes 4 to 11, Respiratory isolates before and after digestion, respectively, with SspI: R 32 G (lanes 4 and 5), Tw 10-6 G (lanes 6 and 7), Tw 10-5 G (lanes 8 and 9), and Tw 48-5 G (lanes 10 and 11). Lane 12 is blank. Lanes 13 to 16 show the sensitivity of the PCR for M. genitalium: lane 13, 70 pg of DNA (80,000 organisms); lane 14, 0.7 pg of DNA (800 organisms); lane 15, 7 fg of DNA (8 organisms); and lane 16, no DNA. (B) Southern analysis of the gel shown in panel A with biotinylated MgPa-2. None of these organisms gave rise to amplified DNA fragments in the 180- to 400-bp range, although a 160-bp fragment was seen when DNA from H. influenzae was used. Throat swabs from 20 healthy persons were also PCR negative. Amplification of DNA in genital samples. A total of 150 swabs collected from the urethra or the cervix for culturing of C. trachomatis were tested for the presence of M. genitalium DNA. The swabs originated from 100 patients (26 male and 74 female). In each of 10 samples from eight patients (three male and five female), we detected a very distinct band at a position corresponding to that of the 281-bp fragment, but in 1 sample, the position corresponded to that of an approximately 10-bp-longer fragment (Fig. 3). The MgPa-2 probe hybridized strongly to all 10 amplified fragments, and when the samples were retested with MgPa-1 and MgPa-2 as primers, a strong signal was observed for all samples. Digestions with AluI, DdeI, and Sau3AI yielded fragments of the predicted sizes. EcoRI was unable to cut the amplified DNA in our clinical samples, and SspI did not digest three of the samples from two patients (Fig. 3). The sample with the 291-bp fragment that was amplified when

4 VOL. 29, A B FIG. 3. (A) Electrophoretic analysis of the PCR products obtained from urogenital samples submitted for culturing of C. trachomatis. Lanes 1 and 16, Molecular weight standards (pbr322 digested with both HindlIl and Hinfl). The numbers at the left are sizes in base pairs. Lanes 2, 4, 6, 8, 10, 12, and 14, Amplified fragments without restriction enzyme analysis. Lanes 3, 5, 7, 9, 11, 13, and 15, Same fragments after digestion of samples with SspI. Note that the fragments in lanes 2 and 4 do not possess the SspI site. The fragments in lanes 2 and 4 were amplified in a urethral swab and a cervical swab, respectively, from the same patient. Lanes 8 and 9 contain a fragment carrying an insertion (see the text). (B) Southern blot of the gel shown in panel A with biotinylated MgPa-2 as a probe. MgPa-1 and MgPa-3 were used as primers had a similar 10-bp-longer fragment that was amplified when MgPa-1 and MgPa-2 were used as primers. Digestion with SspI, which cuts at position 297 of the published sequence (2), showed that the longer fragment carried the insertion (Fig. 3). This result indicates that the insertion is located between positions 297 and 348 in the sequence of the adhesin gene (Fig. 1). DISCUSSION To make it feasible to investigate the possible pathogenicity of M. genitalium and to aid in the elucidation of its main tissue tropism, we have applied the PCR technique to the detection of M. genitalium DNA in clinical samples. We have chosen to use the previously published DNA sequence of the gene for the 140-kDa adhesion protein of M. genitalium, which is presumably essential for the pathogenicity of this organism. In this communication, we show that the PCR assay is capable of detecting very few copies of the M. genitalium genome by using the type strain, G-37, as well as four respiratory isolates of M. genitalium. DNA from the closely related M. pneumoniae, DNAs from other human and nonhuman mycoplasmas, both with and without a tip structure, human DNA, and DNAs from a PCR FOR DETECTION OF M. GENITALIUM 49 variety of bacteria did not yield amplified 281-bp DNA fragments. In the urogenital specimens examined, M. genitalium DNA was detected in 10 of 150 samples (6.7%) from 8 of 100 patients (3 male [12%] and 5 female [7%]). This result is in accordance with the 11% overall prevalence in a heterosexual male population found in a previous study (3) with a probe prepared from total M. genitalium DNA. The DNA amplified in the urogenital specimens in our study did not possess the EcoRI site present in the type strain and in the respiratory isolates examined, and one of the amplified DNA fragments was approximately 10 bp longer than expected. On