Comparative Sequence Analysis of the Genomic Segment 6 of Four Rotaviruses Each with a Different Subgroup Specificity

Transcription

1 J. gen. Virol. (1988), 69, Printed in Great Britain 1659 Key words: rotavirus VP6/sequence homology~antigenic epitopes Comparative Sequence Analysis of the Genomic Segment 6 of Four Rotaviruses Each with a Different Subgroup Specificity By MARIO GORZIGLIA,* YASUTAKA HOSHINO, KAZUO NISHIKAWA, W. LEE MALOY, 1 RONALD W. JONES, ALBERT Z. KAPIKIAN AND ROBERT M. CHANOCK Laboratory of Infectious Diseases and 1Biological Resources Branch, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892, U.S.A. (Accepted 25 March 1988) SUMMARY The nucleotide sequences of the genes that code for the major inner capsid protein, VP6, of the human rotavirus strain (subgroup I), porcine rotavirus (subgroup II), equine rotavirus strain (non-i/ii) and equine rotavirus strain FI-14 (both subgroups I and II) have been determined. The sixth segment positive-stranded RNA encodes a protein of" 397 amino acids in all strains with the exception of strain in which it encodes a protein of 399 amino acids. Alignment of amino acid sequences of the VP6 protein of strain FI-14 and subgroup II rotaviruses ( and ) indicates a high degree of homology (94~), while homology between strain FI-14 and subgroup I rotaviruses (, and ) was somewhat less (90 to 92~). On the other hand a high degree of conservation of amino acid sequence (95 to 97~) was observed between the strain and subgroup I rotaviruses. Five regions that may contribute to subgroup epitopes were identified. Region A (amino acids 45, 56) and region C (amino acids 114, 120) may contribute to subgroup I epitopes and regions B (amino acids 83, 86, 89, 92), D (amino acids 312 or 314, 317 or 319) and E (amino acids 341 or 343, 350 or 352) may contribute to subgroup II epitopes. When analysed using the Western blot technique monoclonal antibodies specific for VP6 epitopes shared by all rotaviruses were observed to react with both monomeric and trimeric forms of VP6, while monoclonal antibodies specific for a subgroup I or II epitope reacted only with the trimeric form of VP6. This observation and the sequence analyses suggest that subgroup antigenic specificity is determined by conformational epitopes produced by the folding of VP6 or the interaction between VP6 monomers. INTRODUCTION Rotaviruses possess two outer capsid proteins, designated VP7 and VP3, which are considered to be independent neutralization antigens (Hoshino et al., 1985; Offit & Blavat, 1986). The major inner capsid protein of rotaviruses, p45k (Novo & Esparza, 1981), also referred to as VP6 (Espejo et al., 1981; Ericson et al., 1982) is present in the virion in an oligomeric, possibly trimeric form (Gorziglia et al., 1985; Sabara et al., 1987). VP6 is an important component of the virion not only because of its abundance, accounting for approximately 80 ~ of viral protein, but also because of its constituent antigenic sites. Moreover, VP6 may be a component of the viral polymerase or other enzyme complexes which are active in single capsid particles (Holmes, 1983). The analysis of reassortant rotaviruses initially led to the identification of the sixth RNA segment as the gene which encodes VP6 (Kalica et al., 1981). This protein can be detected readily with a variety of antigen assay systems including complement fixation, immune adherence haemagglutination assay, radioimmunoassay and ELISA. VP6 contains a group antigen common to all group A rotaviruses (Greenberg et al., 1983). Also, in initial studies two distinct non-overlapping antigenic specificities, designated subgroup I and subgroup II, were identified and localized to the VP6 protein (Kapikian et al., SGM

2 1660 M. GORZIGLIA AND OTHERS 1981 ; Greenberg et al., 1983; Taniguchi et al., 1984). When tested with specific hyperimmune rotavirus antisera or subgroup-specific monoclonal antibodies group A rotaviruses usually exhibited either subgroup I or subgroup II specificity. In subsequent studies a more complex pattern emerged when it was observed that some animal and avian rotavirus failed to react with either subgroup I- or II-specific antibodies and were designated non I/II (Hoshino et al., 1983, 1984). In addition, Hoshino et at. (1987a) recently identified a fourth category of subgroup reactivity in an equine rotavirus strain, FI-14, which reacted with both subgroup I and subgroup II monoclonal antibodies. The complete nucleotide sequence of gene 6, the gene that encodes VP6, of two subgroup I animal rotaviruses, vervet monkey rotavirus (Estes et al., 1984) and bovine rotavirus (Cohen et al., 1984) and one subgroup II human rotavirus (Both et al., 1984) have been previously determined. Comparison of the deduced amino acid sequences indicated a high degree of homology; more