The effectiveness of zinc proteinate for chicks fed a conventional corn-soybean meal diet

Transcription

1 2013 Poultry Science Association, Inc. The effectiveness of zinc proteinate for chicks fed a conventional corn-soybean meal diet S. B. Liu,* S. F. Li,* L. Lu,* J. J. Xie,* L. Y. Zhang,* R. L. Wang, and X. G. Luo * 1 * Mineral Nutrition Research Division, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing , P. R. China; Wen s Foodstuffs Group Corporation Ltd., Yunfu , P. R. China; Department of Animal Science, Hebei Normal University of Science and Technology, Qinhuangdao , P. R. China; and Department of Animal Science, Guangdong Ocean University, Zhanjiang , P. R. China Primary Audience: Nutritionists, Researchers SUMMARY An experiment was conducted to investigate the effectiveness of organic zinc (Zn) proteinate relative to inorganic Zn sulfate for chicks fed a conventional corn-soybean meal basal diet. A total of 576 one-day-old chicks were fed a Zn-unsupplemented corn-soybean meal basal diet (control) or the basal diet supplemented with 10, 20, 40, or 80 mg of Zn/kg from each Zn source for 21 d. As compared with birds fed diets supplemented with Zn sulfate, broilers fed the diets supplemented with Zn proteinate had higher (P = 0.048) ADFI and higher (P = 0.106) ADG values. Meanwhile, birds fed the diets supplemented with Zn proteinate had higher (P < 0.05) Zn concentrations in plasma and tibia ash than those fed the diets supplemented with Zn sulfate. Plasma Zn concentrations, tibia ash Zn contents, and pancreas metallothionein mrna level increased linearly (P < 0.001) as dietary Zn level increased. Based on the slope ratios from multiple linear regressions of tibia ash Zn concentration and pancreas metallothionein mrna level with daily analyzed Zn intake, no significant (P > 0.05) difference in bioavailability was observed between Zn proteinate and Zn sulfate for chicks, which might be explained by the weak chelation strength of the Zn proteinate. Zinc from Zn proteinate was as available as Zn from Zn sulfate for broilers; however, Zn proteinate was more effective than Zn sulfate in enhancing feed intake and tended to improve the growth rate of broilers. Key words: zinc proteinate, effectiveness, bioavailability, broiler chick 2013 J. Appl. Poult. Res. 22 : DESCRIPTION OF PROBLEM Zinc (Zn) is known to be essential for growth, skeletal development, and immune competence of chickens [1 3]. Inorganic Zn salts, such as sulfate and oxide, are generally supplemented in diets to meet the Zn requirement of chickens [4]. In recent years, organic Zn products have been developed and reported to be more effective than inorganic Zn used in chicken feeds [4 6]. However, in some studies [7, 8], no differences in bioavailability were observed between organic and inorganic forms of Zn products. These discrepancies might be related to the degree of che- 1 Corresponding author: wlysz@263.net

2 Liu et al.: ZINC PROTEINATE EFFECTIVENESS 397 lation or complexation of the Zn ion to organic ligands [8]. Currently, a new form of organic Zn proteinate has been produced, which has a much more complicated structure and composition than commonly used single- or multiple-complexed amino acid or chelated Zn. In previous studies, this Zn proteinate was more effective in promoting growth [9] with less interaction with other minerals [10, 11] than Zn sulfate for chicks. However, the relative bioavailability of this Zn proteinate has not been experimentally verified. Bone Zn accumulation is generally used to measure the bioavailability of different Zn sources for chicks [12 16]. Metallothionein (MT), a Zn-binding protein, plays a critical role in Zn transport and storage [17]. Previously, in our laboratory, we observed that the pancreas MT mrna level of chicks was positively related to dietary Zn level [18]. Pancreas MT mrna level was more sensitive than tibia Zn concentration in differentiating the differences in the bioavailability of various Zn sources for chicks in a short time trial [8]. Therefore, the objective of this study was to test the effectiveness of the new Zn proteinate compared with inorganic Zn for