the other hand, all the amplified fragments hybridized strongly to the MgPa-2 probe and possessed DdeI, AluI, and Sau3AI restriction enzyme cleavage sites, precluding the possibility that the band was a result of nonspecific amplification. The loss of the restriction enzyme cleavage site may have been due to a point mutation, perhaps reflecting a geographic variation of the M. genitalium strains or a variability in the adhesion protein gene between positions 297 and 348. The findings that one of the specimens contained M. genitalium DNA with an apparent insertion in this area and had lost the EcoRI site at position 315 and that some of the specimens had lost the SspI site at position 297 raise questions as to the conserved nature of the genomic material in this part of the adhesion protein gene and call for a more thorough investigation of the variations among different isolates. Although the variability in the sequences seems to be prevalent in the region between positions 297 and 348, outside the priming region, the possibility that some samples could carry mutations in the priming region cannot be excluded. Mutations in the 3' end of the primers would preclude efficient amplification, giving rise to false-negatives. The final documentation that the variability in the amplified sequences is not due to a lack of specificity must await the isolation of M. genitalium by culturing. A detailed examination of many different isolates of M. genitalium has hitherto been impossible because isolation by culturing is extremely difficult, but the PCR may be of some help in these investigations by identifying samples containing M. genitalium. We have tried to cultivate M. genitalium from the PCR-positive specimens but have failed, presumably because the chlamydia transport medium contains gentamicin, which is inhibitory to M. genitalium. We believe that the PCR method that we have developed for M. genitalium will make it possible to investigate its role in human disease and to obtain new isolates of this interesting organism. The method is easy to perform and lends itself to routine analysis. We are presently attempting to demonstrate M. genitalium DNA in throat swabs from patients with pneumonia by this technique. REFERENCES 1. Baseman, J. B., S. F. Dallo, J. G. Tully, and D. L. Rose Isolation and characterization of Mycoplasma genitalium strains from the human respiratory tract. J. Clin. Microbiol. 26: Dallo, S. F., A. Chavoya, C.-J. Su, and J. B. Baseman DNA and protein sequence homologies between the adhesins of Mycoplasma genitalium and Mycoplasma pneumoniae. Infect. Immun. 57: Hooton, T. M., P. L. Roberts, W. E. Stamm, M. C. Roberts, K. K. Holmes, and G. E. Kenny Prevalence of Mycoplasma genitalium determined by DNA probe in men with urethritis. Lancet i: Lind, K., and G. B. Kristensen Significance of antibodies

5 50 JENSEN ET AL. to Mycoplasma genitalium in salpingitis. Eur. J. Clin. Microbiol. 6: Lind, K., B. 0. Lindhardt, H. J. Schutten, J. Blom, and C. Christiansen Serological cross-reactions between Mycoplasma genitalium and Mycoplasma pneumoniae. J. Clin. Microbiol. 20: Maniatis, T., E. F. Fritsch, and J. Sambrook Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 7. M0oler, B. R., D. Taylor-Robinson, and P. M. Furr Serological evidence implicating Mycoplasma genitalium in pelvic inflammatory disease. Lancet i: Razin, S., and J. G. Tully (ed.) Methods in mycoplasmology, 1st ed., vol. 1. Academic Press, Inc., New York. 9. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich Primerdirected enzymatic amplification of DNA with a thermostable J. CLIN. MICROBIOL. DNA polymerase. Science 239: Southern, E. M Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: Taylor-Robinson, D., J. G. Tully, and M. F. Barile Urethral infection in male chimpanzees-produced experimentally by Mycoplasma genitalium. Br. J. Exp. Pathol. 66: Tully, J. G., D. Taylor-Robinson, R. M. Cole, and D. L. Rose A newly discovered mycoplasma in the human urogenital tract. Lancet i: Tully, J. G., D. Taylor-Robinson, D. L. Rose, R. M. Cole, and J. M. Bove Mycoplasma genitalium, a new species from the human urogenital tract. Int. J. Syst. Bacteriol. 33: Tully, J. G., R. F. Whitcomb, H. F. Clark, and D. L. Williamson Pathogenic mycoplasmas: cultivation and vertebrate pathogenicity of a new spiroplasma. Science 195: Downloaded from on October 8, 2018 by guest