Antifungal lactic acid bacteria with potential to prolong shelf-life of fresh vegetables

Transcription

1 Journal of Applied Microbiology ISSN ORIGINAL ARTICLE Antifungal lactic acid bacteria with potential to prolong shelf-life of fresh vegetables S. J. Sathe 1, N. N. Nawani 1, P. K. Dhakephalkar 2 and B.P. Kapadnis 1 1 Department of Microbiology, University of Pune, Pune, India 2 Agharkar Research Institute, Pune, India Keywords antifungal, biopreservative, fresh vegetables, Lact. plantarum, lactic acid bacteria, spoilage fungi. Correspondence B.P. Kapadnis, Department of Microbiology, University of Pune, Pune , India. bpkap@unipune.ernet.in : received 26 February 2007, revised 11 May 2007 and accepted 9 June 2007 doi: /j x Abstract Aim: The aim of this study was to isolate and identify antifungal lactic acid bacteria from fresh vegetables, and evaluate their potential in preventing fungal spoilage of vegetables. Methods and Results: Lactic acid bacteria from fresh vegetables were enriched in MRS (de Man Rogosa Sharpe) broth and isolated by plating on MRS agar. All the isolates (359) were screened for activity against Aspergillus flavus of which 10% showed antifungal activity. Potent antifungal isolates were identified by phenotypic characters and confirmed by partial 16S rrna gene sequencing. These were screened against additional spoilage fungi viz. Fusarium graminearum, Rhizopus stolonifer, Sclerotium oryzae, Rhizoctonia solani, Botrytis cinerea and Sclerotinia minor by overlay method. Most of the isolates inhibited wide range of spoilage fungi. When fresh vegetables were inoculated with either cell suspension (10 4 cells ml )1 ) or cell-free supernatant of Lact. plantarum, followed by application of vegetable spoilage fungi (A. flavus and F. graminearum, R. stolonifer, B. cinerea each with 10 4 conidia ml )1 ) the vegetable spoilage was significantly delayed than control. Conclusions: Fresh vegetables constitute a good source of lactic acid bacteria with ability to inhibit wide range of spoilage fungi. Such bacteria can be applied to enhance shelf-life of vegetables. In the present study, we report for the first time the antifungal activity of Weissella paramessenteroides and Lact. paracollinoides isolated from fresh vegetables, against wide range of food spoilage fungi. Significance and Impact of the Study: Fresh vegetables can be used as a source of antifungal lactic acid bacteria. Their exploitation as biopreservative will help in prolonging shelf-life of fresh vegetables. Introduction Moulds and yeasts are most common spoilage organisms of vegetables, food and feed causing significant reduction in their quality and quantity. In addition to economic losses, the potential production of toxins by moulds are of particular health concern (Filtenborg et al. 1996). Vegetables are infested with large number of spoilage microorganisms because of their contact with soil during growth and harvesting. The fungi involved in the spoilage of fresh vegetables are Botrytis cinerea, Rhizoctonia solani, Sclerotinia sclerotiorum, various species of the genera Alternaria, Aspergillus, Cladosporium, Colletotrichum, Phomopsis, Fusarium, Penicillium, Phoma, Phytophthora, Pythium and Rhizopus and some mildews (Tournas 2005). Spoilage of vegetables by moulds and yeasts can be reduced or delayed by good sanitation practices, careful handling during harvesting, proper transportation and storage conditions (temperature and humidity) and use of chemical preservatives or biopreservatives, i.e., the use of other microorganisms or their metabolites (Davidson 2001). In recent years, increasing interest has been shown in biopreservation over chemical preservation due to consumer demand for a reduced use of chemicals in food 2622 Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