than 90 ~ of the amino acids were conserved between subgroup I and subgroup II rotaviruses. We describe the deduced amino acid sequence of the VP6 protein of four additional rotavirus strains, each with a different subgroup specificity: human rotavirus strain (subgroup I), porcine rotavirus strain (subgroup II), equine rotavirus strain (non-i/ii) and equine rotavirus strain FI-14 (both subgroup I and II). This report presents a comparison of the VP6 amino acid sequences of rotaviruses with dual or no known subgroup reactivity with those of rotaviruses belonging to subgroup I or II. This approach was taken in an attempt to identify epitopes responsible for subgroup specificity. In addition, the importance of the trimeric conformation of the VP6 protein to subgroup epitopes was investigated. METHODS Viruses and cells. The following rotavirus strains were studied: human rotavirus (subgroup I, serotype 2), porcine rotavirus Gotffried (subgroup II, serotype 4); equine rotavirus (subgroup non-i/ii, serotype 3) and equine rotavirus FI-14 (both subgroup I and II, serotype 3). These viruses were propagated in a continuous line of African green monkey kidney cells, MA104 (Hoshino et al., 1984). Trypsin (Type IX, Sigma) was used at a final concentration of 10 Bg/ml for 60 rain at 37 C to activate virus infectivity. After adsorption of virus, cell monolayers were fed with Eagle's MEM supplemented with 1 ~g of trypsin per ml. In vitro transcription. Viruses were purified by Freon 113 extraction of rotavirus-infected cells followed by pelleting through a cushion of 30~ (w/v) sucrose. The virus pellet was resuspended in buffer containing 20 mm- Tris-HC1 ph 7.4 and 15 mm-edta and incubated at 37 C for 1 h. Single capsid viral particles produced by this treatment were purified by isopycnic centrifugation in a CsCI gradient. Single-stranded RNAs were prepared by in vitro transcription of rotavirus single capsid particles. The ssrnas were purified by lithium chloride precipitation (Flores et al., 1982). The ssrna pellet was washed twice with 100~ ethanol, vacuum-dried and resuspended in 20 to 40 BI of sterile distilled water. The integrity and concentration of ssrna were determined by electrophoresis in 1 ~ agarose followed by staining with ethidium bromide. Dideoxynueleotide sequencing. The procedure used followed the method described by Gorziglia et al. (1986). Briefly, 40 to 70 ng of a DNA primer 18 nucleotides long, which was synthesized on an Applied Biosystems synthesizer, was mixed with 4 to 7 ~g of rotavirus ssrna transcripts, heated at 95 C for 1 min, and then allowed to anneal at 42 C for 5 min. Primer extension was performed as a set of four reverse transcription reactions that contained 3 pm-datp, 50 ~M each of dctp, dgtp and dttp, 600 units of reverse transcriptase per ml, and I mci of [~x-32p]datp per ml In addition, 1 gm-ddatp or 14 ~M each of ddctp, ddgtp or ddttp was included to terminate extension. Reaction mixtures were incubated at 42 C for 30 min, combined with 7 ~tl of sequencing gel sample buffer (95~ formamide, 10 mm-edta ph 8.0, 2-5 mm-tris-hc1 ph 8.3, 0.1 ~ xylene cyanol and 0.1 bromophenol blue), heated at 95 C for 3 min and analysed on 6~ sequencing gels. An oligonucleotide primer corresponding to the last 17 nucleotides of the 3' end of gene 6 (Estes et al., 1984; Both et al., 1984) was used empirically to initiate nucleotide sequence extension of all rotavirus strains. Subsequently oligonucleotide primers 18 nucleotides long were used at intervals of about 200 to 300 nucleotides to sequence the plus strand of strains,, and FI-14. SDS-PAGE and eleetroblotting of virus polypeptides. Polypeptides were analysed by polyacrylamide slab gel electrophoresis using the method of Laemmli (1970), with 10~ running and 4~ stacking gels as previously described (Gorziglia et al., 1985). Before electrophoresis, single capsid particles were dissociated by incubation at 100 C for 7 rain in Laemmli sample buffer, with or without a final concentration of 5 % 2-mercaptoethanol or by incubation at 37 C for 30 min in the same buffer, with or without 2-mercaptoethanol. Samples were loaded in duplicate and following electrophoresis half of the slab gel was fixed in 7 ~ acetic acid-30 ~ methanol. Bands in

