Livestock Science 129 (2010) Contents lists available at ScienceDirect. Livestock Science. journal homepage:

Transcription

1 Livestock Science 129 (2010) Contents lists available at ScienceDirect Livestock Science journal homepage: Effects of addition of tea saponins and soybean oil on methane production, fermentation and microbial population in the rumen of growing lambs Hui-Ling Mao, Jia-Kun Wang, Yi-Yi Zhou, Jian-Xin Liu Institute of Dairy Science, MOA Key Laboratory of Molecule Animal Nutrition, Zhejiang University, Hangzhou , PR China article info abstract Article history: Received 31 May 2009 Received in revised form 21 December 2009 Accepted 22 December 2009 Keywords: Fermentation Growing lamb Methane production Ruminal microbe Soybean oil Tea saponin The study was carried out to investigate the effects of tea saponins (TS), soybean oil (SO), and tea saponins plus soybean oil (TS SO) on methane production, fermentation and microbial populations in the rumen of growing lambs. Thirty-two Huzhou lambs weaned at the age of 50 days, with an initial body weight of 14.2±1.38 kg, were assigned to four dietary treatments in a 2 2 factorial arrangement with TS (0 or 3 g/d) and SO (0 or 3% of DM). The diet without additives was considered as NTNS (no TS or SO). After a feeding trial for 60 days, four lambs from each treatment were moved to simple open-circuit respiratory chambers (two animals per chamber) to measure methane production for3 dayseach measurement period. Animals were then slaughtered to obtain rumen samples for analysis of microbial ecology by real-time PCR. Populations of rumen methanogens, protozoa, fungi, Ruminococcus flavefaciens, and Fibrobacter succinogenes were expressed as a proportion of total rumen bacterial 16 S rdna. Daily methane production was decreased (Pb0.05) with TS, SO and TS SO by 27.7, 13.9, and 18.9%, respectively. Ruminal ph was decreased (Pb 0.05) for lambs fed diets with TS, SO, and TS SO, vs. the NTNS, and ammonia N concentration was reduced by SO (Pb0.05). Concentrations of total volatile fatty acids were increased by all treatments (Pb0.05), with no significant differences in proportions of individual acids among diets. Microbial protein was increased (Pb0.05) with TS, SO, and TS SO. Addition of TS, SO, and TS SO had little effect on fungal population (PN0.05), but protozoa populations relative to total bacterial 16 S rdna were decreased (Pb0.05) for lambs fed diets with TS, SO, and TS SO, with the lowest value in lambs fed the diet containing SO only. Population of methanogens was inhibited by SO (Pb0.05), but not by TS. Addition of SO and TS SO had an inhibitory effect on the population of fibrolytic microbes including R. flavefaciens and F. succinogenes. From the present study, it is inferred that tea saponins and soybean oil have an inhibitory effect on methane production in growing lambs when they are added to the diets, but they show different action against the protozoa, methanogens and other rumen microbes involved in methane formation Elsevier B.V. All rights reserved. 1. Introduction In the process of ruminal fermentation in ruminants, 2 12% of ingested gross energy is converted to methane, which not only lowers the efficiency of feedstuff utilization, but also contributes to global warming (Johnson and Johnson, 1995). Corresponding author. Institute of Dairy Science, Zhejiang University, Kaixuan Road 268, Hangzhou , PR China. Tel.: ; fax: address: liujx@zju.edu.cn (J.-X. Liu). Methane from livestock accounted for 38% of the green house gases emitted (McGinn et al., 2004). Therefore, inhibition of methane production from livestock can improve feed efficiency and potentially have long-term environmental benefits. Dietary manipulation can help suppress methane emission from ruminants by inhibiting rumen microbes involved in methane formation, or by diverting hydrogen away from methane production during ruminal fermentation (McGinn et al., 2004). Saponins or saponin-like substances have been reported to suppress methane production, reduce rumen protozoa counts, and modulate fermentation patterns (Wang et al., /$ see front matter 2010 Elsevier B.V. All rights reserved. doi: /j.livsci

