Circulating Angiopoietin-like Protein 8 Is Independently Associated With Fasting Plasma Glucose and Type 2 Diabetes Mellitus
|
|
- Georgina Bruce
- 5 years ago
- Views:
Transcription
1 JCEM ONLINE Hot Topics in Translational Endocrinology Endocrine Research Circulating Angiopoietin-like Protein 8 Is Independently Associated With Fasting Plasma Glucose and Type 2 Diabetes Mellitus T. Ebert,* S. Kralisch,* A. Hoffmann, A. Bachmann, U. Lössner, J. Kratzsch, M. Blüher, M. Stumvoll, A. Tönjes, and M. Fasshauer Department of Endocrinology and Nephrology (T.E., S.K., A.H., A.B., U.L., M.B., M.S., A.T., M.F.) and Institute of Laboratory Medicine (J.K.), University of Leipzig, and Integrated Research and Treatment Center Adiposity Diseases (T.E., S.K., U.L., A.T., M.F.), Leipzig University Medical Center, Leipzig, Germany Objective: Angiopoietin-like protein 8 (Angptl8) has recently been introduced as a novel adipokine/hepatokine that promotes pancreatic -cell proliferation and improves glucose tolerance in mouse models of insulin resistance. However, regulation of Angptl8 in human type 2 diabetes mellitus (T2DM) and renal dysfunction has not been determined. Research Design and Methods: Serum Angptl8 levels were quantified by ELISA in 62 patients with T2DM as compared with 58 nondiabetic subjects in vivo. Within both groups, about half of the patients were on chronic hemodialysis or had an estimated glomerular filtration rate above 50 ml/min/1.73 m 2. Furthermore, we investigated the effect of insulin and differentiation on Angptl8 mrna expression in 3T3-L1 adipocytes in vitro. Results: Median [interquartile range] serum Angptl8 levels were higher in patients with T2DM (1.19 [0.37] g/l) as compared with nondiabetic subjects (1.03 [0.47] g/l) (P.005). Furthermore, the adipokine/hepatokine was significantly higher in women (1.21 [0.47] g/l) as compared with men (1.05 [0.44] g/l]) (P.013). In multivariate analysis, fasting glucose and T2DM but not renal function remained independent and positive predictors of circulating Angptl8 even after adjustment for markers of obesity, lipid status, and inflammation (P.05). Furthermore, Angptl8 mrna expression was induced by insulin and during adipogenesis in 3T3-L1 adipocytes in vitro. Conclusions: Circulating Angptl8 is positively and independently associated with T2DM and fasting glucose in vivo. Furthermore, Angptl8 mrna expression is induced by insulin and during adipogenesis in 3T3-L1 adipocytes in vitro. (J Clin Endocrinol Metab 99: E2510 E2517, 2014) The metabolic syndrome and its phenotype including visceral obesity, insulin resistance, type 2 diabetes mellitus (T2DM), hypertension, and dyslipidemia is an increasing global health burden. In the last 2 decades, various metabolic hormones have been shown to significantly influence obesity and associated complications. Among those, adipocyte- and hepatocyte-secreted proteins, socalled adipokines and hepatokines, provide a link between obesity, the metabolic syndrome, and associated cardiovascular diseases. Thus, the adipokine leptin is an appetite-suppressive adipokine upregulated in obesity and cardiovascular disease in various animal models (1, 2). Moreover, the adipocyte- and hepatocyte-derived cytokine fibroblast growth factor 21 (FGF21) stimulates glucose uptake in adipocytes (3) and increases insulin sensitivity in rodents (4). ISSN Print X ISSN Online Printed in U.S.A. Copyright 2014 by the Endocrine Society Received December 7, Accepted September 4, First Published Online October 17, 2014 * T.E. and S.K. equally contributed to this work. A.T. and M.F. equally contributed to this work. Abbreviations: Angptl8, angiopoietin-like protein 8; BMI, body mass index; CD, chronic hemodialysis; egfr, estimated glomerular filtration rate; FG, fasting glucose; FGF21, fibroblast growth factor 21; FI, fasting insulin; HDL, high-density lipoprotein; HOMA-IR, homeostasis model assessment of insulin resistance; hsil-6, high-sensitivity IL-6; LDL, low-density lipoprotein; ogtt, oral glucose tolerance test; T2DM, type 2 diabetes mellitus; TG, triglyceride. E2510 jcem.endojournals.org J Clin Endocrinol Metab, December 2014, 99(12):E2510 E2517 doi: /jc
2 doi: /jc jcem.endojournals.org E2511 Recently, angiopoietin-like protein 8 (Angptl8; also known as betatrophin, hepatocellular carcinoma-associated protein TD26, or lipasin) has been introduced as a novel adipokine/hepatokine that significantly and specifically promotes pancreatic -cell proliferation, expands -cell mass, and improves glucose tolerance in mouse models of insulin resistance (5). The authors suggested that Angptl8 expression is a compensatory mechanism to increase -cell proliferation in insulin resistance (5). Interestingly, serum levels of this adipokine/hepatokine are 2-fold increased in patients with T1DM as compared with age-matched healthy controls in a very recent study (6). Taking these interesting and novel findings into consideration, Angptl8 appears as a novel adipokine/hepatokine that improves glucose tolerance. In contrast to these elegant studies in animals (5) and patients with T1DM (6), regulation of Angptl8 in human T2DM and insulin resistance has not been investigated until now. Furthermore, no study has evaluated potential renal elimination and regulation of this beneficial adipokine/hepatokine during renal failure in humans so far. To address these issues, we determined circulating Angptl8 concentrations in 62 well-phenotyped patients with T2DM as compared with 58 nondiabetic subjects in vivo. Within both groups, about half of the patients were on chronic hemodialysis (CD) or had an estimated glomerular filtration rate (egfr) above 