3 Sequence analysis of rotavirus gene the slab were detected by staining with Coomassie Brilliant Blue R-250. The other half of the gel was soaked for 60 min in transfer buffer, containing 20 mm-tris-hc1, 150 mm-glycine and 20~ methanol. The polypeptides from the gels then were transferred electrophoretically onto nitrocellulose membranes (Schleicher & Schuell) for 14 h at 50 V in a Bio-Rad Trans-Blot unit. Immunological detection ofpolypeptides on nitrocellulose. After electrophoretic blotting, the polypeptides were detected using a commercial enzyme immunoassay kit (Bio-Rad Immunoblot; goat anti-mouse, horseradish peroxidase). Monoclonal antibody raised against FI-14 VP6 which recognizes a rotavirus group A-common (4B5), FI-14-specific (4F12), subgroup I (6C 10) or subgroup II (5F5) epitope and monoclonal antibody raised against subgroup II (631/9) were used as first antibody in this assay (Hoshino et al., 1987a; Greenberg et al., 1983). As a second antibody we used goat anti-mouse IgG-horseradish peroxidase conjugate. RESULTS Gene 6 nucleotide sequence Of gene 6 of rotavirus strains,, and FI ~o was sequenced directly by the dideoxynucleotide method using synthetic oligonucleotides to prime cdna synthesis from mrna (Fig. 1). The remaining 1.25~ represents the 17 nucleotide long primer used to initiate the primer extension. The sequence of this primer corresponds to the 3' end of gene 6 (Estes et al., 1984; Both et al., 1984). We chose this sequencing method because it is rapid, reproducible and specific. Also, this method provides the advantage of sequencing a representative population of the specific mrna rather than dealing with a single mrna sequence through the cloned cdna. One artefact observed is premature termination (bands in all sequencing lanes); however, carrying out the reverse transcriptase reaction at 50 C or using different primers helps to eliminate this problem. The gene 6 of three strains,, and FI-14, contains 1356 nucleotides, while the fourth strain,, has six additional nucleotides, CCACCA, inserted at position 911. The gene 6 of the rotaviruses previously sequenced, i.e. simian strain, bovine strain and human strain, possesses a 5' terminal non-coding region of 23 nucleotides which precedes the first AUG codon. This codon initiates the only long open reading frame which in these instances codes for a polypeptide of 397 amino acids. The sixth gene of each of the four rotaviruses analysed in this study also has a 5' untranslated region of 23 nucleotides preceding the AUG which initiates the long open reading frame. This long open reading frame also codes for a protein of 397 amino acids in the case of strains, and FI-14, while the corresponding protein of strain is 399 amino acids in length. Moreover, possesses a second potential initiation codon at residues 132 to 134, within a sequence favourable for translation, i.e. CAAAUGG. This second in-phase AUG could initiate a polypeptide of 363 amino acids. A single termination codon is present at nucleotides 1215 to 1217 in the VP6 of strains, and FI-14 or at nucleotides 1221 to 1223 in the case of strain. The termination codon is followed by a 3' terminal untranslated region of at least 125 nucleotides in each of the four strains sequenced. The actual length cannot be determined by this sequencing method since the 3' 17 nucleotide long primer region was not actually sequenced. Amino acid homology among subgroup I, subgroup II, subgroup I and II, and subgroup non-i/h rotaviruses Comparison of the deduced amino acid sequence of VP6 of the four rotavirus strains determined in this study as well as that of three rotaviruses analysed in previous studies indicates that seven regions are completely (residues 8 to 29, 63 to 74, 176 to 204, 226 to 238, and 316 or 318 to 326 or 328) or highly conserved (residues 122 to 171, 371 or 373 to 397 or 399) (Fig. 2). We observed a high degree of homology (95 ~ or more) among the subgroup I and subgroup non-i/ii strains (,, and ) and a somewhat lower homology (90 to 93~o) of these strains with the subgroup I and II and subgroup II strains (FI-14, and ) (Table 1). The VP6 of the subgroup I and II rotavirus strain FI-14 was most homologous (94~) to the two subgroup II strains, and. There are 18 positions in VP6 among the subgroup I and subgroup non-i/ii viruses at which a specific amino acid is conserved, while a different amino acid is conserved at each of these 18 positions in the protein sequence of the subgroup I and II and/or subgroup II rotavirus strains.

4 O b~ 0 o p0 N 0 Z o FIoI~ Gottfri~ a ~n( /II)... T--C... TT-A... T... C... C--A--C--CT... A... TC... T... G--T... GG-'A-T l... T--C..... TT-G... -T C... C--A- -C--TT-G TC... T- -A... T... G- --A-T... G- C C--G I... T--C--G... CT-G... T... C... C- -A- -C--AT C--C... A... TC... T- -A... T... G- --A-T...!... T--C--G... T-G... T... C- G-*G-... A- -C- -AT... C--C... A... TC... T- -A- -G--T... G- - -A-T -C... -C and 11 GGCTTTT~C~GTCTT~ATGG~GTTCTATACTC~TTTCA~CGCTTAAAGATGCTAGAGAT~TTGTTGAGGGTACGCTATATTCT~TGTTAGTGACAT~TACAGC~TTC~TC~TCATAGTA!... G... G... T-G T G" "C... A... AT A''C- "TC A... T" "C" "G--G... G... A... G... G... G... C-G... T... G" "C A... AT... C- "TC'T- "T... G... SA'11 Fl-14 Gottfr~ed non( /!)