2 S. J. Sathe et al. Antifungal lactic acid bacteria from vegetables and feed because of their health hazards, such as indigestibility or allergies (Ross et al. 2002; Devlieghere et al. 2004). Application of lactic acid bacteria (LAB) in traditional food and feed fermentation and preservation is well documented and still under study (Kim 1993). As vegetables are natural habitat of LAB; their potential application for prevention of vegetable spoilage opens up a new area in the biopreservation technology. The antimicrobial properties of LAB can be attributed to both the competition for nutrients and the production of various inhibitory compounds, such as organic acids, bacteriocins, antibiotics and other products like ethanol, hydrogen peroxide, carbon dioxide, diacetyl, acetaldehyde etc. (Ouwehand 1998). Although many studies have assessed the antibacterial effects of LAB and their bacteriocins, only few investigations deal with antifungal compounds and their potential to increase safety. There are few reports of low molecular weight antifungal peptides synthesized ribosomally by LAB, which inhibit spoilage and pathogenic fungi with inadequate information on their precise mechanism of action. (Schnurer and Magnussion 2005). Previously, antifungal Lact. plantarum have been isolated from sour dough (Lavermicocca et al. 2000), beer and pickled vegetables (Laitila et al. 2002), grass silage (Strom et al. 2002) and Lilac flowers (Sjogren et al. 2003). There are few reports on antifungal activity of Lact. plantarum where the active compounds have been characterized as cyclic dipeptides, hydroxy fatty acids, 3-phenyl lactic acid and other low molecular weight compounds (Strom 2005). In the present study, efforts have been made for isolation of LAB from fresh vegetables with antifungal potential and identification of most potent antifungal LAB by conventional microbiological techniques and modern molecular techniques. The antifungal spectrum of isolates was investigated against various vegetable spoilage fungi. The direct applications of either cell suspension or cellfree supernatant (CFS) of LAB on vegetables to prevent spoilage by fungi is also demonstrated. Materials and methods Cultures and media The spoilage fungi, Aspergillus flavus (MTCC 2798), Fusarium graminearum (MTCC 1893), Rhizopus stolonifer (MTCC 2198), B. cinerea (MTCC 359) and S. minor (MTCC 1125) were obtained from Microbial Type Culture Collection (MTCC), Institute of Microbial Technology, Chandigarh (India) and S. oryzae, R. solani were obtained from Departmental culture collection. The fungal cultures were maintained on potato dextrose agar (PDA) and glycerol water (20% w v) at )80 C as required. The MRS medium was obtained from HiMedia (India). Isolation of lactic acid bacteria Lactic acid bacteria were isolated from fresh vegetables (Table 1) collected from fields near Pune and Baramati area (Maharashtra, India). The vegetables (1 g) were cut into small pieces and suspended into 9 ml MRS broth (De Man et al. 1960) and incubated at 30 C under static microaerobic conditions for 48 h for enrichment of LAB. Then, the appropriately diluted samples were plated on MRS selective agar and incubated under same conditions. From each plate of MRS agar, 10% colonies with different morphologies were picked up randomly and maintained on MRS agar slants stabs at 4 C and in MRS broth with 20% glycerol at )80 C until required. These were designated as isolates. Screening of isolates for antifungal activity The isolates of LAB were screened for antifungal activity by overlay technique as described by Strom et al. (2002) on MRS agar plates using A. flavus as indicator with slight modification. Briefly, the LAB were grown in the form of Table 1 Lactic acid bacteria from different vegetables Vegetable source Common name Number of isolates Code assigned Rods Cocci Total Bottle gourd BG Cabbage CB Capsicum CM Carrot CR Cauliflower CL Cowpea CP Bladder dock BD Cucumber CUK Drumstick DS Cluster beans CLB French beans FB Gram leaves GML Ladies finger LF Fenugreek FG Lima beans leaves LBL Lima beans Pods LBP Pea leaves PL Pea pods PP Spinach leaves SPL Tomato TMO Gherkins GK Total Number of antifungal isolates* *Determined by overlay technique against A. flavus as an indicator fungus. Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

