This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

Transcription

1 This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier s archiving and manuscript policies are encouraged to visit:

2 Journal of Bioscience and Bioengineering VOL. 114 No. 6, 640e647, Production of keratinolytic enzyme by an indigenous featheredegrading strain Bacillus cereus Wu2 Wei-Hsun Lo, Jui-Rze Too, and Jane-Yii Wu * Department of BioIndustry Technology, Da-Yeh University, No. 168, University Rd., Dacun, Changhua 51591, Taiwan, ROC Received 3 July 2012; accepted 24 July 2012 Available online 19 September 2012 A novel feather-degrading microorganism was isolated from a poultry farm in Taiwan, and was identified Bacillus cereus Wu2 according to 16S rrna sequencing. The isolated strain produces keratinolytic enzyme using chicken feather as the sole carbon and nitrogen source. The experimental results indicated that the extra carbon sources (glucose, fructose, starch, sucrose, or lactose) could act as a catabolite repressor to the enzyme secretion or keratinolytic activity when keratinous substrates were employed as protein sources. However, addition of 2 g/l of NH 4 Cl to the feather medium increased the enzyme production. The optimum temperature and initial ph for enzyme production were 30 C and 7.0, respectively. The maximum yield of the enzyme was 1.75 ku/ml in the optimal chicken feather medium; this value was about 17-fold higher than the yield in the basal hair medium. The B. cereus Wu2 possessed disulfide reductase activity along with keratinolytic activity. The amino acid contents of feathers degradated by B. cereus Wu2 were higher, especially for lysine, methionine and threonine which were nutritionally essential amino acids and usually deficient in the feather meal. Thus, B. cereus Wu2 could be not only used to enhance the nutritional value of feather meal but is also a potential bioinoculant in agricultural environments. Ó 2012, The Society for Biotechnology, Japan. All rights reserved. [Key words: Keratin; Feather-degrading; Bacillus cereus; Keratinase; Poultry waste] A million tons of chicken feathers from poultry processing plants are produced as wastes annually throughout the world (1). For mature chicken, feather accounts up to 5%e7% of the live weight and is composed of over 90% crude protein, the main component being keratin, a fibrous and insoluble protein (2). Keratins are insoluble fibrous proteins highly cross-linked with disulfide bridges, hydrogen bonds, and hydrophobic interactions. The tightly packed super coiled polypeptide chains result in high mechanical stability and resistance to proteolysis by common proteases such as trypsin, pepsin, and papain (3,4). At present, feathers are converted to feather meal, a digestible dietary protein for animals, using physical and chemical treatments (5). These physico-chemical conversion methods involve costly treatments under harsh temperature and pressure conditions that result in a loss of certain heat sensitive amino acids, e.g., methionine, lysine and tryptophan (6). Heat treatment also adds to non-nutritive amino acids such as lysinoalanine and lanthionine (3,7). The microbial degradation of feather represents an alternative eco-friendly technology to improve the nutritional value of feather-meal. Nevertheless, feathers do not accumulate in nature, since structural keratin can be degraded by some microorganisms (3,8). Known keratinases are mainly produced by some species of saprophytic and parasitic fungi (9,10), actinomycetes(11e13), and some species of Bacillus produce feather-degrading enzymes (14e17),such as Bacillus pumilus (18), Bacillus subtilis (19), and Bacillus licheniformis (20). It has been proposed that use of crude keratinase prepared from B. licheniformis significantly increased the total amino acid digestibility of raw feathers and commercial feather meal (20). This enzyme increased digestibility of a commercial feather meal up to 82% and could replace up to 7% of the dietary protein for growing chickens (21). Itwas concluded that not only feather meal (keratin) could be used as protein for animal food but also the biomass of the enzymeproducing strain as well. These keratinolytic enzymes may have important applications in biotechnological and industrial processes involving keratin-containing wastes from the poultry and leather industries through the development of non-polluting processes and dehairing of skin and hides (3,7,8). Keratinolytic enzymes have been studied from a variety of fungi and, to a lesser extent, bacteria. Much current research is centered on the potential use of keratinase which was produced from bacteria. Moreover, the low ph requirement for an optimum activity of the enzymes and the long growth period are the disadvantages of using fungi. This study attempted to isolate some bacterial strains, which possessed the ability to grow on feather hydrolyzate as a sole source of carbon and nitrogen. Therefore, the aim of this study was to investigate factors affecting feather degradation by this bacterium and to evaluate nutritional values of degraded feather. MATERIALS AND METHODS * Corresponding author. Tel.: þ /1630; fax: þ address: jywu@mail.dyu.edu.tw (J.-Y. Wu). Isolation and screening of the feather degrading microorganisms The soil samples were collected from a poultry farm in Changhua, Taiwan. For each /$ e see front matter Ó 2012, The Society for Biotechnology, Japan. All rights reserved.