broiler chicks fed a conventional corn-soybean meal basal diet by observing growth performance and using bioavailability comparisons based on the tibia Zn concentration and pancreas MT mrna level of chicks. MATERIALS AND METHODS Experimental Design and Treatments A completely randomized design involving a 1 (control) plus 2 4 factorial arrangement of treatments was used in this experiment. One control was the Zn-unsupplemented basal diet treatment. The 2 supplemental Zn sources were Zn proteinate and Zn sulfate, respectively, and the 4 added Zn levels were 10, 20, 40, or 80 mg of Zn/kg, respectively. Therefore, a total of 9 treatments were used in this study. Birds All experimental procedures were approved by the Animal Research Center at the Veterinarian Office of Beijing. A total of 576 one-dayold Arbor Acres commercial male chicks were randomly allotted by weight to 1 of 9 treatments for 8 replicate cages of 8 birds each. Birds were housed in electrically heated, thermostatically controlled, plastic-coated stainless steel cages with fiberglass feed and water containers ( cm) and maintained on a 24-h constant light schedule. Feed and tap water were available for ad libitum consumption for 21 d. The Zn concentration in tap water was determined to be less than 0.10 mg/l. Birds were weighed and feed intake was recorded at the end of every week. Diets The corn-soybean basal diet (containing mg of Zn/kg by analysis; Table 1) was formulated to meet the nutrient requirements of starting chicks [19] except for Zn. The Zn sources were added to the basal diet according to the experimental treatments. The reagent-grade Zn sulfate (ZnSO 4 7H 2 O) contained 22.70% Zn on a basis of analysis [20]. The Zn proteinate was supplied by Alltech [21], and its purity was about 90.0%, containing 15.80% Zn on a basis of analysis. The value of formation quotient (Q f ) is a quantitative measurement of chelation or complex strength between metal and ligand [22]. The Q f value of Zn proteinate was analyzed to be as low as 1.98, therefore, it was an organic Zn product with a weak chelation strength based on the classification of Holwerda et al. [22]. This Zn proteinate was obviously different from the Zn proteinate with the very strong chelation strength (Q f = 944) used in our previous study [8]. Lysine or Met concentration in each treatment diet was balanced by supplementation of additional Lys-HCl or dl-met. The Zn levels of diets supplemented with Zn sulfate were 35.6, 42.6, 67.0, and 104 mg/kg by analysis on an asfed basis, respectively, and the Zn levels of diets supplemented with Zn proteinate were 34.5, 43.8, 64.5, and 101 mg/kg by analysis on an asfed basis, respectively, as shown in Table 2. Sample Collections and Preparations The corn-soybean meal and diet samples were taken and submitted for CP, Ca, and Zn analyses before the initiation of the trial to confirm CP, Ca, and Zn in diets. The Zn content in

3 398 JAPR: Research Report Table 1. Composition of the basal diet for broilers (asfed basis) Item Amount Ingredient, % Yellow ground corn Soybean meal Soybean oil 3.30 CaHPO 4 2H 2 O CaCO NaCl dl-met 0.22 Micronutrients Cornstarch + Zn Calculated nutrient composition, % ME, MJ/kg CP Lys 1.16 Met 0.54 Met + Cys 0.90 Ca Nonphytate P 0.45 Zn, 4 mg/kg Reagent grade. 2 Provided per kilogram of diet: 15,000 IU of vitamin A (alltrans retinol acetate); 5,100 IU of cholecalciferol; 19.2 IU of vitamin E (all-rac-α-tocopherol acetate); 2.4 mg of vitamin K (as menadione sodium bisulfate); 1.2 mg of thiamin (thiamin mononitrate); 10.2 mg of riboflavin; 2.4 mg of vitamin B 6 ; mg of vitamin B 12 ; 12 mg of calcium pantothenate; 39 mg of niacin; 1.2 mg of folic acid; mg of biotin; 700 mg of choline (choline chloride); 8 mg of Cu (CuSO 4 5H 2 O); 100 mg of Mn (MnSO 4 H 2 O); 80 mg of Fe (FeSO 4 7H 2 O); 0.35 mg of I (KI); 0.15 mg of Se (Na 2 SeO 3 ). 3 Zinc supplement added in place of equivalent weight of cornstarch. 