3 Antifungal lactic acid bacteria from vegetables S. J. Sathe et al. two 2 cm streaks on MRS agar plates and incubated under microaerobic conditions at 30 C for 48 h. These plates were overlaid with semisolid malt extract agar (0Æ7%) seeded with 10 4 spores ml )1 of A. flavus and incubated aerobically at 30 C for 24 to 72 h. Clear zones of inhibition were recorded and scored (Strom et al. 2002) as follows: -, no visible inhibition; +, inhibition area per bacterial streak of 1 to 3% of Petri dish; ++, inhibition area per bacterial streak of 3Æ0 to 8Æ0% of the Petri dish; +++, inhibition area per bacterial streak of >8Æ0% of the Petri dish. Each experiment was performed in triplicate and the cultures giving zone of inhibition with ++ and +++ were selected for further studies. Twelve antifungal LAB were tested further for their ability to inhibit wide range of fungi as mentioned above, by overlay technique. Antifungal spectrum of selected LAB isolates Further antifungal spectrum of these twelve selected LAB isolates against F. graminearum, R. stolonifer, S. oryzae, R. solani, B. cinerea and S. minor was determined by overlay technique. Clear zones of inhibition around bacterial streaks were recorded and compared for their potential to inhibit wide range of spoilage fungi. Characterization of antifungal bacterial isolates The LAB isolates grown on MRS agar were examined for morphology and motility under phase contrast microscope (Nikon, Japan). They were subjected to Gram staining and catalase-oxidase tests followed by further biochemical characterization as per Bergey s Manual of Determinative Bacteriology (Kandler and Weiss 1986). Growth conditions were determined in MRS broth at different temperatures (10 and 45 C), ph (4Æ4 and 9Æ6) and with different salt concentrations (NaCl) of 6Æ5 and 18% at 30 C for 48 h. Growth was determined in terms of turbidity. Identification of selected strains by partial 16S rrna gene sequencing DNA of each overnight grown culture was isolated by method described by Sambrook et al. (1989). The PCR reaction mixture contained approximately 10 ng of DNA; 2Æ5 mmol l )1 MgCl 2, 1X PCR buffer (Bangalore Genei, Bangalore); 200 lmol l )1 of each dctp, dgtp, datp and dttp; 2Æ0 pmol of each forward and reverse primers and 1Æ25 U of Taq DNA polymerase (Bangalore Genei, Bangalore) in a final volume of 20 ll. FDD2 and RPP2 primers were used to amplify almost entire 16S rrna gene, as described previously (Rawlings 1995). Primer FDD2 5 GGATCCGTCGACAGAGTTTGATCIT- GGCTCAG3 34-mer. Primer RPP2 5 CCAAGCTTCTAGACGGITACCTTGT- TACCACTT3 33-mer. The PCR was performed using Eppendorf Gradient Master Cycler system with initial denaturation at 94 C for 5 min followed by 30 cycles of denaturation at 94 C for 1 min, primer annealing at 60 C for 1 min and primer extension at 72 C for 1 min. Final extension was done at 72 C for 10 min and the mixture was held at 4 C. The PCR product was purified using PEG NaCl and 70% ethanol and dried product was dissolved in milliq water and used as template for cycle sequencing reaction using ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystem, Foster City, CA, USA) as described below: A combination of universal primers was chosen to sequence the nearly complete gene (Muyzer et al. 1993; Rawlings 1995). The sequencing reaction and template preparation were performed in accordance with the directions of the manufacturer. The sequencing products were purified and resolved by electrophoresis and analysed by an ABI PRISM 3100 Genetic Analyzer. The nucleotide sequences were compared with sequences in the NCBI database using the BLAST algorithm. Production of antifungal substance in liquid medium by Lact. plantarum CUK501 and its assay Lact. plantarum CUK501 was studied for its ability to produce active antifungal substance in liquid medium. Overnight grown culture (10 4 CFU ml )1 ) was used to inoculate (0Æ2% v v) 800 ml MRS broth and incubated under microaerobic conditions, at 30 C for 72 h. Aliquots were withdrawn at 6 h interval and examined for growth (OD 600 ), ph and antifungal activity of CFS against most sensitive fungus, R. stolonifer. To obtain CFS, 10 ml aliquot was centrifuged at g for 10 min and the supernatant passed through sterile membrane filter (0Æ20 lm pore size, Millipore). The filtrate was designated as CFS. To determine antifungal activity of CFS by agar well diffusion technique, the CFS (100 ll) was applied into wells prepared in MRS agar plates seeded with the spores (10 4 ml )1 )ofr. stolonifer. The concentration of antifungal compound per milliliter of CFS was determined in terms of arbitrary units (AU) defined as the reciprocal of highest dilution at which fungus was inhibited (Wan et al. 1995). The above experiment was done in triplicate. Testing Lact. plantarum in preventing fungal spoilage of cucumber Surface sterilized cucumbers were wounded with cork borer (2 2 2mm 3 ) and 20 ll of (10 4 cells ml )1 ) saline suspension of Lact. plantarum was pipetted into this wound. This was followed by challenging the wound 2624 Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