2 H.-L. Mao et al. / Livestock Science 129 (2010) ; Hristov et al., 1999). Tea saponin (TS) is extracted from tea seed, usually considered as a residue and disposed of after the tea seed is extracted for oil. In a previous study, Hu et al., (2005) observed that TS may influence the rumen fermentation, decrease protozoa counts and inhibit methane release in vitro, but the methane-suppressing effects of TS may lead to the accumulation of hydrogen. Another way of diverting hydrogen away from methane formation would be to promote alternative, electron-sink metabolic, pathways to dispose of the reducing power (Ungerfeld et al., 2003), and unsaturated fatty acids may provide an alternative metabolic hydrogen acceptor to CO 2 (Czerkawski et al., 1966). Due to biohydrogenation and toxic effects of free fatty acids on both methanogens (Prins et al., 1972) and protozoa (Broudiscou et al., 1990), some types of vegetable oils rich in C 18 -unsaturated fatty acids, such as oil from rapeseed, sunflower and linseed, have been shown to reduce methane production and alter fermentation patterns (Jalč and Čerešňáková, 2002; McGinn et al., 2004). Soybean oil (SO) contains more than 50% linoleic acid (Zhang, 2008) and may be an effective hydrogen acceptor. However, information is limited on the effects of TS and SO on methane production and ruminal microorganism in vivo. Thus, the objective of this study was to investigate the effect of TS, SO, and TS plus SO (TS SO) on methane production, fermentation and microbial flora in the rumen of growing lambs. 2. Materials and methods 2.1. Animals, feeds, and experimental design Thirty-two Huzhou male lambs, weaned at the age of 50 days, with an initial body weight of 14.2±1.38 kg, were used. The animals were divided into four groups of eight lambs each, with four units of two lambs in each group. Diets contained 60% Chinese wild rye (Aneurolepidium Chinese Kitagawa) and 40% concentrate mixture formulated (DM basis) to be isocaloric and isonitrogenous and to meet or exceed the nutrient requirement for meat-producing sheep (Table 1; Ministry of Agriculture, MOA, PRC, 2004). In all groups, feed was given in equal portions twice a day at 0830 and The lambs had free access to drinking water. An experiment was carried out according to a 2 2 factorial design with TS and SO as main effects. The diets included: NTNS (no TS or SO), TS (3 g/d), SO (3% of the DM), and TS plus SO (TS SO). Dose of TS was based on the result of a previous in vivo study with growing goats (Hu et al., 2006). During the feeding trial lasting for 60 days, each unit of two lambs was housed in individual pens (2 1.5 m) and bedded on wood. After the feeding trial, four lambs in each treatment were transported to simple open-circuit respiratory chamber to measure methane production. Because only two chambers were available, two pairs of animals were used at the same time. Each measurement lasted for three days. The first day within the chambers was considered as adaptation, allowing the sheep to adapt before measurements were recorded for two consecutive days starting at When the methane measurement was terminated, the animals used for methane production measurement (four lambs of each treatment) were slaughtered to obtain rumen samples for analysis of microbial ecology Simple open-circuit respiratory chamber design The simple open-circuit respiratory chambers for in vivo methane measurement were cuboid ( m) and constructed using concrete with an arched roof covered with plastic film. Through a pump set to the outlet, outside air was supplied to the chamber from one side and chamber air was removed from another side. The volume of the air through the chamber was recorded by the flow meter set to the outlet. The methane production was calculated according to the methane concentration of the air samples taken from the inlet and outlet, and the volume of air that flowed through the chamber. Before the measurement, methane recovery from the chambers was measured to calibrate the chamber. Using the standard intake methane gas (99.99%, 0.83 cm 3 /s), the measured methane recoveries of these two chambers were 0.91 and 0.87, respectively Sampling procedures and measurements Growth performance Feed offered and refused, and body weights were recorded once every two weeks during the feeding trial. Each measurement was recorded for two consecutive days starting at Methane measurement During the two consecutive days when lambs were housed in chambers, the volume of the air flowed through the chamber was recorded per hour. Air samples were taken once an hour from the outlet of each chamber with two airproof syringes and analyzed immediately for methane concentration by gas chromatograph (GC-2100, Shimadzu Table 1 Ingredient and chemical composition of the diet a (%, DM basis). Items Diets b NTNS TS SO TS SO Ingredient, % Chinese wild rye Ground corn Soybean meal Bran Rapeseed meal NaCl CaHPO Mineral and vitamin premix Soybean oil Chemical composition c DM, CP NDF ADF Ca P DE, MJ/kg DM a Diet was formulated to meet the Feeding Standard of Meat-producing Sheep and Goats (Ministry of Agriculture, MOA, PRC, b Diets: NTNS = no tea saponins or soybean oil; TS = tea saponins; SO=soybean oil; TS SO=tea saponins plus soybean oil. c Chemical composition was calculated based on tabulated composition of individual feedstuffs (Ministry of Agriculture, MOA, PRC, 2004). DM=Dry Matter; CP=Crude Protein; NDF=Neutral Detergent Fibre; ADF=Acid Detergent Fibre; DE=Digestiable Energy.