3 VOL. 114,2012 FEATHER-DEGRADING STRAIN B. CEREUS Wu2 641 FIG. 1. Phylogenetic tree analyzed by 16S rrna sequences with the neighbor joining methods. sample, 1 g of soil was suspended in 50 ml sterile distilled water. The supernatant was diluted and then laid on a casein agar plate containing the following (in the unit of g/l): casein (10.0), peptone (1.0), urea (0.3), (NH 4 ) 2 SO 4 (1.4), KH 2 PO 4, (2.0), CaCl 2, (0.344), MgSO 4 $7H 2 O (0.3), FeSO 4 $7H 2 O (0.005), ZnSO 4 $7H 2 O (0.014), MnSO 4 $7H 2 O (0.0098), CoCl 2 $6H 2 O (0.002), and agar (18.0). After incubation at 37 C for 48 h, clearing zones around the colony were observed to signify the protease production. A single colony with a clearing zone was picked up and inoculated on an agar plate containing the following (g/l): feather meal (10.0), NaCl (0.5), K 2 HPO 4 (0.3), and KH 2 PO 4 (0.4). The isolated strain, which formed a clearing zone on the feather meal agar plate, was then cultured in a liquid medium which consisted of (g/l): NaCl (5.0), peptone (10.0), and yeast extract (5.0). Meanwhile the isolated strain was maintained as a suspension in 20% (v/v) glycerol at 20 C for later use. Taxonomic studies and 16S rrna sequencing Bacterial identification was conducted based on morphological and biochemical tests. The 16S rrna gene of the isolated strain was sequenced after genomic DNA extraction and PCR amplification as described in Riffel and Brandelli (22). Two bacterial 16S rrna primers, F8 (AGAGTTTGATCCTGGCTCAG) and R1510 (GGTTACCTTGTTACGACTT), were used for gene amplification and sequencing. PCR was run for 40 cycles under the following steps: 94 C for 30 s, 55 C for 30 s, and 72 C for 2 min 20 s. An ABI 3730XL DNA FIG. 2. Time courses of ph, ammonia-nitrogen, and keratinase activity when B. cereus Wu2 was cultivated under various conditions. (a) Temperature and (b) various initial phs. Symbols: (a) closed circles, 30 C; open circles, 37 C; closed triangles, 40 C; closed squares, 55 C; (b): closed circles, ph 3; open circles, ph 5; closed triangles, ph 7; closed squares, ph 9; open triangles, ph 11.

4 642 LO ET AL. J. BIOSCI. BIOENG., Analyzer (Life Technologies, USA) was used for sequencing. The 1426-bp sequence was submitted to the GenBank. The nucleotide sequence of the strain was compared to any similar database sequence in the GenBank using the program BLAST version 3.2 via the NCBI site. The 16S rrna sequences were aligned, and the phylogenetic tree was booted by the BioEdit version 7.0 and MEGA 3.0 software. Culture conditions for enzyme production The isolated bacteria were cultivated at 37 C for 4 days in a medium with whole feathers as a sole source of carbon and nitrogen. The medium contained the following (g/l): raw chicken feathers (10.0), MgSO 4 $7H 2 O (0.2), K 2 HPO 4 (1.0), CaCl 2 (0.1), and KH 2 PO 4 (0.4). The ph of the medium was adjusted to 7.0 with 6 N HCl or 6 N NaOH. The influence of temperature on microbial growth and keratinase production was examined at 30, 37, 40, and 55 C. The keratinase production was also investigated in media with various initial phs (3.0, 5.0, 7.0, 9.0 and 11.0). Different keratin sources, including commercial feather meal, chicken feather powder, chicken feather, human hair and goose feather, were used as substrates, each with a concentration of 10 g/l to replace the raw feathers. The effect of carbohydrate (glucose, fructose, sucrose, lactose or soluble starch) on the keratinase production was also examined by adding 5 g/l of each into the fermentation medium. The effect of nitrogen on the keratinase production was investigated by adding 10 g/l of each of peptone, urea, NH 4 Cl, and NaNO 3. All experiments were done in triplicate. Testing samples were taken from each flask and centrifuged to remove the cells and insoluble residues, and the ph value, protein and free amino acid contents, and keratinase activity for the supernatant were determined. The insoluble residues were observed and examined with FTIR and SEM. The protein content was measured by the method of Lowry with bovine serum albumin as a standard (23). Keratinase activity Keratinase activity was measured using the modified azocasein hydrolysis method of Tomarelli et al. (24). The reaction mixture that contained 0.2 ml of an enzyme and 0.8 ml of azocasein solution was incubated in a water bath at 70 C for 30 min. The reaction was terminated by the addition of 0.2 ml of 20% trichloroacetic acid. The absorbance of the filtrate was measured photometrically at 440 nm. One unit of keratinase activity is defined as the amount of the enzyme that liberates 1 mmole of sulfanilic acid per minute at 70 C. Amino acid analysis The method of amino acid analysis of White et al. (25) was used to determine the amino acid contents for the unprocessed and fermented feather meals. Each sample, equivalent to about 