4 Analyzed values and each value based on triplicate determinations. the tap water was also analyzed. The Zn proteinate was sampled for analyses of Zn, amino acids contents, and Q f. At 21 d of age, 3 chicks were chosen from each of the 72 cages (n = 216) according to average BW. Blood samples were taken from each of 3 birds via cardiac puncture by using a 5-mL sterilized syringe and 21-gauge 1.5-in. needle, and plasma was obtained by centrifugation (1,500 g, 10 min, 4 C) of the blood sample and was used for subsequent determination of Zn concentration. The chicks were then killed by cervical dislocation. The pancreas was immediately collected and frozen in liquid N for MT mrna analysis. The right tibia was collected for analyses of ash weight and Zn concentration. Tibia ash weight was normalized by BW. All plasma and tibia samples were stored at 20 C until analyses. All samples from 3 chicks Table 2. Analyzed Zn concentrations in diets for broilers (as-fed basis) Zn source in each cage were pooled into 1 sample in an equal ratio for Zn concentration and MT mrna level analyses (thus, n = 8). Sample Analyses Added Zn, mg/kg Analyzed Zn, 1 mg/kg Control ZnSO 4 7H 2 O Zn proteinate Values based on triplicate determinations of diet samples. Zinc concentrations in each Zn source, water, diet, plasma and tibia samples, or Ca in feed ingredient or diet samples were measured by inductively coupled plasma emission spectroscopy [23] after wet digestions with HNO 3 and HClO 4 as described by Huang et al. [8]. Tibia ash weight was analyzed by the method described by Huang et al. [8]. Concentrations of CP in feed ingredients or diets were determined as described by AOAC [24] method (procedure ). Amino acids of Zn proteinate were analyzed using an amino acid analyzer [25]. Before analysis, samples were hydrolyzed in 6 N HCl for 24 h at 110 C under a nitrogen atmosphere. Methionine and Cys were acid-hydrolyzed after performic acid oxidation. For Trp analysis, samples were hydrolyzed by using barium hydroxide. The amino acids in the hydrolysate were determined by HPLC after postcolumn derivatization (AOAC [24]; method E [a, b, c]). The value of Q f was determined by polarography as described by Holwerda et al. [22] and Cao et al. [6]. The total RNA was isolated from pancreas tissue using the Trizol reagent [26] according to the manufacturer s instructions. The RNA concentration was measured using a Nano Drop ND-1000 spectrofluorometer [27] and the quality of total RNA was determined in agarose gels stained with ethidium bromide. One microgram of total RNA was subjected to reverse transcrip-

4 Liu et al.: ZINC PROTEINATE EFFECTIVENESS 399 tion by using the Super Script First-Strand Synthesis System [26]. Real-time PCR reactions were performed on an ABI 7500 real-time PCR system, using SYBR-Green PCR Master Mix [28]. Specific primers based on known sequences of chicks used in PCR and their gene bank accession numbers were: MT (NM_ ), forward primer (5-3 ) = GCAACAACT- GTGCCAAGGGC, reverse primer (5-3 ) = TTTCGTGGTCCCTGTCACCC; β-actin (NM_ ), forward primer (5-3 ) = GAGAAATTGTGCGTGACATCA, reverse primer (5-3 ) = CCTGAACCTCTCATTGCCA. The amplification reactions were performed for 10 min at 95 C and 40 cycles of 94 C for 15 s and 60 C for 1 min. Each gene was amplified independently in triplicate within a single instrument run. Relative mrna expression of MT gene was calculated using the 2 ΔΔct method reported by Livak and Schmittgen [29], and β-actin was chosen as reference to normalize the relative level of MT mrna. Statistical Analyses To test the effect of supplemental Zn, data were analyzed using single degree of freedom contrast to compare all supplemental Zn treatments with the control [30]. Data excluding the control were analyzed by 2-way ANOVA using the GLM procedure of SAS [31]. The replicate cage served as the experimental unit. The model included the main effects of Zn source, added Zn level, and their interaction. Differences among means were tested by the LSD method. Orthogonal polynomials were used to assess linear and quadratic responses of dependent variables to dietary Zn levels. Relative bioavailability value of Zn proteinate was determined by slope ratio comparison based on multiple linear regressions using Zn sulfate as the standard source [8, 32]. Because feed intake was affected (P < 0.01) by Zn source and added