3 58 H.-L. Mao et al. / Livestock Science 129 (2010) Corp., Kyoto, Japan) equipped with a flame ionization detector (FID) (Zhang et al., 2008). The samples of the air entering the chamber were taken from the intake and analyzed for the methane proportion Sampling and measurement of rumen fermentation Rumen fluid samples were collected immediately after lambs were slaughtered, and strained through four layers of compress gauze. The ph of rumen liquor was determined immediately using a ph meter (Model PB-20, Sartorius, Germany). Ruminal ammonia N, volatile fatty acid (VFA) and microbial protein (MCP) were determined using methods described by Hu et al. (2005). For determination of the relative quantity to total bacterial 16 S rdna of methanogens, protozoa, fungi, Ruminococcus flavefaciens and Fibrobacter succinogenes, six aliquots of 1 ml rumen fluid were sampled and stored at 80 C immediately Total DNA extraction and real-time quantitative PCR Total DNA was extracted from rumen fluid by the beadbeating method as described by Zhang et al. (2008). The primers of total bacteria, methanogens, protozoa, fungi, R. flavefaciens, and F. succinogenes are listed in Table 2, as described by Denman and McSweeney (2006), and Denman et al. (2007). The species-specific real-time quantitative PCR was performed using the ABI 7500 real time PCR system (Applied Biosystems, USA) with fluorescence detection of SYBR green dye. Amplification condition was as follows: one cycle at 95 C for a 10 s for initial denaturation and followed by 40 cycles of 95 C for 5 s and 60 C for 34 s. Specificity of amplified products was confirmed by melting temperatures and dissociation curves after each amplification. Amplification efficiencies for each primer pair were investigated by examining dilution series of total ruminal microbial DNA template on the same plate in triplicate Calculation and statistical analysis The methane production per hour was calculated by the following equation: V CH4 =(P P 0 ) V/R, where P and P 0 is the methane concentration (V/V) of the air samples taken from the outlet and inlet, respectively; V is the volume of air flowed through the chamber (L); and R is the recovery of methane in the chamber. Table 2 PCR primers for real-time PCR assay. Target Species Forward Primer sequence Total bacteria a F CGGCAACGAGCGCAACCC R CCATTGTAGCACGTGTGTAGCC Methanogens b F TTCGGTGGATCDCARAGRGC R GBARGTCGWAWCCGTAGAATCC Fungi a F GAGGAAGTAAAAGTCGTAACAAGGTTTC R CAAATTCACAAAGGGTAGGATGATT Protozoa b F GCTTTCGWTGGTAGTGTATT R CTTGCCCTCYAATCGTWCT R. flavefaciens b F CGAACGGAGATAATTTGAGTTTACTTAGG R CGGTCTCTGTATGTTATGAGGTATTACC F. succinogenes a F GTTCGGAATTACTGGGCGTAAA R CGCCTGCCCCTGAACTATC a Cited from Denman and McSweeney (2006). b Cited from Denman et al. (2007). Populations of methanogens, protozoa, fungi, R. flavefaciens, and F. succinogenes were expressed as a proportion of total rumen bacterial 16 S rdna according to the equation:relative quantification of target=2 (Ct target Ct total bacteria), where Ct represents threshold cycle. The results were analyzed as a completely randomized design (SAS, 1999). Every two lambs in each pen were considered as the experimental unit. The experimental model was 2-way interactions and the main effects were TS and SO. In case the interaction between TS and SO was deemed statistically significant, a secondary statistical test was used to separate the efficacy of factor TS within factor SO (and vice versa) (Robinson et al., 2006). Multiple comparisons of means among treatments were carried out by the Duncan's multiple range tests. Degree of significance was defined as follows: PN0.10, not significant; P=0.05 to 0.10, trends; P 0.05, significant. 