0.2 g of protein, and norleucine (as an internal standard) were weighed accurately in a 250-mL round-bottomed flask. Next, 100 ml of 6 N hydrochloric acid containing 0.1% phenol were added. The sample was then heated at 110 C on a heating mantle and refluxed for 24 h. After cooling, the content of each flask was quantitatively transferred to a 200-mL volumetric flask and made up to the mark. Hydrochloric acid was removed from the sample by drying under vacuum at room temperature. The sample was then redried from 10 ml redrying reagent (95% ethanol: water: triethylamine ¼ 2:2:1). Derivatization was initiated by adding 20 ml of freshly prepared reagent (95% ethanol: water: triethylamine: phenylisothiocyanate ¼ 7:1:1:1), which was mixed using a vortex mixer and allowed to stand at room temperature for 20 min. The entire reagent was then removed under vacuum. It was essential to dry the sample thoroughly at this stage to remove excess reagent and by-products, which gave interfering peaks in the chromatogram. The derivatized sample was redissolved in sample diluent (5 mm sodium phosphate buffer (ph 7.4): acetonitrile ¼ 95:5), and amino acid analysis was then performed on a PICO$TAG Amino Acid Analysis System (Waters, Milford, MA, USA). Fourier transform infrared spectroscopy (FTIR) analysis The change of function groups of unprocessed and fermented feather were observed by FTIR, that was carried out according to Wojciechowska et al. (26). An IR spectroscopic analysis was performed using the FTIR 8400S, Shimadzu (with the resolution of 2 cm 1 ). The feather samples used for the FTIR tests were prepared in the following way: 3 mg feather powdered were mixed with KBr (dried in the temperature of 120 C) in the amount complementary to the final 300 mg. Next, in order to make the test material more uniform they were carefully rubbed in an agate mortar in conditions which made water absorption impossible. For the spectroscopic tests, samples of 150 mg were taken from previously prepared mixture. Next they were deaerated and treated with the process of ironing under the pressure of 8 tons for 1 min. For each individual sample 9 scans were done. Scanning electron microscope (SEM) studies To examine the change of feathers during the fermentation process, the feathers were observed by a scanning electron microscopy (SEM). The feathers were collected and fixed in a 0.2-M cacodylate buffer (ph 7) containing 1% glutaraldehyde at 4 C for 6 h. The moisture in each sample was replaced by ethanol, and this step was repeated six times. The samples were then dried with a Hitachi HCP-2 critical point dryer and plated with an Eiko IB-5 ion coater. The residues of feather were observed by Field Emission Gun Scanning Electron Microscopy (FE-SEM, Model JSM-6700F, JEOL, Tokyo, Japan) at 5 kv. sources to grow and produce keratinase. Soil samples were collected from a poultry farm in Changhua, Taiwan. Twenty-three isolated strains were able to form clear zones on casein agar plates since casein was hydrolyzed by the extracellular proteolytic enzyme secreted by the isolated strains. Of these, three strains grew well on feather meal agar plates. Especially, strain Wu2 was selected for further study because of its highest keratinase activity. The morphological analysis showed that strain Wu2 was a filamentous, rod-shaped gram-positive bacterium, forming endospores and no capsule. In addition, analysis of 16S rrna of this strain showed a high sequence identity to Bacillus cereus (Fig. 1). Therefore, based on these biochemical, physiological (data not shown) and 16S rrna analyses, the isolated strain was identified and named as B. cereus Wu2. The 16S rrna sequence of strain Wu2 was deposited by the NCBI Nucleotide Sequence Database with the accession number JF Effect of temperature on keratinase production To explore the effect of temperature on keratinolytic activity, B. cereus Wu2 was cultivated under various temperatures (30 C, 37 C, 40 Cand55 C) in a medium containing 1% feather for 96 h. The time courses of ph, ammonia-nitrogen, and keratinase activity are shown in Fig. 2a. The increase trend in ph values and ammonium nitrogen were observed with feather degradation. For these four temperatures, keratinase RESULTS AND DISCUSSION Identification and characterization of feather-degrading microorganisms The purpose of this study was to isolate bacterial strains which utilized feather as carbon and nitrogen FIG. 3. Effects of (a) carbon source and (b) nitrogen source on ph value, ammonianitrogen, and keratinase activity of B. cereus Wu2. Symbols: (a) closed circles, blank; open circles, glucose; closed triangles, fructose; closed squares, starch; open triangles, sucrose; open squares, lactose; (b) closed circles, blank; open circles, peptone; closed triangles, urea; closed squares, NH 4 Cl; open triangles, NaNO 3.