... G... A... A G... C-AC A... AT... AT... A... TC-A--A--C... C... G... CC-T-AT--G--T A... A... A- -C AT- -G... A- *C----AT- - -A-H-C -GT... A... T- --C----CT G... AT... T C ]... C- -A... A... ATC... G... A... AT... AT... A... TC-AC-A---T... C- -C--C G--CC-C-AT... T--... ] A..... A... C-AC... C... A... AT... C... A--T--TC-AC-A--CT... C... C-T-AT... T A... and ACTATGAATGGAAATGAGTTTCA ACTGGA CATTG TACATTACCAATTAGGAATTGGACATTTGATTTTGGTCTACTTGGTACAACATTGTTGAATCTAGATGCTAATTATGTTGAAACTGCAAGAACAACAATAGA!! X I... C... A... AC... G- --A... T... C--GC... T... A... G... G--T... T-- [ I... T... A... AT... TG----A... T--C... C-T... CT-G... G-A... T-T---T-- T-A... F[-14 non(!/i ) T--C---G----T--TG-G--T... T... GTTC... G--G... C--A--A... A---T-T--CA-A---T... A... A... G... l T... CG-G- -T--TG... -GTT... G- -C A... A- -CT-G---A-A- -G- -A-CC... A- -C... G G- G- [ T... G-A--T--TG... T GTT... A--A... A-- T... TATA--GT... A--C... A T... C C I T... G-C- -T- -TG-G- -T... G- -GTT- -G... -A--G... A- -CT... CA-A... G--A- -C... A... C... - C- and ATATTTTATTGACTTCATAGACAATGTATGCATGGATGAAATGACAAGAGAATCACAAAGAAATGGAATTGCTCCTCAATCCGATGCACTACGTAAACTATCTGGTATTAAGTTTAAAAGAATAAATTTTGATAATTCAT ] [ ] ]... C... T... T- -T... T... G-TC... G- -T A... A... T- -A- - -T-CA-A- - -T- -G-A... A... G... C... ] T -T- -T..... T G T G-A- -G- -A... T" -A* -GT-GA-A- -GT- -G-G- -A... A... G... C Fl-14 Gott fried non(]/ I) -T G--T... G... GA-A-AG- -C-- -ACA--T... A... A--C--AC... GCT---G--A- ---G... C--A ] -G... C... GA-G- -A- -T- -CACT- -T... A- -A- -A-A- - -AC... T... CGCT- - -G- -- -G... C--A T... -A-... C... G... A-A--G--T-- -ACA--T A... A--C--G--G... GGCT---G--A-C--G... T--G C C--T I T... T... G... GA-A- -A- -T -CACA... C- -G- -G... C... T... A- -A- -A... AC... C... GCT- - -G- -A... T- -A G C... G... and I I AGAATATATAGAAAACTGGAATTTGCAAAATAGAAGACAA GTACTGGATT GTGTT CATAAA caaacatttttccatattctgcttc TTACTTTAAA AGATCACRA CAcTGCATAATGATTTAATGGGAACT T... C... C... G A-T--T... T--T A... A... A T... GA... G--A-C A I... C... T... C--A... G--C" "C... l"-t... l... A... C--A... A... C... T... T... A... G-"A... C Fl-14 Ua non(]/ )... T... T--T... A--T... T--T--G... C... T--C... T--A... T... G--G--G... G... A--G--CC--A-A-T A--T... T---C-TC- ]... T G- -A- -T..... T.... C- -C A... C G... -G-C- - -CC- -A-A-TGT... T- -A- -T- -G... C-TC- C T... T- I... C... G... A- -T- -G... T... C- -C- -C... A- -A... G... T... G... G... T- -A- -G- - -C- -A- - -TGT-G- -T- -A--T... C-T- - I A" "T--G" "T- "T... T... T" -A- -G- "CC'GA'A'T... T... T" "G... C-T- - T and ATGTGGCTAAATG AGGATCAGAGATACAAGTCGCAGGATTTGAT ATTCATGTGcTA TAACGcTCCAGCAAATACACAACAATTTGAACATATAGTTCAACTTAGACGGGCAcTAACAACTGCAAcAATAACTATATT I II... C... A--T... A--T... T... G... T... G... G... T--C--G... C--GT-- -C--A--T--T... T-G-- I I... T... A--T... G- -T... C--C -T--A... G--C-T- --G... C*-C--G G--T--A- -T-... T... T C--C- -A- G--C -T F1-14 GottfrJed non(i/if)... G--A... T--T---A--- -C--G- ---A---C... G--G--A--T... T--GA-T... T... G--C... A... A--T-AT- I T... G T... C--C... ~---C-C--G--G G--G--T---T-G... A... C--G G--C C--T T- ]... A... G... C... T... G- -T... -C... G- - -C-T... C- -T- - -A G- -T... A- -C- -G... A- -T- -T- AC- ]... C... A... G... T... T... A... G- - -C-Y- -G... C--T... G- -T- -GT-G... G--A... A... T- and ACCAGATGCAGAAAGGTTTAGTTTTCCAAGAGTAATTAATTCAGCAGACGGAGCAACAACATGGTTTTTTAATCCAGTAATTTTAAGACCAAATAATGTAGAAGTAGAATTCCTACTTAATGGACAGATAATTAACACAT [ ] ---T... GC'A- "C... G... C... T... T... C... C... T" --C... C... G--G" "T" -GT-G... A... T T... G- -A... T- -T- -C- -G- -T T---C TT-GT-G... A--T... T... C C G

5 Fig. 1. Comparison of the nucleotide sequence of the VP6 gene of equine FI-14 with homologous genes from equine, simian (Estes et al., 1984), bovine (Cohen et al., 1984), human, porcine and human (Both et al., 1984) rotaviruses. The sequence shows the DNA strand that corresponds to the viral plus RNA strand. Underlined bases indicate the positions of the initiation and the single termination codons. N indicates the conserved region used to initiate primer extension ', FI-14 non(i/11)! l 1 I andll li 11 -T--G- --A-A... A--A- -T- -A... T--G- -T- "AC... A... G... CCCACCA-- - -A"" "C... T... GCA'-AC... TA-T... C... TG'A... T -'... A-A... h...,g-a- "T... T" "T--T--AC-A--A--C" "G... A-A... *... C... A... A,CA" TAC" - - "C- "GA'T... G-'A-- "G-A... T... A-A... A--G" "C- "A--T... T... T" -A... A... G'-G---A-A A... G- "AGCG-'G... A-T- "G" "G" -A-'TG'A... -T... A-A... A" "A... A- "T... T" "T" -T- -A... A--,'-G,... A'A... "... A" - "A""" -AGC"" "AC... A'T... A--TG-A... T ACCAAGCACGGTT T GGCACTATAATTGCAAGAAATTTTGACACAATCAGGT TGTCGT TTCAATTAATGCGT... CCACCAAATATGACGCCAGCAGTTAATGCCTTATTTCCACAAGCACAACCGTTCCAGCATCAC -T... TA-A... T... TG'C... AC-T... A--C A... '''-G''" "AC"" - "C" "G... A" "'... T "T- "'--TA'A... T... C--C... -TC-T- -A-TA... G- -G T... A... T... AC'G... T--T... -T TG" -- C" non(fill) I ] 1 F -14 am 11 II II "T... A'''T-A''T... A--C--A--T--GA... G... AC-T''T'--G-C'G'--G--G'''T... T... A'-GT... T''A-'G... G--T... A... G--Q-- --A... G--'T''... TA-A... G--T... '--'--,,-,--'---,---,... C'AT'G... T'-A'''T-C''T... G'-C--'A... ""A... A... G--TA-A... A- -T... AC-T T- -C- --T... T- -A... C--GA... -C- -CG- --GC A T T'-G--A- "C" -A... A-A... G--T... G... A'... T- - "G-G'GC... A... T- -T - -A- -GT... T... G... C- - -A... A A--T... G- -A- - "T-G--C... A" -T... AC'T... G... T*-T'G- "G" -T... A" -C-T... G... TA... A- -C... - G... - "A...,- - -T... A" "T- "G... GC-T... CG... C- -T... T... C" "G- "GC'T... CA... G- -A... non(l/ii) I I l Fl-14 I and II II II non(i/i l) I I l FI-14 I and II Got t fried l l a! I C... T- -A... A- -C... A... T... T... A... A... T... A... GA... CA-TCT... G'T"" "AT-T-- T... C... T- "A" -C... A" -G" "T- "G" "G" -T" -G... CA-A... "T... CA-- -T... A-C... G-G- -0- C" - T... T... C- -T- -C A... T... G... G-'G... A... TG... CC---T... G-C----G-, -... C... T,-A- -C- -T... C- -A... T- -G- *G... -G- -G...,... C- - --T... G-AC-~T T-... AATGAAT TGGACTGAAT T GAT TACCAATTAT TCTCCATCAAGAGAAGATAACTTACAACGTGTGT T TACAGTGGCT T,CAT TAGAAGCAT G CTAATCAAATG=AGGACCAAGCTAAT TACT C GGTATCCTAGTT TGATAAG C... C... T-'C... A--T--C... G--C--TC-G... T... G--A... T'G--T-'G... GA----AC-TCT... A-''-T-" T-- C... A... T- -C... G "'" -C" "a- -A... T-G- "T-... 6A... GC-TCT... A'TC" "AG-T" - T G C" -G 1362 C... -T-ATACAG... G-T-TA- -T-TA AOTA... CTG-A... NNNNNNNNNNNNNflNNN A'C A-C... T... T G'TG" - "AT- - "C... CTA'A-T... C... AGTGAGAGGATGTGACC C" "C " - C"" "T... T... G" TG"" "CT... CTA - A... C" - A... AGTGAGAGGAT GT GACC CG" C... C... AT G-TGTA-'T- TAC... OTA'A--A... C-TCA- - -A-G- NNNNNNNNNNNNNNNNN T--T TATGTAGCTATGT TAAGCT G CT T G AACTCTGCAAGTAAGAACACGT T ACGTATTCGTACCGCAGAGTAATCAT TCT G AT GGT A TNNNNflNNNNNNNNNNNN C C... CA'C"" -T'AT "CAG... GG" -T'A-TT-A... CTA" "T... CTG-CTCA- - - A - G" NNNNNNWNNNNflNPOINN C... CA-C- " "TCAT "CAG... T... G" " "T'A'TT -A-G... UTA" -T... CTG'CTGA- - "A'G'AGTGAGAGGATGTGACC

6 1664 M. GORZIGLIA AND OTHERS Fl-14 non(ill,) I l I and I1 l[ II A B 100 "0... L... L... MV... ~ ' ' N... ~... -o...,... L....-, " I " " "... r"' v"v)" L... L... M-I... I... N'''m'''N... ~N'-O--V--V]-... -o... c... ~....,... I... " ~ "... ~--o--v.-~... NEVLYS I SKT CI(DARDK VE GT LYSNVSO I QQFV~ [ [VnqGI~EFQTGGI GTLP I~NWTFOFGLLfiTTLLNLOANYVETARITT 1EYF IDFI~NVCMDEI q... L... ~ ~ ~-... ~... ~ c... c ~....--v~...,-+ t... :--~... SA'11 FI-16 ~a C 2o0 non(i/h) V... ~... I(--T... A-ON... l V... 1-S... ~... T... Y... A-DN..., V... ~-S-l--- I... p... T... A-ON..., V... ~-S... I... T... A-DN... I and II TRE.~DR~G~APQ~iDALRKLS~G~KFKR~FDN~EY'ENWNLQNRRQRTGF~FHKPN~FPYSA~FTLNRSQPLHN~L~GTHWLNAGSE~QVAGF0YSCA N II A... -IE-F---~ -... l... M-ON... 'l A... V'--~E... A~... R'DN Fl PP-Q non(i/[ I)... V... L... T---Y... F... [ I... I... P---V... L... V... o.-- I... V... L... T... Y... I.....'" I... V... L... Y I and II A~A~T~F~H~VQLRRAL~AT~T~LPDAE~FPR~AD~LT~WFFNPV~LRPNNVEVEFLLNGQ~N~Y~AG~ARNFD~RL$FQLMR~PP II... I... L... V II L... A--'L D E z99 FI-14 non( I/I l)... A" ""-~- P--El... E--I... ~S S~... D...,... Av--?,... e r... E...,~--L... ~..., , ' 1 "... El E D v-,... T-A---ls... E I... E... ~... ~..., ' and '1 N~AVNALF~AQ~FQ~HHATVGLTLR~SAVCE~LA~s~NETMLA~VTA~/RQE~AV~VGPVFPPGMNWTEL%T~YSP$RE~NLQRVFTVAs'R~L K I[... 0-'" 1... I... E... ~---L-... I... l... 1'... ";... ]... E... A~'--L... t... I Fig. 2. Comparison of the amino acid sequences of VP6 from seven different rotaviruses representing four different subgroups (in roman numerals). Simian SAq 1 (Estes et al., 1984), bovine (Cohen et al., 1984) and human (Both et al., 1984) are presented for the purpose of comparison. Boxes A to E are regions within a frame of six to 12 amino acids, where rotaviruses with subgroup non-i/h specificity and both subgroup I and II specificity share two or four amino acids with the strain of subgroup I and II specificities. Table 1. Percentage amino acid (or nucleotide) homology in VP6 among three subgroup L two subgroup 11, one subgroup non-i/h and one subgroup I and H animal rotavirus strains Rotavirus SA-I 1 FI-14 (subgroup II) (subgroup non-i/ii) - 97(85) 95(82) 96(84) 90(79) 90(80) 90(81) (subgroup I) - 97(87) 98(88) 92(81) 92(79) 93(82) (subgroup I) - 96(87) 91(80) 91(78) 93(80) (subgroup I) - 91(81) 91(80) 92(80) FI-14 (subgroup I and 1I) - 94(82) 94(83) (subgroup II) 98(88) No. unique amino acids* * An amino acid at a given position in the sequence of VP6 which is not shared by any of the other six rotavirus strains. Among these positions nine amino acids of the subgroup I or non-i/ii are shared with subgroup II and are therefore unlikely to determine subgroup specificity (Table 2). There are four positions in the VP6 of rotaviruses belonging to subgroup I, subgroup non-i/ii and subgroup I and II at which a specific amino acid is conserved (residues 45, 56, 114 and 120).