Zn level, regression was calculated using daily intake of analyzed dietary Zn as the independent variable. Slope ratio and SE were estimated using the method of error propagation as described by Littell et al. [32]. Difference between sources was determined by difference in their respective regression coefficients; P < 0.05 was considered to be statistically significant. RESULTS AND DISCUSSION Growth Performance of Broiler Chicks Compared with the control chicks, chicks fed diets supplemented with Zn had higher (P < 0.02) ADG and ADFI in this study (Table 3). The Zn source, added Zn level, and their interaction did not affect (P > 0.05) FCR. The added Zn level and the interaction between Zn source and added Zn level did not affect (P > 0.05) ADG or ADFI. However, the Zn source significantly affected (P < 0.05) ADFI, in which the birds fed the diets supplemented with Zn proteinate had higher (P < 0.05) ADFI than those fed the diets supplemented with Zn sulfate. Although no significant effect (P > 0.05) of Zn source was detected on ADG, the birds fed the diets supplemented with Zn proteinate tended to have higher (P = 0.106) ADG compared with those fed the diets supplemented with Zn sulfate. Tibia Ash Weight, Tissue Zn Concentrations, and Pancreas MT mrna Level Compared with the control chicks, chicks fed diets supplemented with Zn had higher (P < 0.001) Zn concentrations in plasma, tibia ash Zn, and pancreas mrna level (Table 4). The Zn source, added Zn level, and their interaction did not affect (P > 0.05) tibia ash weight. No interactions (P > 0.05) between Zn source and added Zn level were observed in Zn concentrations in plasma and tibia ash and pancreas MT mrna level. However, added Zn level affected (P < 0.05) Zn concentrations in tibia ash and pancreas MT mrna level. As added Zn level increased, plasma Zn, Zn in tibia ash, and pancreas MT mrna increased linearly (P < 0.001). Zinc source affected (P < 0.05) Zn concentrations in plasma and tibia ash, but not (P > 0.05) pancreas MT mrna level. Estimation of Relative Bioavailability of Zn Proteinate Because no significant (P > 0.05) linear regression relationship was observed between plasma Zn concentration and daily dietary analyzed Zn intake, the relative bioavailability values were estimated only based on multiple linear regressions of tibia ash Zn and pancreas MT

5 400 JAPR: Research Report Table 3. Effects of Zn source and level on growth performance of broiler chicks Item Added Zn level, mg/kg ADG, g/d ADFI, /d G:F, g/g Control * 38.6* 1.38 ZnSO 4-7H 2 O Zn proteinate Pooled SE Zn source 2 ZnSO 4-7H 2 O b 1.38 Zn proteinate a 1.38 Pooled SE Added Zn level Pooled SE P-value Zn source Added Zn level Source level a,b Means with different superscripts between Zn sources differ (P < 0.05). 1 Data represent the means of 8 replicate cages (n = 8). 2 Data represent the means of 32 replicate cages (n = 32). 3 Data represent the means of 16 replicate cages (n = 16). *Different from all supplemental Zn groups (P < 0.02). mrna level on daily dietary analyzed Zn intake (Table 5). However, as for tibia ash Zn concentration and pancreas MT mrna level, the added Zn levels of both 40 and 80 mg/kg were deleted in multiple linear regressions to improve linear response. When the response to Zn sulfate was set at 100%, the estimated relative bioavailability values of Zn proteinate were 105.0% for tibia ash Zn concentration and 103.8% for pancreas MT mrna level, respectively. No significant difference (P > 0.05) in bioavailability was observed for broilers between the 2 Zn sources. In the present study, added Zn significantly increased feed intake of chicks regardless of Zn source, which was in agreement with previous reports [5, 13, 18]. This might be explained by the role of Zn in the appetite regulation for chicks [33, 34]. However, understanding the mechanisms that Zn regulates feed intake is a daunting challenge for all animals [35]. It was interesting that Zn proteinate was more effective than Zn sulfate in enhancing feed intake and tending to improve the growth rate of broilers in the current study, which was consistent with published data by Ao et