3. Results 3.1. Effects on growth performance and methane release No significant effects were observed on feed intake and daily gain by addition of TS, SO, and TS SO (Table 3). All lambs had similar diurnal pattern of methane emissions (Fig. 1). Methane emissions were increased rapidly after the animals were fed, and then decreased slowly until the next feeding. Daily methane production (L/kg DM intake) was decreased (Pb0.05; Table 3) for lambs fed the diets with TS, SO, and TS SO. Lambs fed the diet containing only TS had lowest (decreased by 27.7%) methane production compared with the NTNS, but the reduction was not greater when SO was included. A TS SO interaction was observed (Pb0.05; Table 3). The main effect of SO on the reduction of methane production was not significant, but a secondary statistical test indicated that addition of SO had an inhibitory effect on methane production, regardless addition with (P=0.030) or without TS (P=0.002) Effects on fermentation characteristics Compared with the NTNS, ruminal ph was decreased in all treatments (Pb0.05), but all values were in the normal range (Table 4). The concentrations of total VFAs were enhanced (Pb0.05) in all treatments, but no significant differences were observed in proportion of individual acid among diets. Ammonia N concentration was lower (Pb0.05) in lambs fed the diets containing SO and TS SO than in those fed on the NTNS, but little affected by TS addition (PN0.05). Lambs fed the diets with TS, SO, and TS SO had a greater MCP concentration (Pb0.05) vs. the NTNS, with an interaction of TS SO (Pb0.05; Table 4) Effects on rumen microbes Effects on the ruminal microbial population are shown in Table 5. Addition of TS, SO, and TS SO had little effect on fungi quantity relative to total bacterial 16 S rdna (PN0.05). Protozoa population was decreased markedly when lambs were fed the diets containing TS, SO, and TS SO (Pb0.05), with a tendency for a TS SO interaction (P=0.08). The main effect of TS on the protozoa population was not significant, but a secondary

4 H.-L. Mao et al. / Livestock Science 129 (2010) Table 3 Effects of addition of tea saponins, soybean oil, or tea saponins plus soybean oil on productive performance and methane emission in growing lambs. Items Diets 1 P-value NTNS TS SO TS SO SEM TS SO TS SO No. of animals Feed intake, g/d Initial weight, kg Final weight, kg Daily gain, g/d Methane, L/kg DMI 26.2 a 19.0 c 22.6 b 21.2 b 0.65 b Diets: NTNS =no tea saponins or soybean oil; TS=tea saponins; SO=soybean oil; TS SO=tea saponins plus soybean oil. 2 Due to the interaction between TS and SO, a secondary statistical test indicated the efficacy of factor TS: without SO, Pb0.0001; with SO, P = Due to the interaction between TS and SO, a secondary statistical test indicated the efficacy of factor SO: without TS, P=0.002; with TS, P = a,b,c Within a row, means without a common superscripts letter differ, Pb0.05. statistical test indicated that the effect of TS on protozoa population was dependent on the SO. Without addition of SO, the inhibitory effect of TS was significant (P=0.04), but when added with SO, the effect of TS on protozoa population was not significant (P=0.68). Populations of methanogens relative to total bacterial 16 S rdna was inhibited by addition of SO (Pb0.05), but not influenced by TS. Population of R. flavefaciens was lowest in lambs fed the diet containing SO only (Pb0.05). Addition of SO reduced the population of F. succinogenes (P=0.05), while addition of TS had little effect on the population of R. flavefaciens or F. succinogenes. 4. Discussion 4.1. Effects on methane release In the current study, addition of TS, SO, and TS SO reduced methane production by 27.7, 13.9 and 18.9%, respectively, as compared with the NTNS. The inhibitory effect of TS on methane production was higher than that reported by Yuan et al. (2007), who added 5 g TS/d to adult sheep. This may be due to the difference in the activity of rumen microorganism between young and mature sheep. The effectiveness of adding lipids to the diet on methane production depends on many factors including level of supplementation, fat source, fatty acid profile, form in which the fat is administered, the type of diet, etc. (Beauchemin et al., 2008). Numerous authors have reported that supplementation of oils rich in C 18 -fatty acids can reduce methane production