5 VOL. 114,2012 FEATHER-DEGRADING STRAIN B. CEREUS Wu2 643 activity was detected and reached the maximum value (711 U/mL) after cultured for 90 h at 40 C. Nevertheless, the keratinase activity suddenly decreased to 25 U/mL at 55 C for 42 h. The Bacillus species typically are mesophilic and grow well within a temperature range of 30e40 C. The optimum cultured temperature in this study was similar to those in the previous reports (27). Lin et al. (28) indicated that the optimal range of temperature for keratinase production by feather-degrading B. licheniformis was between 40 Cand45 C, which was lower than the best temperature range for proteolysis on milk plates (50e55 C). Streptomyces thermonitrificans, thermophilic actinomycetes, was isolated from soil and had the maximal activity after 48 h of incubation at 50 C (29). Inaddition,Streptomyces sp. S.K 1-02 produced a high keratinolytic activity at 70 C (30). Effect of initial ph on keratinase production Fig. 2b shows the time courses of ph, ammonia-nitrogen, and keratinase activity as B. cereus Wu2 was cultivated in feather media with various initial ph values ( , 7.0, 9.0 and 11.0). The optimum initial ph for keratinolytic enzyme production was ph 5.3; meanwhile the activity reached U/mL after 78 h of cultivation. The optimum initial ph obtained in this study was similar to those of B. subtilis, e.g., B. pumilus (27), B. cereus MCM B-326 (31), and Bacillus horikoshii (32). Furthermore, the ph values increased as feather was degraded, and a similar result was observed in the previous research with high keratinolytic activities (33). The trend of ph value may be associated with proteolytic activity, consequent deamination reactions and the release of excess nitrogen to form ammonium ions following utilization of amino acids and soluble peptides as a metabolic fuel for growth and microbial maintenance (as shown in Fig. 2b). The increase in ph FIG. 4. Time courses of ph, ammonia-nitrogen, and keratinase activity when B. cereus Wu2 was cultivated in media containing various keratinous substrates for 96 h. Symbols: open circles, feather meal; closed circles, commercial feather meal; closed triangles, chicken feather; open squares, goose feather; closed squares, hair. TABLE 1. Amino acid contents of unprocessed and processed feathers in this study compared with those in the literature. WCH Unprocessed 207 kpa for 24 min 160 C for 15 min Unprocessed Degraded by Wu2 Feather-lysate Purified keratinase EFM EHM Feather hydrolyzates (mol%) (g/kg) (g/kg) (mg amino acid/g CP) (g amino acid / l00 g CP) (g amino acid / 100 g CP) (mg/100 g) (%) (relative concentration, %) Non-essential amino acids Asp e e Glu e e Ser Gly His Arg Ala e e Pro e 1.71 e e e Cys Tyr e e 3.29 e e 33.1 Essential amino acids Thr Val Met Ile Leu Phe Lys References In this study

6 644 LO ET AL. J. BIOSCI. BIOENG., FIG. 5. Optical and scanning electron micrographs of a native feather degraded by B. cereus Wu2 for 96 h. The left is the optical photo, and the SEM is on the right. Bar: 50 mm. during cultivation is pointed as an important indication of the keratinolytic potential of microorganisms (9). Effects of carbon and nitrogen sources on keratinase production To examine the influence of carbon source on keratinolytic activity, B. cereus Wu2 was cultivated in a medium containing 1% feather and another carbon source at 40 C for 96 h (Fig. 3a). As shown in this figure, the highest enzyme production (671 U/mL) was obtained at the control experiment (without extra carbon source). This fact indicated that the extra carbon sources (glucose, fructose, starch, sucrose, or lactose) could act as a catabolite repressor to the enzyme secretion or keratinolytic activity when keratinous substrates were employed as protein sources. These results were in agreement with the earlier research, for example, the glucose practically suppresses the protease secretion (34). Initial surveys on the role of individual carbon sources on keratinase production showed that exogenous carbohydrates suppressed enzyme production of diverse bacteria (35,36). In a similar manner, adding glucose and methanol in a medium generally suppressed Bacillus sp. FK46 growth and keratinase production, and consequently inhibited feather degradation (37). Sugar suppression of enzyme activity commonly appears in fungi and other microorganisms. The proteolytic activity of S. thermonitrificans has been shown to be suppressed by glucose (29). The catabolite repression of protease by sucrose has been shown in Neurospora crassa (38) as has repression by fructose in Trichophyton rubrum (39). To investigate the effect of nitrogen source on keratinase production, media containing various nitrogen sources and 1% raw feather were used to cultivate B. cereus Wu2. Fig. 3b shows that except ammonium chloride, supplementing other nitrogen sources in the medium not only did not yield better keratinase activity but

7 VOL. 114,2012 FEATHER-DEGRADING STRAIN B. CEREUS Wu2 645 also inhibited the activity. The maximum keratinase production (3.5 ku/ml) was obtained with 2 g/l of NH 4 Cl as the nitrogen source after 54 h of culture. These results were similar to those in some previous investigations. For instance, extra NH 4 Cl and yeast extract as nitrogen sources have been shown to have a favorable effect on keratinase production by B. pumilus FH9 (40). Nilegaonkar et al. (31) reported that increased level of keratinase production by B. cereus MCM B-326 was observed to be up due to the addition of ammonium chloride and sodium nitrite compared with other inorganic nitrogen sources. Moreover, the microbial growth and keratinase production of B. licheniformis PWD-1 was encouraged by NH 4 Cl (14). Effect of keratinous substrate on keratinase production Most keratinases are largely inducible, requiring keratin as an exogenous inducer (8). The duration and intensity of keratinase secretion were strongly influenced by various keratinous substrates (41). Different keratinous substrates such as commercial feather meal, chicken feather, human hair, and goose feather were used to