Supplementary Methods Enzyme expression and purification

Transcription

1 Supplementary Methos Enzyme expression an purification he expression vector pjel236 (18) encoing the full length S. cerevisiae topoisomerase II enzyme fuse to an intein an a chitin bining omain was kinly provie by Janet Linsley, University of Utah. A seconary mutation (A3925G) was reverte to the wil-type sequence by QuickChange site irecte mutagenesis (Stratagene) after subcloning the coing sequence into pbluescript II S+ (Fermentas). In aition, a Y782F mutation was introuce by QuickChange mutagenesis. he coing sequences were clone back into the pjel236 vector backbone. A kanamycin resistence gene was inserte into the Apa1 site to yiel pfmp54 encoing wil-type an pfmp69 encoing the Y782F mutant topoisomerase. he DNA sequences were verifie by DNA sequencing of the full coing regions. he constructs were esigne such that the only ifference between S. cerevisiae topoisomerase II an the final, purifie topoisomerase is a change of the C-terminal aspartic aci is to glycine. Purifie protein with this one change was reporte to have ientical biochemical characteristics to the fully wil-type enzyme (18); for the purposes of these stuies, it is referre to as wil-type topoisomerase II. Single colonies of the yeast expression strain BCY123 harboring pfmp54 or pfmp69 were grown in YP-Raffinose in the presence of 0.2 mg/ml G418 (A.G. Scientific). Cells were inuce an harveste as escribe (18) an store at -80 C. o purify topoisomerase II, cells were lyse in liqui nitrogen using a Waring blener. Chitin affinity chromatography was performe essentially as escribe (18). Intein cleavage was inuce with 30 mm DLithiothreitol (Sigma) overnight at 4 C in FPLC buffer [50 mm potassium HEPES ph 7.5, 20% sucrose, 0.1 mm EDA, 0.01% ween 20] plus 500 mm potassium acetate (OAc). Protein containing fractions from the elution were ilute 1:1 with FPLC buffer mm OAc an loae on a Heparin FF column (Pharmacia) from which topoisomerase II was elute with a OAc graient (0.25 to 0.7 M). opoisomerase-containing fractions were loae unilute on a MonoQ (Pharmacia) column an elute with a OAc graient (0.5 to 1 M). he most concentrate fractions were poole an further concentrate to µμ using an Amicon Ultra (Millipore) 100 cutoff centrifugal filter. he concentrate was aliquote an store at -80 C. Per 40 g of wet weight cells (from ~8 L culture), the yiel was 5 mg for wil-type an 1 mg for Y782F topoisomerase II. he purity was 95% base on Coomassie Blue staining of SDS gels (Supplementary Figure S1 an ata not shown). opoisomerase II can be reversibly phosphorylate. he phosphorylation state of the enzyme was not monitore or controlle. 23

2 Selection of the DNA uplex for the DNA cleavage assay opoisomerase-meiate cleavage of the 40 bp an 68 bp uplex substoichiometric with respect to enzyme in the presence of Mg 2+ -AMPPNP coul be etecte, but the signal was too low for accurate quantification (<1%; ata not shown). A series of uplexes with palinromic sequences was create base on the cleavage site within the 40 bp uplex (unpublishe results). he lengths of these uplexes were increase to 46 bp to position the cleavage site in the center of the DNA. he sequence proviing the highest extent of cleavage was selecte for the cleavage experiments herein (Supplementary able S1). he cleavage specificity of the main cleavage site of the 46 bp uplex use in this stuy was >95% (ata not shown). ase assay hyrolysis was measure by a couple ase assay using pyruvate kinase (15 U/mL final concentration), PEP (6 mm), lactate ehyrogenase (15 U/mL), NADH (0.5 mm) an varying concentrations of Mg 2+ - in 0.1 ml reactions. he absorption of NADH over time was rea by a SpectraMax 340 PC 96 well plate reaer in flat bottom, uncoate 96 well plates (Nunc). resynthesis apparently i not limit the measure rates: varying the regenerating system concentration two-fol i not result in changes of the measure rates. his result is corroborate by control experiments in which the solution containing the regenerating system was mixe with pure ADP. Rates for regeneration in those experiments were at least five times faster that the rates in experiments containing topoisomerase II. Iniviual ase activities between inepenent experiments varie on average 7% (stanar error) for saturating (3 mm) an 15% for subsaturating (0.06 mm) concentrations. 24