in vitro (Broudiscou et al., 1990, 1994; Van Nevel and Demeyer, 1996) and in vivo (Czerkawski et al., 1966; Jordan et al., 2006), while Cosgrove et al. (2008) found that up to 5% oil infusion did not affect methane production. In a previous study, Zhang (2008) observed that the addition of soybean oil at 7% of DM decreased in vitro methane emission significantly. A distinct toxicity of unsaturated fatty acids has been shown for several species of bacteria (Galbraith et al., 1971) and protozoa (Matsumoto et al., 1991). These toxic effects may be attributed to surface-active fatty acids attaching to the cell wall and hindering the transfer of essential nutrients (Henderson, 1973) Effects on fermentation characteristics Addition of TS reduced the ph in rumen. Same results have been observed in vitro (Hu et al., 2005) and in vivo (Yuan et al., 2007). The decrease of ph by TS and SO may be due to the increase in rumen VFAs, which represent the rumen fermentation pattern and the efficiency of nutrient digestion. In this study, the concentrations of acetate, propionate and Fig. 1. Diurnal pattern of methane emission from sheep in a chamber fed diets with different additives: no tea saponins or soybean oil (- - NTNS), tea saponins (- - TS 3 g/kg DM), soybean oil (- - SO 3% DM), tea saponins plus soybean oil (- - TS 3 g/kg DM plus SO, 3% DM). All lambs had similar diurnal pattern of methane emissions. Methane emissions were increased rapidly after the animals were fed, and then decreased slowly until the next feeding.

5 60 H.-L. Mao et al. / Livestock Science 129 (2010) Table 4 Ruminal ph, ammonia N, VFAs and microbial protein variables for lambs fed diets with tea saponins, soybean oil, or tea saponins plus soybean oil. Items Diets 1 P-value NTNS TS SO TS SO SEM TS SO TS SO Ruminal ph 6.9 a 6.8 b 6.8 b 6.7 c Total VFAs 2, mmol/l 22.9 b 25.9 a 25.9 a 26.9 a Molar proportions, % Acetate Propionate Butyrate Acetate: propionate Ammonia N, mg/l a a b b Microbial protein, mg/ml 3.8 b 4.9 a 5.1 a 5.2 a Diets: NTNS =no tea saponins or soybean oil; TS=tea saponins; SO=soybean oil; TS SO=tea saponins plus soybean oil. 2 VFA =volatile fatty acid. a,b,c Within a row, means without a common superscripts letter differ, Pb0.05. butyrate were not significantly changed when lambs were fed the diet containing TS, confirming the in vitro result that TS had minor effect on the pattern of rumen fermentation (Hu et al., 2005). Jouany (1996) reported that ciliates protozoa contribute significantly to intraruminal cycling of microbial N. Thus, reducing protozoa populations could cause lower bacterial protein breakdown and result in more MCP flow to the intestine. In the current study, the MCP was higher and ammonia-n concentration was lower in the lambs fed diets with TS, SO, and TS SO, compared to the NTNS Effects on rumen microbes The methane-suppressing effects of saponins are presumably a direct action against the rumen microbes involved in methane formation including methanogens and protozoa (Finlay et al., 1994). However, in our previous in vitro studies, we have found that TS have an inhibitory effect on protozoa population, but not on methanogens directly (Hu et al., 2005; Guo et al., 2008). Protozoa were sensitive to saponins because their membrane sterols bind with saponins (Wina et al., 2005). A 54% decrease in protozoa counts and 20% decline in in vitro methane release by the saponin rich fruit (S. saponaria) have been reported (Hess et al., 2003), but without effects on methanogens. The same result was observed in this study. It was inferred that addition of TS did not have direct action on methanogens, but reduced the activity of methanogen for a lower supplying of hydrogen by defaunation. In a pure culture study, Guo et al. (2008) did not observe any inhibitory effect of TS on Methanobrevibacter ruminantium, the dominant methanogen in the rumen. The methane-suppressing effects of TS could lead to accumulations of hydrogen. Unsaturated fatty acids may be a good electric acceptor for hydrogen. The