investigate the effect of the keratinous substrate on the keratinase production by B. cereus Wu2 (Fig. 4). The highest keratinase activity (1.75 ku/ml) was observed with chicken feather powder, and whole chicken feather was the second (0.75 ku/ml). These results are in accordance with the findings of Cheng et al. (34) with B. licheniformis PWD-1, El-Refai et al. (40) with B. pumilus FH9, Park and Son (42) with Bacillus megaterium F7-1, and Cai et al. (43) with B. subtilis. However, the commercial feather meal was a poor substrate for keratinase induction. The molecular structure, which might be important to keratinase induction, of commercial feather meal might have been destroyed during the preparation (34). Keratinase induction by various keratinous substrates was also observed by Singh (44) with Trichophyton simii which was induced by buffalo skin and human nails to produce keratinase. Besides, Trichophyton mentagrophytes var. erinacei showed the highest keratinase production with wool and Aspergillus flavus with chicken feather, and the keratinase activity was the highest for C. pannicola and M. gypseum in a culture medium induced with human hair (45). Analysis of amino acid content The waste chicken feathers were degraded by B. cereus Wu2 under the optimum cultured condition. During the period of cultivation, the culture broth was collected for determining the content of amino acids, and the residual feathers were observed by SEM and Fourier transform infrared spectrum (FTIR). In this study, B. cereus Wu2 could utilize wasted feathers as the sole carbon and nitrogen sources and meanwhile release substantial amounts of soluble protein in the broth. Table 1 shows the amino acid contents of the unprocessed feather and the fermented feather broth. The hydrolyzate in the fermented broth is rich in glutamic acid, aspartic acid, proline, glycine and serine; on the opposite, the tyrosine, cysteine, histidine, and methionine were scarce in the hydrolyzate. Compared with the unprocessed feathers, the amino acid contents of feathers degradated by B. cereus Wu2 were higher, especially for lysine, methionine and threonine which were nutritionally essential amino acids and usually deficient in the feather meal. These results were similar to those reported in previous studies (46e48). For instance, a purified product obtained from a feather culture of Aspergillus oryzae contained a higher proportion of glycine (21.7%), glutamic acid (10.3%) and serine (9.44%) (49). To increase free amino acids such as asparagine, glycine, proline and lysine in the fermentation broth when wool was degraded by the isolated strain 4 M using wool as the sole carbon and nitrogen sources (50). Feather degradation observed by SEM and FTIR The degradation of whole feathers by B. cereus Wu2 was observed by SEM. The feather surface was only slightly damaged after 24 h of cultivation (data not shown). As shown in Fig. 5, the barbules of feathers became cracked after 48 h, and the rachis were attacked by the strain after 96 h. In a previous study, the feather degradation by Chryseobacterium sp. strain kr6 was observed by SEM (51). Other researchers (33,43,52) also used SEM to observe the keratin attacked by microorganisms. The functional groups of the feather were detected by FTIR, and the result is given in Fig. 6. FTIR spectra of degraded feather displayed that transmittance peaks nearby 500, 1100, 1544, 1650, 2960 and 3420 cm 1. The peak located in the range of 2700e3100 cm 1 indicates the presence of CH groups, and the broad peak around 3400 cm 1 is usually caused by the vibration of hydrogen bonded eoh groups (53). The transmittance peaks for the amide I (1650 cm 1 ) and amide II (1547 cm 1 ) suggest the presence of an a-helix structure in the sample, moreover the amide I (1638 cm 1 ) and amide II (1515 cm 1 ) indicate the presence of a b-sheet type (26). The peak near 1100 cm 1 was observed, and this fact indicated that CeC groups existed in each of the two samples (53). Additionally, as shown in Fig. 6, compared with the processed (incubated with Wu2) and unprocessed feather meal, the peaks of the disulphide bonds of the processed feather weaker than the native feather meal was observed, it exhibited the disulphide bond structure of the feather was attacked by Wu2. Disulphide bonds owing to the SeS stretching vibrations show a peak in the 500e550 cm 1 (53,54). The peaks appeared in the range of 480e560 cm 1 as shown in Fig. 6 represented disulphide bonds existing in the sample. Poultry feathers have been generated in a huge quantity as a waste after the process of chickens and could lead to the potent polluting implications. Additionally, limitations to feather utilization arise due to its poor digestibility, low biological value, and the deficiencies of nutritionally essential amino acids such as methionine, lysine, histidine and tryptophan (46e48). According to these results, development of an alternative technology with prospects for environmental friendliness, nutritional enhancement or compatibility, bioresources optimization and cost effectiveness seems an urgent need. In this study, a feather-degrading bacterium, B. cereus Wu2, was isolated from the soil of a poultry farm via a two-step screening strategy. The condition for feather degrading by this strain was optimized, and the optimum condition included 40 C, an initial ph of 5.3 with an incubation time of 96 h. In addition, the keratinase could be produced by B. cereus Wu2 in conditions with wide ranges of ph and temperature, and various keratinous substrates. These are regarded as favorable characteristics for industrial applications of this enzyme. Moreover, some essential amino acids such as methionine, histidine, and lysine that are deficient in feather keratin were obtained in the cultured broth of B. cereus Wu2. FIG. 6. IR spectra of degraded feathers (dotted line) and native feather meal (solid line). Peak A, 3400 cm 1 (eoh); peak B, 2960 cm 1 (asymmetric ech 3 ); peak C, 1665 cm 1 (amide I); peak D, 1550 cm 1 (amide II); peak E, 1150 cm 1 (ecece); peak F, 500 cm 1 (esese).