4 S. J. Sathe et al. Antifungal lactic acid bacteria from vegetables with 20 ll of spore suspension (10 4 spores ml )1 ) of respective fungal pathogens viz., A. flavus, F. graminearum, R. stolonifer, B. cinerea. Each treatment included five cucumbers and was repeated three times. The controls were cucumbers inoculated either with pathogen or with LAB only. Lesion diameters were measured after 9 days of inoculation at 20 C and 85% relative humidity (RH) in a controlled atmosphere. Results Isolation and Screening of lactic acid bacteria for antifungal activity Table 2 Grouping of LAB isolates based on their potential to inhibit Aspergillus flavus Group SPL-402, CB-601, CUK-501, PP-601, FB-301, +++ FG-401, FG-601, CR-501 PP-402, CB-402, LF-501, TMO BG-501, CB-401, CB-502, CM-501, CR-502, + CL-102, CL-203, CL-601, CP-502, CUK-101, CUK-201, CUK-301, CUK-502, DS-104, DS-205, CLB-101, CLB-103, CLB-202, FB-501, LBL-101, PP-404, PP-501, SPL-102, SPL-103, SPL-401 Antifungal activity* * +, inhibition 0Æ1 3Æ0% of Petri dish area; ++, inhibition 3Æ0 8Æ0% of the Petri dish area; +++, inhibition >8Æ0% of the Petri dish area (Tested by overlay technique). From 21 fresh vegetables total 359 presumptive lactic acid bacteria were isolated on MRS agar. Microscopic observations showed that 57% were rods and 43% were cocci. Screening for antifungal activity against A. flavus by overlay technique showed that 37 out of 359 isolates were antifungal (Table 1). Activity of LAB against A. flavus was variable. Eight isolates had strong antifungal activity (inhibition area per bacterial streak was more than 8% of the Petri dish) while four of them had moderate activity (inhibition area per bacterial streak was 3 8% of Petri dish) against A. flavus (Table 2). Characterization and identification of LAB Potent isolates were subjected to characterization and identification. Their phenotypic characteristics are shown in Table 3. Four of these isolates were rods and remaining cocci. All isolates were Gram-positive, non motile, catalase and oxidase negative, could grow at 10 and 45 C and at ph 4Æ4 and 9Æ6, except the isolate SPL-402 which couldn t grow at ph 9Æ6. All of them grew at 6Æ5% NaCl but failed to grow at 18% NaCl. For further identification, 16S rrna gene sequences of these isolates were matched with the GenBank Database by BLAST (Table 3). Antifungal activity spectrum The antifungal spectrum of selected lactic acid bacteria against six spoilage fungi was determined by overlay method (Table 4). Out of 12 isolates, CUK-501 (identified as Lact. plantarum) had strong activity against all fungi, which showed broad antifungal spectrum. All isolates showed inhibitory effects against R. stolonifer and B. cinerea. Table 3 Characteristics of antifungal LAB isolates from different vegetables and their identifications based on 16S rrna gene sequencing Growth at Temp ( C) ph NaCl (%) Characteristics Shape Motility Catalase Oxidase Gram reaction Æ4 9Æ6 6Æ5 18 Homology with Homology (%) SPL-402 Cocci ) ) ) + ) Weissella paramessenteroides 94 CB-601 Rods ) ) ) Lact. plantarum 98 CUK-501 Rods ) ) ) Lact. plantarum 99 PP-601 Cocci ) ) ) Pediococcus pentosaceus 99 FB-301 Cocci ) ) ) P. pentosaceus 90 FG-401 Cocci ) ) ) P. pentosaceus 99 FG-601 Rods ) ) ) L. paracollinoides 96 CR-501 Cocci ) ) ) P. pentosaceus 94 PP-402 Cocci ) ) ) P. pentosaceus 86 CB-402 Cocci ) ) ) P. pentosaceus 98 LF-501 Cocci ) ) ) P. pentosaceus 99 TMO-501 Rods ) ) ) L. paracollinoides 95 +, positive, ), negative. Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