amount of total metabolic hydrogen used in the biohydrogenation process of unsaturated fatty acids is small (1%), compared with that used for reduction of CO 2 to methane (48%), VFA synthesis (33%), and bacterial cell synthesis (12%) (Czerkawski, 1986). Therefore, the major reason for the decrease in methane production by addition of unsaturated fatty acids, was not related to the biohydrogenation process requiring metabolic hydrogen produced during fermentation (Van Nevel and Demeyer, 1996; Cosgrove et al., 2008), but a direct action against the rumen microbes involved in methane (Hegarty, 1999; Zhang et al., 2008). The fact that no positive associative effect existed between TS and SO on methane suppression in this study may confirm this. Rumen protozoa were thought to be of importance in methane production because of the association of protozoa with ecto- and endo-symbiotic methanogens (Finlay et al., 1994). In the absence of protozoa, methane may be decreased by 20% in both short- and longterm defaunated animals (Morgavi et al., 2008). In the study of Broudiscou et al. (1990), both protozoa proportion (in rumen fluid of refaunated sheep) and in vitro methane production (defaunated and refaunated sheep as rumen fluid donors) were reduced by addition of 7% soya oil of DM to the diet of donor sheep. These results were consistent with the present observa- Table 5 Effects of addition of tea saponins, soybean oil, or tea saponins plus soybean oil on microbial populations (% of total bacterial 16 S rdna). Items Diets 1 P-value NTNS TS SO TS SO SEM TS SO TS SO Methanogens 0.34 a 0.36 a 0.20 b 0.24 b Protozoa 9.71 a 5.72 b 4.71 b 5.42 b Fungi, R. flavefaciens, a 0.70 ab 0.28 b 0.76 ab F. succinogenes 1.00 ab 1.29 a 0.68 b 0.81 ab Diets: NTNS =no tea saponins or soybean oil; TS=tea saponins; SO=soybean oil; TS SO=tea saponins plus soybean oil. 2 Due to the tendency of interaction between TS and SO, a secondary statistical test indicated the efficacy of factor TS: without SO, P=0.04; with SO, P = Due to the tendency of interaction between TS and SO, a secondary statistical test indicated the efficacy of factor SO: without TS, P=0.02; with TS, P=0.86. a,b,c Within a row, means without a common superscripts letter differ, P b0.05.

6 H.-L. Mao et al. / Livestock Science 129 (2010) tions. Addition of oils also decreased the methane production in defaunated sheep (Van Nevel and Demeyer, 1996), suggesting that the elimination of methanogens that are associated with protozoa is not the only causes of methane suppression. In this study, lambs fed the diet containing only SO also decreased the population of methanogens by 41.2%, compared with lambs fed the NTNS. It seems that SO rich in C 18 -fatty acids suppressed the methane release by depressing the proportion of both protozoa and methanogens. However, reduction in methanogenic numbers did not always follow a pattern similar to protozoa population. About 52.2% of protozoa population was decreased in lambs fed the diet with only SO, while reduction in methanogens was about 41.2%, suggesting that the sensitivity of protozoa to SO may be higher than methanogens. The methanogens which live in association with protozoa would decrease together with protozoa, while the rest of methanogens that reside freely in the rumen might not be affected by additives to the same extent (Wina et al., 2005). Fibrolytic microbes responded to additives differently. The relative abundance of Ruminococcus was little affected by TS, but Wang et al. (2000) reported that the growth of Ruminococcus was negatively affected by saponins from Yucca. Saponins from Sesbania pachycarpa enhanced the growth of Ruminococcus (Muetzel et al., 2003). The differences among these results may be due to the different types of saponins present. The Fibrobacter was not affected by TS either. Fibrobacter is classified as Gram negative bacterium, possessing two membranes in their cell walls. These membranes may protect them from substances like TS (Wina et al., 2005). As Wang et al. (2000) noted, the