al. [9]; however, reasons for this need to be further investigated. The higher feed intake, and thus the higher dietary Zn intake, might explain why the birds fed the diets supplemented with Zn proteinate had higher Zn concentrations in plasma and tibia ash than those fed the diets supplemented with Zn sulfate. In addition, Ao et al. [10] also reported that the Zn proteinate caused more Zn accumulation in the tibia of chicks than inorganic Zn source, and the mechanism for this might be explained by the antagonism occurring between Zn and other minerals (such as Cu) when the inorganic forms, but not organic forms were included in diet. The bioavailability of Zn is defined as the degree to which an ingested Zn in a particular source is absorbed in a form that can be used in metabolism by the animals [36]. The sensitive criterion is important for the estimation of bioavailability for different Zn sources. Most

6 Liu et al.: ZINC PROTEINATE EFFECTIVENESS 401 Table 4. Effects of Zn source and level on tibia ash weight, Zn concentrations in plasma and tibia ash, and pancreas metallothionein (MT) mrna level of broiler chicks on d 21 Item Added Zn, mg/kg Plasma Zn, μg/ml Tibia ash weight, g/kg of BW Tibia ash Zn, μg/g Pancreas MT mrna, 1 RQ Control * * 0.336* ZnSO 4-7H 2 O Zn proteinate Pooled SE Zn source 3 ZnSO 4-7H 2 O 1.61 B B Zn proteinate 1.69 A A Pooled SE Added Zn level c b b ab a a a a Pooled SE P-value Zn source Added Zn level < Source level Linear 5 < <0.001 <0.001 A,B Means with different superscripts between Zn sources differ (P < 0.05). a c Means with different superscripts among added Zn levels differ (P < 0.01). 1 The MT mrna level was calculated on fresh basis as the relative quantities (RQ) of MT mrna to β-actin mrna; RQ = 2 ΔΔCt. 2 Data represent the means of 8 replicate cages (n = 8). 3 Data represent the means of 32 replicate cages (n = 32). 4 Data represent the means of 16 replicate cages (n = 16). 5 Linear effects of added Zn levels. *Different from all supplemental Zn groups (P < 0.001). previous studies were conducted to estimate the bioavailability of different Zn sources by using a purified diet based on growth performance and bone Zn as response criteria [7, 13, 15, 16]. However, the estimated results with a purified diet might not be applicable to conventional diets due to their higher levels of phytate and fiber [5]. Wedekind et al. [5] developed a procedure to determine relative bioavailability based on tibia Zn accumulation by using a corn-soybean meal basal diet with adequate Zn supplementation. Subsequently, many follow-up studies have been reported using this approach to estimate the relative availabilities of Zn sources for chicks [4, 6, 14] despite some studies showing evidence that bone Zn is not a sensitive criterion for the assessment of bioavailability of Zn sources for broilers [5, 8, 14]. The MT is a low molecular weight protein with high cysteine content, and has a high Znbinding capacity [17]. Tissue MT concentrations are often proportional to Zn status and, in response to dietary Zn [4, 6, 8, 18], MT might potentially be a useful biomarker to measure the bioavailability of different Zn sources under normal physiological conditions. However, MT concentrations in liver and pancreas have been shown to not be sensitive criteria for assessment of bioavailability in different Zn sources for broilers [4, 6, 8]. Huang et al. [8] found that pancreas MT mrna was more sensitive than bone Zn or other indices in detecting the differ-

7 402 JAPR: Research Report Table 5. Relative bioavailability values (RBV) of Zn based on slope ratios from multiple linear regressions of Zn concentration in tibia ash and pancreas metallothionein (MT) mrna level on daily dietary analyzed Zn intake of broilers during d 1 to 21 1 Regression coefficient Dependent variable Zn source Slope SE RBV, % P-value 2 Tibia ash Zn 3 ZnSO 4-7H 2 O Zn proteinate Pancreas MT mrna 4 ZnSO 4-7H 2 O Zn proteinate Daily dietary analyzed Zn intake calculated as ADFI during d 1 to 21 multiplied by the analyzed dietary Zn content of each respective treatment. Regression analysis was based on cage averages with 8 cages per treatment. 