3 Supplementary Results Moels to account for the biphasic DNA stimulation of the ase activity of the Y782F topoisomerase II hree limiting moels can account for the observe biphasic DNA stimulation curve of the Y782F enzyme (Supplementary Scheme 3). he first moel was presente in the main text an is shown in the Supplementary Scheme 3A for comparison. Accoring to this moel, bining of DNA to the higher affinity bining site (efine as 1 ; the thickness of the re arrows inicates the relative affinities of ifferent enzyme species for DNA) partially stimulates hyrolysis. Increase hyrolysis is inicate by thicker, blue arrows in Supplementary Scheme 3. his moel implies communication between each DNA bining site an the ase activity, as bining of each DNA activates hyrolysis. he moest level of stimulation observe from bining of the first DNA to the mutant enzyme woul not be expecte to be etectable in the analogous experiment with the wil-type enzyme, as the affinities for the first an secon DNAs are not sufficiently ifferent in the wil-type. hus, the results with the wiltype enzyme o not provie evience for this moel but are fully consistent with it (Supplementary Figure S2). A secon moel to explain the biphasic stimulation curve oes not require that DNA boun at the higher affinity site partially activates hyrolysis. he ase activity is stimulate only in complexes that have the lower affinity site occupie ( E an E ; DNA2 Supplementary Scheme 3B). o obtain measurable ase stimulation by bining of a single DNA in this moel, a significant fraction of DNA woul have to be boun to the lower affinity site uner conitions when the enzyme is in excess of DNA (i.e. 1 ~ 2 ). he issociation constant for the secon DNA to bin to the mutant enzyme is significantly larger than that for the first DNA [ < 1 nm (Scheme 1), 1 2' 550 nm (able II) an ata not shown]. Consequently, the moel requires that DNA bining exhibits negative bining cooperativity ( < 2 2' ): i.e., G-DNA bining woul inhibit bining of -DNA an vice versa. However, negative bining cooperativity of more than three-fol is not consistent with ase activity results for the wiltype enzyme uner ientical conitions (Supplementary Figure Supplementary Figure S3C). hus, the Y782F mutation woul have to inuce negative DNA bining cooperativity not present in the wil-type enzyme for this moel to hol. 25

4 affinity site ( E A thir moel requires that the enzyme species with DNA boun only at the lower ) have a hyperstimulate ase activity compare to the other enzyme species (Supplementary Scheme 3C). Even though moel ue to unfavorable DNA affinities ( << 1 E cannot strongly accumulate in this 2 ), the small fraction of E forme with enzyme in excess of DNA woul be sufficient to significantly stimulate the observe ase activity. Quantitative analysis shows that the ase activity of E woul have to be stimulate >1000-fol compare to free enzyme to fit the ata (analysis not shown). Because the overall DNA stimulation of the ase activity at saturating DNA concentrations is only ~20- fol compare to DNA free enzyme, bining of the secon DNA segment woul then have to inhibit DNA stimulation by at least 50-fol. As in the first moel escribe above, this moel requires communication between both DNA bining sites an the ase activity except that in this moel in the E -complex is stimulatory an DNA 1 is inhibitory to the ase DNA2 activity. his moel, like the first, is consistent with ata obtaine with the wil-type enzyme (ata not shown). In summary, moels 1 an 3 require that both DNA bining sites can communicate with the ase omains. While in moel 1 each DNA partially activates hyrolysis, moel 3 postulates one inhibitory an one stimulatory bining site. In contrast, moel 2 emans that only one of the DNA bining sites is stimulatory to the ase activity. Moel 2 requires that the Y782F mutation inuces negative DNA bining cooperativity between the two bining sites, an moel 3 requires that a hyperstimulate ase state exists. We aopt the first moel (Supplementary Scheme 3A) as our working moel ue to its simplicity, its consistency with the DNA-epenent ase stimulation for the wil-type enzyme, an the lack of a requirement for aitional a hoc assumptions. Alternative moels accounting for the DNA epenence of DNA cleavage As escribe in the main text, the DNA epenence of DNA cleavage is consistent with a moel that oes not require the presence of a boun -segment before the G-segment can be cleave. wo alternative moels coul in principle also account for the ata, but they can be rejecte base on ata presente herein an aitional unpublishe results, as escribe below. First, DNA bining coul be strongly cooperative, such that uner the conitions employe the enzyme woul never be significantly boun to only a single DNA (Supplementary Scheme 4; thickness of arrows inicates the relative affinities). In this case, it woul not be 26