Gram negative bacterium are more resistant than Gram positive bacterium including Ruminococcus. Addition of TS had no effect on fungi. Wina et al. (2005) observed that the toxicity of feeding saponins at high levels occurred to protozoa, fungi and bacteria. Soybean oil rich in unsaturated C 18 -fatty acids showed toxicity to fibrolytic microbes, F. succinogenes and R. flavefaciens. However, adding SO did not decrease ruminal fiber fermentability, as evidenced by little changes in acetate. This result was inconsistent with Zhang et al. (2008), who observed lower proportion of acetate and higher propionate with increasing levels of C 18 -fatty acids and degree of unsaturation. Further work is needed to clarify the relationship between fibrolytic microbes and fiber digestion. 5. Conclusions No negative effect was observed on growth performance when TS and SO was added to the diet of growing lambs. Addition of TS and SO decreased the methane release, with the TS addition being more efficient. Rumen fermentation patterns did not change by addition of TS or SO. Addition of TS reduced ruminal protozoa population relative to total bacterial 16 S rdna, but had little effect on the relative abundance of methanogens. Populations of methanogens and protozoa were decreased by SO, and addition of SO also inhibited the population of fibrolytic microbes, F. succinogenes and R. flavefaciens. It is concluded that the addition of TS and SO can suppress methane emission in growing lambs by a direct action on rumen microbes, but the effects on protozoa, methanogens and fibrolytic microbes made by TS and SO seems different. Acknowledgements This study was supported in part by grants from the National Key Technologies R&D Program, China (2006BAD14B07-3) and Co-ordinated Research Projects from Joint FAO/IAEA Division, IAEA (contract no /R0). References Beauchemin, K.A., Kreuzer, M., O'Mara, F., McAllister, T.A., Nutritional management for enteric methane abatement: a review. Aust. J. Exp. Agric. 48, Broudiscou, L., Van Nevel, C.J., Demeyer, D.I., Incorporation of soya oil hydrolysate in the diet of defaunated or refaunated sheep: effect on rumen fermentation in vitro. Arch. Anim. Nutr. 40, Broudiscou, L., Pochet, S., Poncet, C., Effect of linseed oil supplementation on feed degradation and microbial synthesis in the rumen of ciliate-free and refaunated sheep. Anim. Feed Sci. Technol. 49, Cosgrove, G.P., Waghorn, G.C., Anderson, C.B., Peter, J.S., Smith, A., Molano, G., Deighton, M., The effect of oils fed to sheep on methane production and digestion of ryegrass pasture. Aust. J. Exp. Agric. 48, Czerkawski, J.W., Blaxter, K.L., Wainman, F.W., The metabolism of oleic, linoleic and linolenic acids by sheep with reference to their effects on methane production. Br. J. Nutr. 20, Czerkawski, J.W., An Introduction to Rumen Studies. Pergamon Press, Oxford (UK)/New York (NY, USA. Denman, S.E., McSweeney, C.S., Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 58, Denman, S.E., Tomkins, N.W., McSweeney, C.S., Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol. Ecol. 62, Finlay, B.J., Esteban, G., Clarke, K.J., Williams, A.G., Embley, T.M., Hirt, R.P., Some rumen ciliates have endosymbiotic methanogens. FEMS Microbiol. Lett. 117, Galbraith, H., Miller, T.B., Paton, A.M., Thompson, J.K., Antibacterial activity of long chain fatty acids and the reversal with calcium, magnesium, ergocalciferol and cholesterol. J. Appl. Bact. 34, Guo, Y.Q., Liu, J.X., Lu, Y., Zhu, W.Y., Denman, S.E., McSweeney, C.S., Effect of tea saponin on methanogenesis, microbial community structure and expression of mcra gene, in cultures of rumen microorganisms. Lett. Appl. Microbiol. 47, Hegarty, R.S., Reducing rumen methane emissions through elimination of rumen protozoa. Aust. J. Exp. Agric. 50, Henderson, C., The effects of fatty acids on pure cultures of rumen bacteria. J. Agric. Sci. Camb. 81, Hess, H.D., Kreuzer, M., Diaz, T.E., Lascano, C.E., Carulla, J.E., Soliva, C.R., Machmuller, A., Saponin rich tropical fruits affect fermentation and methanogens in faunated and defuanted rumen fluid. Anim. Feed Sci. Technol. 