7 Sequence analysis of rotavirus gene Table 2. Conservation of VP6 amino acid sequence among rotaviruses with four different subgroup specificities : L II, I and H or non-i/h Amino acid present in rotavirus strains with indicated subgroup specificity ~k I or non-i/ii I and II II Amino acid (n = 4) (n = 1) (n = 2) 2 Asp Glu Glu 7 Leu Ile Leu 30 Leu Ile Leu 37 Met Ile Met 39 Ile Val Val 45 Glu Glu Asp 53 Asn Thr Asn 56 Ile Ile Val 60 Asn Thr Thr 83 Asn Tlar Thr 86 Asp Glu Glu 89 Val Ile Ile 92 Val Ile Ile 101 Val Thr Ala 114 Asp Asp Glu 115 Ser Ala Ala 120 Ser Ser Ala 151 Thr Val Ile or Val 172 Ala Leu Met 174 Asp Asn Asp 175 Asn Asp Asn 217 Val Ala Ala 225 Leu Ile Leu 305 or 307 Ala Asn Asp or Asn 310 or 312 Asn Gin Gin 315 or 317 Glu Gin Gin 327 or 329 Glu Asp Glu 338 or 340 Ala Ser Ala 339 or 341 Ser Asn Asn 348 or 350 Ser Ala Ala 369 or 371 Asp Glu Glu In contrast, a different amino acid is conserved at each of the four positions in the protein of the subgroup II strains (Fig. 2 and Table 2). Three of these conserved differences represent conservative changes and the other is a change from a polar to a non-polar amino acid in the subgroup II strains. There are six positions in the VP6 protein among the subgroup II rotaviruses at which a specific amino acid is conserved (Fig. 2, Table 2). There are 14 positions in the VP6 protein among the subgroup II and subgroup I and II rotaviruses at which a specific amino acid is conserved while a different amino acid is conserved at each of these 14 positions in the protein sequence of the subgroup I and subgroup non-i/ii rotaviruses. Ten of these conserved differences represent conservative changes. The VP6 protein of the subgroup I and II strain, FI-14, contains 11 positions at which unique amino acids are present. The VP6 of the subgroup non-i/ii strain contains ten unique amino acids, most of which are found between residues 244 and 314. In addition, in this region two extra prolines are present at residues 297 to 298. The other five rotavirus strains,,,, and, contain one and three to six amino acids respectively at a given position in the sequence of VP6 which are not shared by any of the other six rotavirus strains (Fig. 2, Table 1). Immunological detection of native polypeptides A typical electrophoretic profile of single capsid particles incubated at 100 C (Fig. 3) shows four polypeptides with approx. Mr of 120K (VP1), 99K (VP2), 88K (VP4) and 45K (VP6). In

8 1666 M. GORZIGLIA AND OTHERS (a) (b) VP1 VP2 VP6 Fig. 3. Effect of heat and reduction on VP6 present in single capsid particles of subgroup I SA-I l strain. (a) PAGE analysis of rotavirus single capsid proteins stained with Coomassie Brilliant Blue. Single capsid particles were incubated at 37 C without (lane 1) or with (lane 2) 2mercaptoethanol, or at 100 C without (lane 3) or with (lane 4) 2-mercaptoethanol. (b) viral proteins identified in (a) were electroblotted to nitrocellulose paper and reacted with monoclonal antibody 6C10 which recognizes subgroup I specificity. Mr of the proteins is indicated on the left K 45K Fig. 4. Immunoblot analysis of different forms of V P6 (lanes 1 and 2, ; lanes 3 and 4, FI-14; lanes 5 and 6, ; lanes 7 and 8, ). Single capsid particles were incubated at 37 C (lanes 1, 3, 5 and 7) or 100 C (lanes 2, 4, 6 and 8) in sample buffer containing 2-mercaptoethanol. Polypeptides were separated by 10~ PAGE, electroblotted to nitrocellulose paper and reacted with monoclonal antibody raised against VP6 of strain FI-14, which recognizes the common epitope (Hoshino et al., 1987). Mr of proteins is shown on the left. contrast, i n c u b a t i o n of single capsid particles of strain, W a or S A d 1 at 37 C, with 2m e r c a p t o e t h a n o l, resulted in a decrease in i n t e n s i t y of the 4 5 K b a n d ( m o n o m e r i c VP6) a n d the a p p e a r a n c e of a high Mr b a n d of approx. 140K (Fig. 3, 4) w h i c h corresponds to the trimeric form o f VP6 (Gorziglia et al., 1985; S a b a r a et al., 1987). Fig. 3 shows the reactivity of a m o n o c l o n a l a n t i b o d y specific for a subgroup I epitope with the blotted VP6 polypeptides derived from single capsid particles of strain rotavirus

9 Sequence analysis of rotavirus gene incubated at 37 C (lanes 1 and 2) or 100 C (lanes 3 and 4). The VP6 oligomer was antigenic in either its unreduced or reduced conformation, indicating that disulphide bonds were not required for the integrity of the subgroup I epitope recognized in this assay. Smear bands detected in Fig. 3(b), lanes 1 and 2, would be explained by the high sensitivity of the immunoblotting assay; such bands could correspond to different configurations of the trimer. Monomers of VP6 expressed in baculovirus were detected with subgroup I monoclonal antibody (Estes et al., 1987). Our data differ from those of Estes et al. (1987) in that we do not detect binding of subgroup I monoclonal antibodies or subgroup II (data not shown) antibodies to virion VP6 monomers. Thus when expressed in insect cells infected with baculovirus recombinants, VP6 monomers possessed an immunoreactivity different from virion VP6 monomers. Monoclonal antibodies that react with an epitope common to all mammalian rotaviruses recognized both the reduced and