5 possible to istinguish if the -segment were require allosterically for cleavage. However, at most 50% of the DNA coul be cleave in this scenario because at most 50% of the DNA segments coul be boun at the G-DNA site. hus, this moel coul only explain the DNA cleavage ata obtaine in Mg 2+ where <10% cleavage is observe, but is not consistent with the >80% DNA cleavage observe in Ca 2+. A quantitative analysis of the ata showe that bining of the secon segment in Mg 2+ woul have to occur with a fol higher affinity than bining of the first ( ' G / 10 4 an G' / 10 4, i.e., with fol observe bining cooperativity; Supplementary Figure S6 an ata not shown). However, the analysis of the epenence of ase hyrolysis on the concentration of the 40 bp an 68 bp uplexes inicates that there is no observe bining cooperativity (able II). Differences between the DNA cleavage assay conitions compare to the ase assay conitions are not responsible for inucing observe cooperativity *. hus, a moel requiring strong, positive observe cooperativity to explain the DNA cleavage results can be rejecte. In a secon alternative moel, DNA coul bin transiently at the -DNA bining site an inuce cleavage of a boun G-DNA. he DNA at the -DNA site coul then issociate an bin to the -DNA site of another enzyme molecule promoting cleavage an so forth. his possibility can be rule out base on unpublishe kinetic results, as follows. Microscopic reversibility woul require that -DNA also be require for ligation of cleave DNA at the G-DNA site. However, DNA religation by topoisomerase II followe in pulse-chase type experiments in which ligation is inuce by aing in a large excess of unlabele DNA or by iluting the reaction mixture give the same rate constant for ligation (unpublishe results). hese results inicate that a secon, transiently boun DNA is not involve in establishing the cleavage/ligation equilibrium. * A 46 bp uplex was employe in the DNA cleavage assay while a 40 bp an a 68 bp uplex were use in the ase assay opening the possibility that the specific length or sequence of the 46 bp uplex coul promote observe bining cooperativity. he observation of DNA cleavage in Mg 2+, Mg 2+ - AMPPNP, Ca 2+ an Ca 2+ -AMPPNP for the 40 bp an 68 bp DNA uplexes uner conitions where the enzyme was in large excess of DNA provies evience against that possibility (ata not shown). Furthermore, it is possible that AMPPPNP use in the DNA cleavage assay inuces observe bining cooperativity. Evience against that possibility comes from the observation that DNA cleavage of the 40 bp, 46 bp an 68 bp uplexes was etecte also in the absence of AMPPNP in Mg 2+ with the enzyme concentration in large excess of the DNA concentration (ata not shown). Finally, the presence of boun in the ase assay may prevent observe DNA bining cooperativity. However, the analysis of the ase ata inicate the absence of observe DNA bining cooperativity also uner subsaturating conitions (able II). 27