8 646 LO ET AL. J. BIOSCI. BIOENG., References 1. Daroit, D. J., Corrêa, A. P. F., and Brandelli, A.: Production of keratinolytic proteases through bioconversion of feather meal by the Amazonian bacterium Bacillus sp. P45, Int. Biodeterior. Biodegrad., 65, 45e51 (2011). 2. Ismail, A. M. S., Housseiny, M. M., Abo-Elmagd, H. I., El-Sayed, N. H., and Habib, M.: Novel keratinase from Trichoderma harzianum MH-20 exhibiting remarkable dehairing capabilities, Int. Biodeterior. Biodegrad., 70, 14e19 (2012). 3. Brandelli, A., Daroit, D. J., and Riffel, A.: Biochemical features of microbial keratinases and their production and applications, Appl. Microbiol. Biotechnol., 85, 1735e1750 (2010). 4. Riffel, A., Daroit, D. J., and Brandelli, A.: Nutritional regulation of protease production by the feather-degrading bacterium Chryseobacterium sp. kr6, Nat. Biotechnol., 28, 153e157 (2011). 5. Riffel, A. and Brandelli, A.: Isolation and characterization of a featherdegrading bacterium from the poultry processing industry, J. Ind. Microbiol. Biotechnol., 29, 255e258 (2002). 6. Queiroga, A. C., Pintado, M. E., and Malcata, F. X.: Potential use of woolassociated Bacillus species for biodegradation of keratinous materials, Int. Biodeterior. Biodegrad., 70, 60e65 (2012). 7. Tiwary, E. and Gupta, R.: Medium optimization for a novel 58 kda dimeric keratinase from Bacillus licheniformis ER-15: biochemical characterization and application infeatherdegradationand dehairing ofhides, Bioresour. Technol., 101, 6103e6110 (2010). 8. Onifade, A. A., Al-Sane, N. A., Al-Musallam, A. A., and Al-Zarban, S.: Potentials for biotechnological applications of keratin-degrading microorganisms and their enzymes for nutritional improvement of feathers and other keratins as livestock feed resources, Bioresour. Technol., 66, 1e11 (1998). 9. Kaul, S. and Sumbali, G.: Keratinolysis by poultry farm soil fungi, Mycopathologia, 139, 137e140 (1997). 10. Gradisar, H., Kern, S., and Friedrich, J.: Keratinase of Doratomyces microsporus, Appl. Microbiol. Biotechnol., 53, 196e200 (2000). 11. Böckle, B., Galunsky, B., and Muller, R.: Characterization of a keratinolytic serine proteinase from Streptomyces pactum DSM 40530, Appl. Environ. Microbiol., 61, 3705e3710 (1995). 12. Santos, R. M. D. B., Firmino, A. A. P., De Sa, C. M., and Felix, C. R.: Keratinolytic activity of Aspergillus fumigatus fresenius, Curr. Microbiol., 33, 364e370 (1996). 13. Garcia-Kirchner, O., Bautista-Ramirez, M. E., and Segura-Granados, M.: Submerged culture screening of two strains of Streptomyces sp. with high keratinolytic activity, Appl. Biochem. Biotechnol., 70, 277e284 (1998). 14. Williams, C. M., Richester, C. S., Mackenzi, J. M., and Shih, J. C. H.: Isolation, identification and characterization of a feather degrading bacterium, Appl. Environ. Microbiol., 56, 1509e1515 (1990). 15. Zerdani, I., Faid, M., and Malki, A.: Feather wastes digestion by new isolated strains Bacillus sp. in Morocco, Afr. J. Biotechnol., 3, 67e70 (2004). 16. Ramnani, P., Singh, R., and Gupta, R.: Keratinolytic potential of Bacillus licheniformis RG1: structural and biochemical mechanism of feather degradation, Can. J. Microbiol., 51, 191e196 (2005). 17. Manczinger, L., Rozs, M., Lgyi, V. G., and Kevei, F.: Isolation and characterization of a new keratinolytic Bacillus licheniformis strain, World J. Microbiol. Biotechnol., 19, 35e39 (2003). 18. Kumar, A. G., Swarnalatha, S., Gayathri, S., Nagesh, N., and Sekaran, G.: Characterization of an alkaline active-thiol forming extracellular serine keratinase by the newly isolated Bacillus pumilus, J. Appl. Microbiol., 104, 411e419 (2008). 19. Pillai, P., Mandge, S., and Archana, G.: Statistical optimization of production and tannery applications of a keratinolytic serine protease from Bacillus subtilis P13, Process Biochem., 46, 1110e1117 (2011). 