2 P-value for the difference in slopes among Zn sources. 3 Intercept = 99.6; R 2 = 0.898; P < Intercept = 0.294; R 2 = 0.285; P = ences in bioavailability of different Zn sources for chicks in a short time trial. In the present study, both tibia Zn concentration and pancreas MT mrna level of chicks were sensitive enough to respond to the dietary supplemental Zn level, which further confirmed that both tibia Zn concentration and pancreas MT mrna level were sensitive criteria for assessing Zn status of chicks fed a conventional diet. However, the differences in the bioavailability between organic and inorganic Zn sources based on the above 2 indices were not significant in this study. The bioavailability of Zn proteinate may be related to its chemical characteristics. The chelation strength of an organic mineral source and its behavior under physiological conditions are perceived as key points in determining the value of product used as a supplement in animal nutrition [37]. In our previous study, we confirmed the bioavailability of organic Zn, Cu, and Mn sources for broilers were closely related to their chelation strengths [8, 37 41]. The organic trace elements with the moderate chelation strength displayed the highest relative bioavailability, followed by elements with the strong chelation strength, and those with the weak chelation strengths were as available as their inorganic forms [8, 37 41]; however, elements with very strong chelation strength were less available than their inorganic form [8]. In the current study, the Zn proteinate is an organic Zn product with the weak chelation strength, and its relative bioavailability for broilers was similar to that of Zn sulfate, which is consistent with our previous result [8]. CONCLUSIONS AND APPLICATIONS 1. Zinc from Zn proteinate was as available as Zn from Zn sulfate for broilers, which might be explained by the weak chelation strength of this Zn proteinate. 2. Zinc proteinate was more effective than Zn sulfate in enhancing feed intake and tending to improve the growth rate of broilers. REFERENCES AND NOTES 1. O Dell, B. L., P. Newberne, and J. Savage Significance of dietary zinc for the growing chicken. J. Nutr. 65: Mohanna, C., and Y. Nys Effect of dietary zinc content and sources on the growth, body zinc deposition and retention, zinc excretion and immune response in chickens. Br. Poult. Sci. 40: Hudson, B. P., W. A. Dozier, J. L. Wilson, J. E. Sander, and T. L. Ward Reproductive performance and immune status of caged broiler breeder hens provided diets supplemented with either inorganic or organic sources of zinc from hatching to 65 wk of age. J. Appl. Poult. Res. 13: Cao, J., P. R. Henry, S. R. Davis, R. J. Cousins, R. D. Miles, R. C. Littell, and C. B. Ammerman Relative bioavailability of organic zinc sources based on tissue zinc and metallothionein in chicks fed conventional dietary zinc concentrations. Anim. Feed Sci. Technol. 101: Wedekind, K. J., A. E. Hortin, and D. H. Baker Methodology for assessing zinc bioavailability: Efficacy estimates for zinc-methionine, zinc sulfate, and zinc oxide. J. Anim. Sci. 70: Cao, J., P. R. Henry, R. Guo, R. K. Holwerda, J. P. Toth, R. C. Littell, R. D. Miles, and C. B. Ammerman Chemical characteristics and relative bioavailability of supplemental organic zinc sources for poultry and ruminants. J. Anim. Sci. 78:

8 Liu et al.: ZINC PROTEINATE EFFECTIVENESS Pimentel, J. L., M. E. Cook, and J. L. Greger Research note: Bioavailability of zinc-methionine for chicks. Poult. Sci. 70: Huang, Y. L., L. Lu, S. F. Li, X. G. Luo, and B. Liu Relative bioavailabilities of organic zinc sources with different chelation strengths for broilers fed a conventional corn-soybean meal diet. J. Anim. Sci. 87: Ao, T., J. L. Pierce, A. J. Pescatore, A. H. Cantor, K. A. Dawson, M. J. Ford, and M. Paul Effects of feeding different concentration and forms of zinc on the performance and tissue mineral status of broiler chicks. Br. Poult. Sci. 52: Ao, T., J. L. Pierce, R. Power, A. J. Pescatore, A. H. Cantor, K. A. Dawson, and M. J. Ford Effects of feeding different forms of zinc and copper on the performance and tissue mineral