6 able S1 Oligoeoxyribonucleoties use in this stuy Name Sequence (5 3 ) Oligo 68 top GCAACGCAGCAGGCACCGGAGAAACAACAAGCGCCACGCA CCCGGCACCGCACC Oligo 68 bottom GGGACGGGCCGAGGAGACGAGAGCGCAGAGACAACACGG GCCGACGCGAGC Oligo 40 top GAAACAACAAGCGCCACGCACCCGGCACCG Oligo 40 bottom ACGGGCCGAGGAGACGAGAGCGCAGAGACA Oligo 40 top- ROX-GAAACAACAAGCGCCACGCACCCGGCACCG ROX a b Oligo 46 ACGGGCCGAGGAGACGAGCGCGCACGCACCCGGCACCG a ROX: 6-Carboxy-X-rhoamine. b Oligo 46 is self-complementary, so top an bottom strans are ientical. 28

7 Supplementary Scheme 3 29

8 Supplementary Scheme 4 30

9 Supplementary Figures Supplementary Figure S1: Assessment of the purity of the topoisomerase II preparation. Purifie wil-type topoisomerase II (~1 µg; theoretical molecular weight 164 kd) was analyze on a 10% SDS polyacrylamie gel an staine with Coomassie Blue. Quantification of bans in the gel inicates a purity of 95% of the topoisomerase II preparation. 31

10 Supplementary Figure S2: Range of ase stimulation that can be elicite by each boun DNA segment in the absence of the other. he DNA stimulation curves of the ase activity at saturating concentrations from Figure 2A were fit to a set of moels with ase activities for E an E fixe at the levels observe in the absence of DNA an the presence of DNA2 saturating DNA, respectively, but varie in the level of the ase activity for E an E (Scheme 1). he ratio between the ase activity of E an E is efine as f 1, an f 2 is similarly efine as the ratio of the ase activities of E an E. he probability p(χ 2 ) that a particular moel can fit the ata was estimate base on a chi square gooness-of-fit test. 2 in the fits is efine to be of equal or greater value than ( ) as it refers to the weaker bining site. p(χ 2 ) is plotte over a plane efine by f 1 an f 2. Different ranges of values for p(χ 2 ) are assigne ifferent colors. Moels with a low probability to fit the ata base on the χ 2 test are assigne a blue color (see color bar). o fit the ata, M values for all four enzyme species are neee (see Experimental Proceures), but only the values for free enzyme (E, = 1 mm) an E ( M{no DNA} DNA2 M{, } M = 0.2 mm; able I) are known. Four permutations of values of E M an E that span the values for E an E were DNA2 consiere: A) = {DNA } = 1 mm. B) M{} M 2 M{} =1 mm an = 0.2 mm. C) M{DNA 2 } M{} = 0.2 mm an = 1 mm. D) M{DNA 2 } = {DNA } = 0.2 mm. Values for M{} M 2 32

11 an M{} M{DNA 2 } below 0.2 mm or above 1 mm are possible. M values below 0.2 mm woul not change the conclusions because remains saturating for all species. Values significantly above 1 mm woul prevent from being saturating for the particular species; the ase activity of this species woul still be stimulate by DNA but the reporte stimulation woul be an unerestimate. he white line inicates the position of moels for which the prouct of f 1 an f 2 totals the maximal stimulation observe at saturating DNA concentrations of 31-fol. 33

12 Supplementary Figure S3: Estimation of limits for 1, 2' an / (Scheme 1) for wiltype enzyme obtaine from the DNA stimulation of the ase activity in Figure 2 an Supplementary Figure S4. he DNA stimulation curves of the ase activity using a 68 bp uplex uner saturating (panels A, B an C), an subsaturating concentrations (panels D, E an F) an the DNA stimulation curves using a 40 bp uplex uner saturating concentrations (panels G, H an I) were fit to moels that systematically varie the inicate parameters, an the gooness of the fit for each moel was estimate base on a χ 2 gooness-offits test. Values for the inicate parameters that give p(χ 2 ) 0.05 were consiere acceptable an are summarize in able II. In panels A, D an G, 2 2' 1 was systematically varie. 2' was varie in panels B, E, an H, an the egree of DNA bining cooperativity ( / ) was varie in panels C, F, an I. Partial ase stimulation of E an 2 2' E compare to E was allowe in the fits as escribe in Supplementary Figure S2. As explaine in Supplementary Figure S2, values for E an M E (Scheme 1) are not known but neee for the fits. In the fits shown it was postulate that E has the same M value as free enzyme (1 mm; 34