5 Antifungal lactic acid bacteria from vegetables S. J. Sathe et al. Activity against* Table 4 Antifungal spectrum of LAB isolates as determined by overlay technique LAB isolates Fusarium graminearum Rhizopus stolonifer Sclerotium oryzae Rhizoctonia solani Botrytis cinerea Sclerotinia minor SPL CB CUK PP FB FG FG CR PP CB LF TMO *Inhibition zone diameter in mm; no inhibition. Production of antifungal substance The relationship between cell density, ph and antifungal titer during growth of Lact. plantarum in MRS broth at 30 C over 72 h was determined (Fig. 1). Antifungal activity was detected first at 12 h when culture was in the early logarithmic phase. The antifungal titre was maximum (1280 AU ml )1 ) when the culture was in the late logarithmic phase (36 h) and it was at high until early stationary phase over 12 h. During 72 h of growth, the ph declined from 6Æ7 to 4Æ2. The antifungal titre was high when ph of the broth was in the range of 4Æ8 to4æ5. The decline in antifungal titre was observed after 48 h, when culture entered into stationary phase and it was only 300 AU ml )1 at 72 h, when the ph of the broth was 4Æ2. OD at 600 nm ph Time (h) Figure 1 Production of antifungal substance by Lact. plantarum CUK501. Relationship between cell density (h), ph ( ) and antifungal titre (d) during growth in MRS broth at 30 C over 72 h. Antifungal activity (AU ml 1 ) Testing Lact. plantarum in preventing fungal spoilage of cucumber The activity of CFS (data not shown) and cells of Lact. plantarum CUK-501, against Aspergillus flavus, F. graminearum, R. stolonifer and B. cinerea indicated significant delay in vegetable spoilage (Table 5). The cucumber used in the experiment was in good conditions over a period of 8 days when challenged with these four fungi individually in the presence of Lact. plantarum cells as compared to control. The similar results were obtained when Lact. plantarum cells were replaced with cell-free supernatant of Lact. plantarum grown in MRS broth at 30 C for 48 h (data not shown). Identification and characterization of LAB Presence of acetic acid and low ph of the medium favors the growth of LAB. The isolates were characterized biochemically and identified upto genus level. Further identification of the isolates was carried out by 16S rrna gene Table 5 Lesion diameters (mm) on cucumber challenged with different spoilage fungi and wounds inoculated with Lact. plantarum Spoilage fungi Lesion diameter after 9 days* Pathogen control LAB controlà 9 days Aspergillus flavus 22Æ6 0Æ0 1Æ5 Fusarium graminearum 14Æ8 0Æ0 1Æ8 Rhizopus stolonifer 28Æ6 0Æ0 1Æ2 Botrytis cinera 28Æ4 0Æ0 2Æ4 *Means of 15 lesions measured in mm after 9 days of incubation at 20 C. Pathogen control: inoculated with fungal pathogen only. àlab control: inoculated with LAB only Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

6 S. J. Sathe et al. Antifungal lactic acid bacteria from vegetables sequencing. They were identified as Lactobacillus, Pediococcus, Leuconostoc and Weissella. The 16S rrna gene sequences were submitted to NCBI data bank. The accession numbers for nucleotide sequences are CB-601 (EF422373), FB-301 (EF422374), FG-401 (EF422375), FG- 601 (EF422376), LF-501 (EF422377), PP-402 (EF422378), PP-601 (EF422379), SPL-402 (EF422380) and TMO-501 (EF422381). Discussion The more practical approach has been used in the present study to reintroduce the LAB isolates on the vegetables, from which they are isolated, for biocontrol of spoilage fungi. The lactic acid bacteria with antibacterial activity are well documented (Kim 1993) while less attention has been paid to exploit its antifungal activity (Schnurer and Magnusson 2005). Supportive reports are there on persistence of bacteriocin producing LAB on plants and vegetables like Lactococcus lactis on fermented carrots (Andersson et al., 1990), mixed salads and fermented carrots (Uhlman et al. 1992), retail vegetables (Garver and Muriana 1993); Pediococcus pentosaceus and Lactobacillus plantarum on fermented cucumbers (Fleming et al. 1975; Daeschel et al.1990); lactic acid bacteria with antimicrobial property on ready to use vegetables, such as tomatoes, cabbage, red and green chicory, were isolated (Vaughan et al. 1994). More recently, Magnusson et al. (2003) isolated antifungal LAB from plant materials. It was seen in our investigation that though there are large number of lactic acid bacteria habituated on the vegetables, very few (10%) of them possess antifungal property. This is the first