109, Hristov, N.A., McAllister, T.A., Van Herk, F.H., Cheng, K.J., Newbold, C.J., Cheeke, P.R., Effect of Yucca schidigera on ruminal fermentation and nutrient digestion in heifers. J. Anim. Sci. 77, Hu, W.L., Liu, J.X., Ye, J.A., Wu, Y.M., Guo, Y.Q., Effect of tea saponin on rumen fermentation in vitro. Anim. Feed Sci. Technol. 120, Hu, W.L., Liu, J.X., Wu, Y.M., Guo, Y.Q., Ye, J.A., Effects of tea saponins on in vitro ruminal fermentation and growth performance in growing Boer goat. Arch. Anim. Nutr. 60, Jalč, D., Čerešňáková, Z., Effect of plant oils and malate on rumen fermentation in vitro. Czech. J. Anim. Sci. 47, Johnson, K.A., Johnson, D.E., Methane emissions from cattle. J. Anim. Sci. 73, Jordan, E., Kenny, D., Hawkins, M., Malone, R., Lovett, D.K., O'Mara, F.P., Effect of refined soy oil or whole soybeans on intake, methane output, and performance of young bulls. J. Anim. Sci. 84, Jouany, J.P., Effect of rumen protozoa on nitrogen utilization by ruminants. J. Nutr. 126, Matsumoto, M., Kobayashi, T., Takenaka, A., Itabashi, H., Defaunation effects of medium-chain fatty acids and their derivates on goat rumen protozoa. J. Gen. Appl. Microbiol. 37,

7 62 H.-L. Mao et al. / Livestock Science 129 (2010) McGinn, S.M., Beauchemin, K.A., Coates, T., Colombatto, D., Methane emissions from beef cattle: Effects of monensin, sunflower oil, enzymes, yeast, and fumaric acid. J. Anim. Sci. 82, Ministry of Agriculture, MOA, PRC, Feeding Standard of Meatproducing Sheep and Goats (NY/T ). China Agricultural Press, Beijing, China. Morgavi, D.P., Jouany, J.P., Martin, C., Changes in methane emission and rumen fermentation parameters induced by refaunation in sheep. Aust. J. Exp. Agric. 48, Muetzel, S., Hoffmann, E.M., Becker, K., Supplementation of barley straw with Sesbania pachcarpa leaves in vitro: effects on fermentation variables and rumen microbial concentration structure quantified by ribosomal RNA-targeted probes. Br. J. Nutr. 89, Prins, R.A., Van Nevel, C.J., Demeyer, D.I., Pure culture studies of inhibitors for methanogenic bacteria. Antonie Van Leeuwenhoek 38, Robinson, P.H., Wiseman, J., Udén, P., Mateos, G., Some experimental design and statistical criteria for analysis of studies in manuscripts submitted for consideration for publication. Anim. Feed Sci. Technol. 129, SAS, Version SAS Inst Inc, Cary, NC, USA. Ungerfeld, E.M., Rust, S.R., Burnett, R., Use of some novel alternative electron sinks to inhibit ruminal methanogenesis. Reprod. Nutr. Dev. 43, Van Nevel, C.J., Demeyer, D.I., Control of rumen methanogenesis. Environ. Monit. Assess. 42, Wang, Y.X., McAllister, T.A., Yanke, L.J., Xu, Z.J., Cheeke, P.R., Cheng, K.J., In vitro effects of steroidal saponins from Yucca Schidiigera extract on rumen microbial protein synthesis and ruminal fermentation. J. Sci. Food Agric. 80, Wang, Y., McAllister, T.A., Newbold, C.J., Cheeke, P.R., Cheng, K.J., Effects of yucca extract on fermentation and degradation of saponins in the Rusitec. Proc. Western Sec. Am. Soc. Anim. Sci., 48, pp Nashville, Tennessee, USA. Wina, E., Muetzel, S., Hoffmann, E., Makkar, H.P.S., Becker, K., Saponins containing methanol extract of Sapindus rarak affect microbial fermentation, microbial activity and microbial community structure in vitro. Anim. Feed Sci. Technol. 121, Yuan, Z.P., Zhang, C.M., Zhou, L., Zou, C.X., Guo, Y.Q., Li, W.T., Liu, J.X., Wu, Y.M., Inhibition of methanogenesis by tea saponin and tea saponin plus disodium fumarate in sheep. J. Anim. Feed Sci. 7 (Suppl.2), Zhang, C.M., Effects of vegetable oils and unsaturated octadeca carbon fatty acids on ruminal methanogesis and microbial ecology. Thesis for Doctoral Degree, Zhejiang University, P.R. China. (in Chinese with English abstract) Zhang, C.M., Guo, Y.Q., Yuan, Z.P., Wu, Y.M., Wang, J.K., Liu, J.X., Zhu, W.Y., Effect of octadeca carbon fatty acids on microbial fermentation, methanogenesis and microbial flora in vitro. Anim. Feed Sci. Technol. 146 (3 4),