13 able I) an that the M for E is the same as that for enzyme with saturating DNA (0.2 mm). Ientical estimates of the acceptable values for the parameters analyze in the Figure were obtaine when ifferent combinations of values for an M{} M{DNA 2 } were use as escribe in Supplementary Figure S2 ( {DNA } = {DNA } = 1 mm, M 1 M 2 M{} = 0.2 mm an M{DNA 2 } = 1 mm, or = {DNA } = 0.2 mm; analysis not shown). M{} M 2 35

14 Supplementary Figure S4: ase stimulation by a 40 bp DNA uplex with saturating concentrations of Mg 2+ - (3 mm). A) Depenence of the observe hyrolysis rate constant (v o / [E]) on the DNA concentration with 13 nm ( ) an 650 nm ( ) topoisomerase II. Lines represent a global fit of Scheme 1 to the ata. 36

15 Supplementary Figure S5: Depenence of the observe hyrolysis rate constant (v o / [E]) of Y782F topoisomerase II (45 nm) on the concentration of the 68 bp DNA uplex with saturating (3 mm) Mg he line represents a fit of Scheme 1 to the ata. 37

16 Supplementary Figure S6: Systematic search for moels that are consistent with the DNA epenence of the ase activity an the topoisomerase II-meiate DNA cleavage with the sie conition ' clvg clvg (Scheme 2). Equilibrium cleavage ata obtaine at three enzyme concentrations [36 nm (ata not shown), 360 nm an 3200 nm (Figure 4)] with varying concentrations of 46 bp uplexes in Mg 2+ -AMPPNP were globally fit to moels that varie in the amount of DNA bining cooperativity ( / ' ) an in the relative affinities between the - an the G-DNA sites ( / ). he gooness of the each fit p(χ 2 ) was estimate by χ 2 statistics. G p(χ 2 ) (see color legen) was plotte on a two imensional gri spanne by the ratios / ' an /. he area shown in saturate colors in between the magenta an violet lines G represents combinations of values that are not rule out base on the analysis of the DNA epenence of the ase reaction. Values locate to the left of the magenta line ( / < 3*10-3 ) possess a egree of negative DNA bining cooperativity that is not supporte by the ase ata (Supplementary Figure S3). Values to the right of the violet lines ( < ' ' G for 38

17 > an G G' < for < G ) are rule out by the ase ata as this area contains all values with positive, observe DNA bining cooperativity (Supplementary Figure S3 an able II). he only values that are allowe by the results from the ase ata (saturate colors) an that can fit the DNA cleavage ata [p(χ 2 ) > 0.05] are values for which the G-DNA site affinity excees that of the -DNA site ( / > 10 0 ). G 39

18 Supplementary Figure S7: Bining of ROX-labele 40 bp DNA uplex (1 nm ) to wil-type (black squares) or Y782F enzyme (re circles) in low salt buffer [25 mm Hepes-OH ph 7.5, 5 mm MgCl 2, 50 mm Cl, 6% glycerol, 5 mm 2-mercaptoethanol]. Lines are fits of the ata to the quaratic bining isotherm (Equation 1) to apparent = 1.5 nm (black) an apparent = 0.3 nm (re). However, these apparent values only represent upper limits as the apparent values are close to or lower than the DNA concentration use; i.e. the apparent bining curves represent stoichiometric titrations from which bining constants cannot be obtaine. 40