content of chicks. Poult. Sci. 88: Bao, Y. M., M. Choct, P. A. Iji, and K. Bruerton Trace mineral interactions in broiler chicken diets. Br. Poult. Sci. 51: Henry, P., C. Ammerman, and R. Miles Effect of dietary zinc on tissue mineral concentration as a measure of zinc bioavailability in chicks. Nutr. Rep. Int. 35: Wedekind, K. J., and D. H. Baker Zinc bioavailability in feed-grade sources of zinc. J. Anim. Sci. 68: Sandoval, M., P. R. Henry, C. B. Ammerman, R. D. Miles, and R. C. Littell Relative bioavailability of supplemental inorganic zinc sources for chicks. J. Anim. Sci. 75: Edwards, H. M., S. D. Boling, J. L. Emmert, and D. H. Baker Bioavailability of zinc in two zinc sulfate by-products of the galvanizing industry. Poult. Sci. 77: Edwards, H. M., and D. H. Baker Bioavailability of zinc in several sources of zinc oxide, zinc sulfate, and zinc metal. J. Anim. Sci. 77: Fernando, L. P., D. Y. Wei, and G. K. Andrews Structure and expression of chicken metallothionein. J. Nutr. 119: Huang, Y. L., L. Lu, X. G. Luo, and B. Liu An optimal dietary zinc level of broiler chicks fed a cornsoybean meal diet. Poult. Sci. 86: NRC Nutrient Requirements of Poultry. 9th rev. ed. Natl. Acad. Press, Washington, DC. 20. Beijing Chemical Corp., Beijing, P. R. China. 21. Alltech, Nicholasville, KY. 22. Holwerda, R.A., A. R. Albin, and F. C. Madsen Chelation effectiveness of zinc proteins demonstrated. Feedstuffs 67:12 13, Model IRIS Intrepid II, Thermal Jarrell Ash, Waltham, MA. 24. AOAC International Official Methods of Analysis. Association of Official Analytical Chemists, Arlington, VA. 25. Model L-8500A, Hitachi, Chyoudaku, Japan. 26. Invitrogen Corp., Carlsbad, CA. 27. Nano-Drop Technologies Corp., Wilmington, DE. 28. Applied Biosystems Corp., Foster City, CA. 29. Livak, K. J., and T. D. Schmittgen Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method. Methods 25: Li, S., L. Lu, S. Hao, Y. Wang, L. Zhang, S. Liu, B. Liu, K. Li, and X. Luo Dietary manganese modulates expression of the manganese-containing superoxide dismutase gene in chickens. J. Nutr. 141: SAS User s Guide Version 8 ed. SAS Inst. Inc., Cary, NC. 32. Littell, R. C., P. Henry, A. Lewis, and C. Ammerman Estimation of relative bioavailability of nutrients using SAS procedures. J. Anim. Sci. 75: Hughes, B., and W. Dewar A specific appetite for zinc in zinc-depleted domestic fowls. Br. Poult. Sci. 12: Dewar, W. A., I. Sibbald, and P. Wight The contribution of anorexia to reduced growth in zinc-deficient chickens. Br. Poult. Sci. 23: Shay, N. F., and H. F. Mangian Neurobiology of zinc-influenced eating behavior. J. Nutr. 130:1493S 1499S. 36. Baker, D. H., and C. B. Ammerman Zinc bioavailability. Pages in Bioavailability of Nutrients: Amino Acids, Minerals, and Vitamins. C. B. Ammerman, D. H Baker, and A. J. Lewis ed. Academic Press, San Diego, CA. 37. Li, S., X. Luo, B. Liu, T. Crenshaw, X. Kuang, G. Shao, and S. Yu Use of chemical characteristics to predict the relative bioavailability of supplemental organic manganese sources for broilers. J. Anim. Sci. 82: Li, S., X. Luo, L. Lu, T. Crenshaw, Y. Bu, B. Liu, X. Kuang, G. Shao, and S. Yu Bioavailability of organic manganese sources in broilers fed high dietary calcium. Anim. Feed Sci. Technol. 123: Luo, X. G., S. F. Li, L. Lu, B. Liu, X. Kuang, G. Z. Shao, and S. X. Yu Gene expression of manganesecontaining superoxide dismutase as a biomarker of manganese bioavailability for manganese sources in broilers. Poult. Sci. 86: Wang, F., L. Lu, S. Li, S. Liu, L. Zhang, J. Yao, and X. Luo Relative bioavailability of manganese proteinate for broilers fed a conventional corn soybean meal diet. Biol. Trace Elem. Res. 146: Liu, S., L. Lu, S. Li, J. Xie, L. Zhang, R. Wang, and X. Luo Copper in organic proteinate or inorganic sulfate form is equally bioavailable for broiler chicks fed a conventional corn soybean meal diet. Biol. Trace Elem. Res. 147: Acknowledgments This work was supported by Alltech Inc. (Nicholasville, KY), China Agriculture Research System (project no. CARS-42; Beijing, P. R. China), and the Special Fund for Agro-scientific Research in the Public Interest (project no ; Beijing, P. R. China).