unreduced forms of p45k and the pl40k in all the rotaviruses studied (Fig. 4). Immunodot blot assay of the viral proteins treated in the same way as the electrophoresis samples yielded the same results (data not shown). DISCUSSION A high degree of VP6 amino acid homology among simian rotavirus (subgroup I), bovine rotavirus (subgroup I) and human rotavirus (subgroup II) has been observed in previous studies (Both et al., 1984; Cohen et al., 1984). In the present study these relationships were confirmed and extended by sequence analysis of the VP6 genes of four additional rotavirus strains, human rotavirus strain (subgroup I), porcine rotavirus strain (subgroup II), horse rotavirus strain (subgroup non-i/ii) and horse rotavirus strain FI-14 (subgroup I and II). A comparison of the deduced amino acid sequence of the sixth gene product among rotaviruses with four different subgroup specificities indicated that the subgroup II strains were most closely related to each other and the subgroup I strains also formed a closely related family. The subgroup non-i/ii strain was more closely related to the latter strains, while the subgroup I and II strain was more closely related to the former strains. The observed conservation of amino acid sequences among the different subgroups of rotaviruses occurred independent of serotype and host species. This suggests that the diverse rotaviruses which have been studied may have acquired their sixth gene by reassortment (Hoshino et al., 1987b; Midthun et al., 1987). The VP6s of the two equine strains ( and FI-14) contain the highest number of unique amino acids (10 to 11) suggesting that from an evolutionary point of view the VP6 of these strains is more distant from that of the other rotavirus strains. Hoshino et al. (1987a) have suggested that FI-14 strain has a "proto' VP6 gene. The nucleotide sequence suggests that the VP6 proteins of different subgroups and strains within the subgroups represent divergent evolution from a common progenitor: thus (i) the length of VP6,397 amino acids, is similar in all subgroups, except subgroup non-i/ii rotavirus, which contains 399 amino acids, (ii) several regions of the VP6 are highly conserved and (iii) a cysteine residue is present at the same three locations in each of the VP6s. It is now well known that the major inner capsid protein contains domains which specify the common and subgroup antigens (Hoshino et al., 1987a). Recently, Pothier et al. (1987) used a competitive binding assay to identify three non-overlaping antigenic sites common to all rotaviruses. Monoclonal antibody 4B5, against the FI-14 VP6 epitope, which recognized all other strains tested (i.e. common epitope or conserved regions of VP6) reacted in immunoblotting with both the monomeric and trimeric forms of VP6. Moreover, preliminary results, arresting mrna gene 6 translation at predetermined sites by oligodeoxynucleotides, indicated that monoclonal antibody 4B5 immunoprecipitated a polypeptide that corresponds to the first 80 amino acids of VP6 (data not shown). These results as well as the immunoblot ELISA reactions observed with partial digests of VP6 by Sahara et al. (1987) suggests that common epitopes of VP6 are continuous determinants. By contrast, the immunoreactivity of subgroup specificity appears to be complex. VP6 monoclonal antibodies with subgroup I or subgroup II specificity reacted with single capsid particles and with the trimeric, but not the monomeric,

10 1668 M. GORZIGLIA AND OTHERS form of VP6. This suggests that the oligomer is the native conformation of VP6 in the virion and that these subgroup-specific antigenic sites are dependent upon interaction between VP6 monomers for their mature configuration. In an attempt to predict the region most likely responsible for subgroup II specificity we noted that eight amino acids clustered in regions B (Thr 83, Glu 86, Ile 89 and Ile 92), D (Glu 310 and Glu 315) and E (Asn 339 and Ala 348) are conserved in FI-14 and subgroup II rotaviruses. However, six additional amino acids shared among these rotaviruses are scattered in other regions of VP6, and these may also be involved in subgroup II antigenic specificity (or specificities). In contrast, there are two clusters, A (Glu 45 and Ile 56) and C (Asp 114 and Set 120), among the subgroup I viruses, in which four specific amino acids, two in each region are shared with the FI-14 strain. Whether or not the different conserved regions contribute to the various subgroup-specific antigenic sites cannot be decided at present; however, since most of the amino acid changes found among subgroup I, subgroup II and subgroup I and II strains are clustered in five different regions, expression and site-directed mutagenesis of these regions of gene 6 may allow us to elucidate the currently recognized antigenic determinants on VP6. We express our thanks to A. Buckler-White for preparation of oligonucleotide primers. We also thank Ms Sandra Chang and Ms Linda Jordan for editorial assistance in the preparation of this manuscript. REFERENCES BOTH, G. W., SIEGMAN, L. J., BELLAMY, A. R., IKEGAMI, N., SHATLOM, A. J. & FURUICHI, Y. (1984). Comparative sequence analysis of rotavirus genomic segment 6 - the gene specifying viral subgroups 