20. Lee, G. G., Ferket, P. R., and Shih, J. C. H.: Improvement of feather digestibility by bacterial keratinase as a feed additive, FASEB J., 59, 1312 (1991). 21. Shih, J. C. H.: Biodegradation and utilization of feather keratin, pp. 165e171, in: Proceedings of 1999 animal waste Management Symposium. North Carolina State University, Raleigh, NC (1999). 22. Riffel, A. and Brandelli, A.: Keratinolytic bacteria isolated from feather waste, Braz. J. Microbiol., 37, 395e399 (2006). 23. Williams, C. M., Lee, C. G., Garlich, J. D., and Shih, J. C. H.: Evaluation of a bacterial feather fermentation product, feather-lysate, as a feed protein, Poult. Sci., 70, 85e94 (1991). 24. Tomarelli, R. M., Charney, J., and Harding, M. L.: The use of azoalbumin as a substrate in the colorimetric determination of peptic and tryptic activity, J. Lab. Clin. Med., 34, 428e433 (1949). 25. White, J. A., Hart, R. J., and Fry, J. C.: An evaluation of the Waters Pico-Tag system for the amino-acid analysis of food materials, J. Automat. Chem., 8, 170e177 (1986). 26. Wojciechowska, E., Rom, M., Włochowicz, A., Wysocki, M., and Wesełucha- Birczynska, A.: The use of Fourier transform-infrared (FTIR) and Raman spectroscopy (FTR) for the investigation of structural changes in wool fibre keratin after enzymatic treatment, J. Mol. Struct., 704, 315e321 (2004). 27. Kim, J. M., Lim, W. J., and Suh, H. J.: Feather-degrading Bacillus species from poultry waste, Process Biochem., 37, 287e291 (2001). 28. Lin, X., Inglis, G. D., Yanke, L. J., and Cheng, K. J.: Selection and characterization of feather degrading bacteria from conola meal compost, J. Ind. Microbiol. Biotechnol., 23, 149e153 (1999). 29. Mohamedin, A. H.: Isolation, identification and some cultural conditions of a protease-producing thermophilic Streptomyces strain grown on chicken feather as a substrate, Int. Biodeterior. Biodegrad., 43, 13e21 (1999). 30. Letourneau, F., Soussote, V., Bressollier, P., Branland, P., and Verneuil, B.: Keratinolytic activity of Streptomyces sp. S. KI-02: a new isolated strain, Lett. Appl. Microbiol., 26, 77e80 (1998). 31. Nilegaonkar, S. S., Zambare, V. P., Kanekar, P. P., Dhakephalkar, P. K., and Sarnail, S. S.: Production and partial characterization of dehairing protease from Bacillus cereus MCM B-326, Bioresour. Technol., 98, 1238e1245 (2007). 32. Joo, H. S., Kumar, C. G., Park, G. C., Kim, K. T., Paik, S. R., and Chang, C. S.: Optimization of the production of an extracellular alkaline protease from Bacillus hirikoshii, Process Biochem., 38, 155e159 (2002). 33. Mabrouk, M. E. M.: Feather degradation by a new keratinolytic Streptomyces sp. MS-2, World J. Microbiol. Biotechnol., 24, 2331e2338 (2008). 34. Cheng, S. W., Hu, H. M., Shen, S. W., Takagi, H., Asano, M., and Tsai, Y. C.: Production and characterization of keratinase of a feather degrading Bacillus licheniformis PWD-1, Biosci. Biotechnol. Biochem., 59, 2239e2243 (1995). 35. Singh, C. J.: Optimization of an extracellular protease of Chrysosporium keratinophilum and its potential in bioremediation of keratin wastes, Mycopathologia, 156, 151e156 (2002). 36. Anbu, P., Gopinath, S. C. B., Hilda, A., Lakshmipriya, T., and Annadurai, G.: Optimization of extracellular keratinase production by poultry farm isolate Scopulariopsis brevicaulis, Bioresour. Technol., 98, 1298e1303 (2007). 37. Suntornsuk, W. and Suntornsuk, L.: Feather degradation by Bacillus sp. FK 46 in submerged cultivation, Bioresour. Technol., 86, 239e243 (2003). 38. Drucker, H.: Regulation of exocellular proteases in Neurospora crassa. Induction and repression of enzyme synthesis, J. Bacteriol., 110, 1041e1049 (1972). 39. Meevootisom, V. and Niederpruem, D. J.: Control of exocellular proteases in dermatophytes and especially Trichophyton rubrum, Sabouraudia, 17, 91e106 (1979). 40. El-Refai, H. A., AbdelNaby, M. A., Gaballa, A., El-Araby, M. H., and Abdel Fattah, A. F.: Improvement of the newly isolated Bacillus pumilus FH9 keratinolytic activity, Process Biochem., 40, 2325e2332 (2005). 