report on antifungal lactic acid bacteria from fresh vegetables and we report first time two of the isolates, Weissella paramessenteroides and Lact. Paracollinoides as novel antifungal isolates. The species identification was authenticated by partial 16S rrna gene sequencing (Schleifer and Ludwig 1995). The isolated antifungal LAB were identified as Pediococcus pentosaceus (seven isolates), W. paramessenteroides (one isolate), Lactobacillus plantarum (two isolates) and Lactobacillus paracollinoides (two isolates). Very few reports deal with well-characterized antifungal compounds (Schnurer and Magnussion 2005) while the exploitation of antifungal lactic acid bacteria for vegetable preservation is scanty (Vescovo et al. 1996). In our study, the application of antifungal LAB to inhibit fungal spoilage of vegetable showed significant delay in spoilage and therefore, this property can be exploited to enhance shelflife of vegetables. The LAB isolates from vegetable sources seem to be more resistant to stress conditions than those from sea foods (Kobayashi et al. 2003), as we observed their growth at extreme ph (4Æ4 and 9Æ6) and temperature (10 and 45 C), these are exciting properties with an application point of view. The inference on antifungal activity of MRS media components like sodium acetate (Stiles et al. 2002) can be obliterated because of good growth of all fungi used in present studies on MRS agar. Lactic acid bacteria are used for preservation of food and milk products from centuries and thus acquired the GRAS (generally recognized as safe) status. In our study it was found that, the inhibitory activity spectrum of the isolates against vegetable spoilage fungi was broad, thus LAB as live cells or their metabolic products can be used for biopreservation of vegetables. Study on the production of antifungal compounds in MRS broth by one of the isolates, Lactobacillus plantarum indicate that antifungal activity was growth-dependent and was highest at the end of logarithmic phase of growth. Antifungal activity declines during the stationary phase and thereafter which hypothetically suggests that antifungal compound might be converted to other metabolites or degraded by autolytic enzymes. Inhibitory activity of Lact. plantarum against various fungal species are in agreement with previous studies (Niku-Paavola et al. 1999; Lavermicocca et al. 2000; Magnusson et al.2003). The LAB isolates were obtained from fresh vegetables that being their natural habitat they could be exploited for biopreservation of fresh vegetables. Thus this study points out the possibilities of LAB for biopreservation of vegetables by indigenous strains of lactic acid bacteria. Acknowledgement Sathe S. J. thanks UGC, Government of India for providing financial assistance under Faculty Improvement Program (FIP). References Andersson, R.E., Daeschel, M.A. and Hassan, H.M. (1990) Antibacterial activity of plantaricin SIK-83, a bacteriocin produced by Lactobacillus plantarum. Biochimie 70, Daeschel, M.A., McKenney, M.C. and McDonald, L.C. (1990) Bactericidal activity of Lactobacillus plantarum C-11. Food Microbiol 7, Davidson, M. P. (2001) Chemical preservatives and natural antimicrobial compounds. In Food Microbiology: Fundamentals and frontiers ed. Doyle, M.P., Beuchat, L.R. and Montville, T.J. pp Washington: American Society of Microbiology. Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)

7 Antifungal lactic acid bacteria from vegetables S. J. Sathe et al. De Man, J.C., Rogosa, M. and Sharp, M.E. (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23, Devlieghere, F., Vermeiren, L. and Debevere, J. (2004) New preservation technologies: possibilities and limitations. J Dairy Sci 14, Filtenborg, O., Frisvad, J.C. and Thrane, U. (1996) Moulds in food spoilage. Int J Food Microbiol 33, Fleming, H.P., Etchells, J.L. and Costilow, R.N. (1975) Microbial inhibition by an isolate of Pediococcus from cucumber brines. Appl Microbiol 30, Garver, K.I. and Muriana, P.M. (1993) Detection, identification and characterization of bacteriocin producing lactic acid bacteria from retail food products. Int J Food Microbiol 19, Kandler, O. and Weiss, N. (1986) Regular, non-sporing Grampositive rods. In Bergey s Manual of Systematic Bacteriology Vol. 2 ed. Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. pp Baltimore: Williams and Wilkins. Kim, W.J. (1993) Bacteriocins of lactic acid bacteria: their potentials as food preservatives. Food Rev Int 9, Kobayashi, T., Kajiwara, M., Wahyuni, M., Kitakado, T., Hamada-Sato, N., Imada, C. and Watanabe, E. (2003) isolation and charecterization of halophilic lactic acid bacteria isolated from terasi shrimp paste: A traditional fermented seafood product in Indonesia. J Gen Appl Microbiol 49, Laitila, A., Alakomi, H-L., Raaska, L., Mattila-Sandholm, T. and Haikara, A. (2002) Antifungal activities of two Lactobacillus plantarum strains against Fusarium moulds in vitro and in malting of barley. J Appl Microbiol 93, Lavermicocca, P., Valerio, F., Evidente, A., Lazzaroni, S., Corsetti, A. and Gobbeti, M. (2000) Purification and characterization of novel antifungal compounds from the sourdough Lactobacillus plantarum strain 21B. Appl Environl Microbiol 66, Magnusson, J., Strom, K., Roos, S., Sjogren, J. and Schnurer, J. (2003) Broad and complex antifungal activity among environmental isolates of lactic cid bacteria. FEMS Microbiol Lett 219, Muyzer, G., De Wall, E. C. and Uitterlinden, A. G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction amplified genes coding for 16S rrna. Appl Environl Microbiol 59, Niku-Paavola, M.L., Laitila, A., Mattila-Sandholm, T. and Haikara, A. (1999) New types of antimicrobial compounds produced by Lactobacillus plantarum. J Appl Microbiol 86, Ouwehand, A. C. (1998) Antimicrobial components from lactic acid bacteria. In Lactic Acid Bacteria Microbiology and Functional Aspects ed. Salminen, S. and von Wright, A. pp New York: Marcel Dekker. Inc. Rawlings, D. E. (1995) Restriction enzyme analysis of 16S rrna genes for the rapid identification of Thiobacillus ferrooxidans, Thiobacillus thiooxidans and Leptospirillum ferrooxidans strains in leaching environments. In Biohydrometallurgical processing, Vol. 2 ed. Jerez, C.A., Vargas, T., Toledo, H. and Wiertz, J.V. pp Santiago Chile: University of Chile Press. Ross, P.R., Morgan, S. and Hill, C. (2002) Preservation and fermentation: past, present and future. Int J Food Microbiol 79, Sambrook, J., Fritsh, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Schleifer, K.H. and Ludwig, W. (1995) Phylogenetic relationships of lactic acid bacteria. In The Genera of Lactic Acid Bacteria ed. Wood, B.J.B. and Holzapfel, W.H. pp London: Chapman and Hall. Schnurer, J. and Magnussion, J. (2005) Antifungal lactic acid bacteria as biopreservatives. Trends Food Sci Tech 16, Sjogren, J., Magnussion, J., Broberg, A., Schnurer, J. and Keene, L. (2003) Antifungal 3-hydroxy fatty acids from L. plantarum MiLAB 14. Appl Environ Microbiol 69, Stiles, J., Penkar, S., Plockova, M., Chumchalova, J. and Bullerman, L.B. (2002) Antifungal activity of sodium acetate and Lactobacillus rhamnosus. J Food Prot 65, Strom, K. (2005) Fungal Inhibitory Lactic Acid Bacteria. PhD Thesis: Swedish University of Agricultural Sciences. Strom, K., Sjogren, J., Broberg, A. and Schnurer, J. (2002) Lactobacillus plantarum MiLAB 393 produces the antifungal cyclic dipeptides cyclo (L-Phe- L-Pro) and cyclo (L-Phetrans-4-OH-L-Pro) and 3-phenyllactic acid. Appl Environ Microbiol 68, Tournas, V.H. (2005) Spoilage of vegetable crops by bacteria and fungi and related health hazards. Crit Rev Microbiol 31, Uhlman, L., Schillinger, U., Rupnow, J.R. and Holzapfel, W.H. (1992) Identification and charecterization of two bacteriocin producing strains of Lactococcus lactis isolated from vegetables. Int J Food Microbiol 16, Vaughan, E.E., Caplice, E., Looney, R., O Rourke, N., Coveney, H., Daly, C. and Fitzgerald, G.F. (1994) Isolation from food sources, of lactic acid bacteria that produced antimicrobials. J Appl Bacteriol 76, Vescovo, M., Torriani, S., Orsi, C., Macchiarolo, F. and Scolari, G. (1996) Application of antimicrobial producing lactic acid bacteria to control pathogens in ready-to-use vegetables. J Appl Bacteriol 81, Wan, J., Hicky, M.W. and Coveney, M.J. (1995) Continuous production of bacteriocins, bevicin, nisin and pediocin, using calcium alginate-immobilized bacteria. J Appl Bacteriol 79, Journal compilation ª 2007 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007)