1 and 2. Journal of Virology 51, COHEN, J., LEFEVRE, F., ESTES, M. g. & BREMONT, M. (1984). Cloning of bovine rotavirus ( strain): nucleotide sequence of the gene coding for the major capsid protein. Virology 138, ERICSON, B. L., GRAHAM, D. Y., MASON, B. B. & ESTES, M. K. (1982). Identification, synthesis and modification of simian rotavirus polypeptides in infected cells. Journal of Virology 42, ESPEJO, R. T., LOPEZ, S. & ARIAS, C. (1981). Structural polypeptides of simian rotavirus and the effect of trypsin. Journal of Virology 37, ESTES, M. K., MASON, B. B., CRAWFORD, S. & COHEN, J. (1984). Cloning and nucleotide sequence of the simian rotavirus gene 6 that codes for the major inner capsid protein. Nucleic Acids Research 12, ESTES, M. K., CRAWFORD, S., PENARANDA, M., PETRIE, B., BURNS, J., CHAN, W., ERICSON, B., SMITH, G. & SUMMERS, M. (1987). Synthesis and immunogenicity of the rotavirus major capsid antigen using a baculovirus expression system. Journal of Virology 61, FLORES, J., GREENBERG, H. B., MYSLINSKI, J., KALICA, A. R., WYATT, R. G., KAPIKIAN, A. Z. & CHANOCK, R. M. (1982). Use of transcription probes for genotyping rotavirus reassortants. Virology 121, GORZIGLIA, M., LARREA, C., LIPRANDI, F. & ESPARZA, J. (1985). Biochemical evidence for the oligomeric (possibly trimeric) structure of the major inner capsid polypeptide (45K) of rotaviruses. Journal of General Virology 66, GORZIGLIA, M., HOSHINO, Y., BUCKLER-WHITE, A., BLUMENTALS, 1., GLASS, R., FLORES, J., KAPIKIAN, A. Z. & CHANOCK, R. M. (1986). Conservation of amino acid sequence of VP8 and cleavage region of 84K outer capsid protein among rotaviruses recovered from asymptomatic neonatal infection. Proceedings of the National Academy of Sciences, U.S.A. 83, GREENBERG, H., McAULIFFE, V., VALDESUSO, J., WYATT, R., FLORES, J., KALICA, A., HOSHINO, Y. & SINGH, N. (1983). Serological analysis of the subgroup protein of rotavirus using monoclonal antibodies. Infection and Immunity 39, HOLMES, I. H. (1983). Rotaviruses. In The Reoviridae, pp Edited by W. K. Joklik. New York & London: Plenum Press. HOSHINO, Y., WYATr, R. G., GREENBERG, H. B., KALICA, A. R., FLORES, J. & KAPIKIAN, A. Z. (1983). Isolation, propagation, and characterization of a second equine rotavirus serotype. Infection and Immunity 41, HOSHINO, Y., WYATT, R. G., GREENBERG, H. B., FLORES, J. & KAPIKIAN, A. Z. (1984). Serotypic similarity and diversity of rotavirus of mammalian and avian origin as studied by plaque-reduction neutralization. Journal of Infectious Diseases 149, HOSHINO, Y., SERENO, M. M., MIDTHUN, K., FLORES, J., KAPIKIAN, A. Z. & CHANOCK, R. M. (1985). Independent segregation of two antigenic specificities (VP3 and VP7) involved in neutralization of rotavirus infectivity. Proceedings of the National Academy of Sciences, U.S.A. 82, HOSHINO, Y., GORZIGLIA, M., VALDESUSO, J., ASKAA, J., GLASS, R. I. & KAPIKIAN, A. Z. (1987a). An equine rotavirus (FI-14 strain) which bears both subgroup I and subgroup II specificities on its VP6. Virology 157,

11 Sequence analysis of rotavirus gene HOSHINO, Y., SERENO, M., MIDTHUN, K., FLORES, J., CHANOCK, R. M. & KAPIKIAN, A. Z. (1987b). Analysis by plaque reduction neutralization assay of intertypic rotaviruses suggests that gene reassortment occurs in vivo. Journal of Clinical Microbiology 25, KALICA, A. R., GREENBERG, H. B., WYATT, R. G., FLORES, J., SERENO, M. M., KAPIKIAN, A. Z. & CHANOCK, R. M. (1981). Genes of human (strain ) and bovine (strain UK) rotaviruses that code for neutralization and subgroup antigens. Virology 112, KAPIKIAN, A. Z., CLINE, W. L., GREENBERG, H. B., WYATT, R. G., KALICA, A. R., BANKS, C. E., JAMES, H. D., JR, FLORES, J. & CrIANOCK, R. M. (1981). Antigenic characterization of human and animal rotaviruses by immune adherence hemagglutination assay (IAHA): evidence for distinctness of IAHA and neutralization antigens. Infection and Immunity 33, LAEMMLI, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, London 227, MIDTHUN, K., VALDESUSO, l., HOSHINO, Y., FLORES, J., KAPIKIAN, A. Z. & CHANOCK, R. M. (1987). Analysis by RNA- RNA hybridization assay of intertypic rotaviruses suggests that gene reassortment occurs in vivo. Journal of Clinical Microbiology 25, NOVO, E. & ESPARZA, J. (1981). Composition and topography of structural polypeptides of bovine rotavirus. Journal of General Virology 56, OFFIT, P. A. & BLAVAT, G. (1986). Identification of the two rotavirus genes determining neutralization specificities. Journal of Virology 57, VOTmER, P., KOHU, E., DROUET, E. & GHIM, S. (1987). Analysis of the antigenic sites on the major inner capsid protein (VP6) of rotaviruses using monoclonal antibodies. Annales de l'institut Pasteur/Virology 138, SABARA, M., READY, K. F. M., FRENCHICK, P. J. & BABIUK, L. A. (1987). Biochemical evidence for the oligomeric arrangement of bovine rotavirus nucleocapsid protein and its possible significance in the immunogenicity of this protein. Journal of General Virology 68, TANIGUCHI, K., URASAWA, T., URASAWA, S. & YASUHARA, T. (1984). Production of monoclonal antibodies against human rotaviruses and their application to an enzyme-linked immunosorbent assay for subgroup determination. Journal of Medical Virology 14, (Received 3 September 1987)