41. Siesenop, U. and Bohm, K. H.: Comparative studies on keratinase production of Trichophyton mentagrophytes strains of animal origin, Mycoses, 38, 205e209 (1995). 42. Park, G. T. and Son, H. J.: Keratinolytic activityof Bacillus megaterium F7-1, a feather-degrading mesophilic bacterium, Microbiol. Res., 164, 478e485 (2009). 43. Cai, C. G., Lou, B. G., and Zheng, X. D.: Keratinase production and keratin degradation by a mutant strain of Bacillus subtilis, J. Zhejiang Univ. Sci. B., 9, 60e67 (2008). 44. Singh, C. J.: Characterization of an extracellular keratinase of Trichophyton simii and its role in keratin degradation, Mycopathologia, 137, 13e16 (1997). 45. Muhsin, T. M. and Hadi, R. B.: Degradation of keratin substrates by fungi isolated from sewage sludge, Mycopathologia, 154, 185e189 (2001). 46. Baker, D. H., Blitenthal, R. C., Boebel, K. P., Czarnecki, G. L., Southern, L. L., and Wilis, G. M.: Protein amino acid evaluation of steam-processed feather meal, Poult. Sci., 60, 1865e1872 (1981). 47. Papadopoulos, M. C., El-Boushy, A. R., and Ketelaars, E. H.: Effect of different processing conditions on amino acid digestibility of feather meal determined by chick assay, Poult. Sci., 64, 1729e1741 (1985). 48. Dalev, P., Ivanov, I., and Liubomirova, A.: Enzymic modification of feather keratin hydrolysates with lysine aimed at increasing the biological value, J. Sci. Food Agric., 73, 242e244 (1997). 49. Farag, A. M. and Hassan, M. A.: Review-Purification, characterization and immobilization of a keratinase from Aspergillus oryzae, Enzyme Microb. Technol., 34, 85e93 (2004). 50. Gousterova, A., Braikova, D., Goshev, I., Christov, P., Tishinov, K., Tonkova, V. E., Haertle, T., and Nedkov, P.: Degradation of keratin and collagen containing wastes by newly isolated thermoactinomycetes or by alkaline hydrolysis, Lett. Appl. Microbiol., 40, 335e340 (2005). 51. Riffel, A., Lucas, F., Heeb, P., and Brandelli, A.: Characterization of a new keratinolytic bacterium that completely degrades native feather keratin, Arch. Microbiol., 179, 258e265 (2003). 52. Nam, G. W., Lee, D. W., Lee, H. S., Lee, N. J., Kim, B. C., Choe, E. A., Hwang, J. K., Suhartono, M. T., and Pyun, Y. R.: Native-feather degradation by Fervidobacterium islandicum AW-1, a newly isolated keratinase-producing thermophilic anaerobe, Arch. Microbiol., 178, 538e547 (2002). 53. Akhtar, W. and Edwards, H. G. M.: Fourier-transform raman spectroscopy of mammalian and avian keratotic biopolymers, Spectrochim. Acta A Mol. Spectrosc., 53, 81e90 (1997). 54. Wojciechowska, E., Włochowicz, A., Wysocki, M., Pielesz, A., and Wesełucha- Birczynska, A.: The application of Fourier-transform infrared (FTIR) and Raman spectroscopy (FTR) to the evaluation of structural changes in wool fibre keratin

9 VOL. 114,2012 FEATHER-DEGRADING STRAIN B. CEREUS Wu2 647 after deuterium exchange and modification by the orthosilicic acid, J. Mol. Struct., 614, 355e363 (2002). 55. Kim, W. K. and Patterson, P. H.: Nutritional value of enzyme- or sodium hydroxide-treated feathers from dead hens, Poult. Sci., 79, 528e534 (2000). 56. Kim, W. K. and Patterson, P. H.: Recycling dead hens by enzyme or sodium hydroxide pretreatment and fermentation, Poult. Sci., 79, 879e885 (2000). 57. Sangali, S. and Brandelli, A.: Feather keratin hydrolysis by a Vibrio sp. strain kr2, J. Appl. Microbiol., 89, 735e743 (2000). 58. Wang, X. and Parsons, C. M.: Effect of processing systems on protein quality of feather meal and hog hair meals, Poult. Sci., 76, 491e496 (1997). 59. Latshaw, J. D., Musharf, N., and Retrum, R.: Processing of feather to maximize its nutritional value for poultry, Anim. Feed Sci. Technol., 47, 179e188 (1994). 60. Grazziotin, A., Pimentel, F. A., de Jonng, E. V., and Brandelli, A.: Nutritional improvement of feather protein by treatment with microbial keratinase, Anim. Feed Sci. Technol., 126, 135e144 (2006).