50 ml/min/1.73 m 2. Furthermore, we correlated Angptl8 to clinical and biochemical measures of renal function, indices of glucose metabolism, and lipid metabolism as well as inflammation. Moreover, we investigated the effects of hormones inducing insulin resistance, the insulin-sensitizing peroxisome proliferatoractivated receptor- agonist troglitazone, as well as differentiation, on Angptl8 mrna expression in 3T3-L1 adipocytes in vitro. Our primary hypotheses were that Angptl8 concentrations are increased in T2DM as compared with nondiabetic subjects and that adipocyte mrna expression of this novel adipokine/hepatokine is induced by insulin in vitro. Furthermore, we hypothesized that Angptl8 serum levels would increase in patients on CD, indicating that Angptl8 is eliminated by the kidneys. Subjects and Methods Angptl8 in T2DM and renal dysfunction as well as regulation by glucose in vivo Subjects For the cross-sectional study on Angptl8 in T2DM and renal dysfunction, 120 Caucasian men (n 62) and women (n 58) were recruited by the Department of Endocrinology and Nephrology, University of Leipzig. The study design has recently been described (7 10). In brief, 60 patients had an egfr 50 ml/min/1.73 m 2 (controls) according to the Modification of Diet in Renal Disease formula (11), whereas 60 patients were on CD. T2DM in controls and patients on CD was defined as fasting blood glucose 126 mg/dl or use of insulin or oral hypoglycemic medications according to Ref. 12. Using these criteria, 30 of the 60 control and 32 of the 60 CD patients presented with T2DM. Body mass index (BMI) was calculated as weight divided by height squared. Waist-to-hip ratio was determined after waist and hip circumferences were assessed. Age ranged from 32 to 85 years and BMI from 18.7 to 46.1 kg/m 2. Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated as previously described (13). Patients with severe conditions including generalized inflammation or end-stage malignant diseases were excluded from the study. To better define dynamic regulation of Angptl8 by glucose, concentrations of the novel adipokine/hepatokine were measured in a separate cohort comprising 30 subjects with normal glucose tolerance during a 75-g oral glucose tolerance test (ogtt). The study design has recently been described (14). Both studies were approved by the local ethics committee, and all subjects gave written informed consent before taking part in the respective study. Assays All blood samples were taken after a fasting period of at least 8 hours. In CD patients, blood was obtained just before hemodialysis started. Serum Angptl8 (Phoenix Pharmaceuticals), leptin (Mediagnost), and high-sensitivity IL-6 (hsil-6) (R&D Systems) were determined by ELISA according to the manufacturers instructions. According to the manufacturer, the sensitivity of the Angptl8 ELISA was 0.01 g/l. The degree of precision of the ELISA system in terms of intra-assay and interassay coefficient of variance (percentage) was less than 7.5% and 10.5%, respectively. Spike recovery and linearity were in a range of 97% to 131% and 0.3 to 4.4 g/l, respectively. Furthermore, the ELISA was specific for human Angptl8 and did not crossreact with murine and rat Angptl8. Moreover, the antibody used in the ELISA kit specifically detected Angtpl8 at the expected size of about 22.5 kda when unextracted and extracted human plasma samples were probed by Western blot analysis. In addition, quality controls were included in all ELISA measurements, and results were within the expected range. Furthermore, the adipokine/hepatokine was recently quantified by our group in a second cohort of patients with the same Angptl8 ELISA kit lot without any noticeable problems (15). Serum creatinine, fasting glucose (FG), fasting insulin (FI), and triglycerides (TGs) as well as total, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) cholesterol, were measured in a certified laboratory by standard methods. Effects of hormones, troglitazone, and differentiation on Angptl8 expression in 3T3-L1 cells in vitro Reagents and cell culture Isobutylmethylxanthine, IL-6, and dexamethasone were obtained from Calbiochem; insulin from Roche Molecular Biochemicals; and IL-1, GH, and troglitazone from Sigma-Aldrich. Cell culture reagents were purchased from GE Healthcare and
3 E2512 Ebert et al Angptl8 and Type 2 Diabetes Mellitus J Clin Endocrinol Metab, December 2014, 99(12):E2510 E2517 Life Technologies and oligonucleotides from MWG-Biotech. 3T3-L1 cells (American Type Culture Collection) were grown and differentiated into adipocytes as previously described (16). After 6 hours serum starvation, differentiated 3T3-L1 adipocytes were cultured in the presence or absence of insulin, IL-6, IL- 1, GH, and troglitazone under conditions further described in Figure 2. Concentrations of the respective hormones and troglitazone were used according to prior studies (17 19). Furthermore, Angptl8 expression was assessed during differentiation of 3T3-L1 cells. Analysis of Angptl8 mrna production Angptl8 mrna synthesis was determined by quantitative real-time RT-PCR. In more detail, 1 g total RNA was reverse transcribed in a 20- L reverse transcription reaction using standard reagents (Life Technologies) and 1 L of each reverse transcription reaction was quantified on a LightCycler 480 real-time PCR 96-well thermocycler using LightCycler 480 Probes Master Mix (Roche Diagnostics GmbH) essentially as described (20). The following primer pairs were used: Angptl8, CACCAGCCT- GTCGGAGATTC (sense) and GTCTCTGCTGGATCTGTCGC (antisense); and m36b4, AAGCGCGTCCTGGCATTGTCT (sense) and CCGCAGGGGCAGCAGTGGT (antisense). Angptl8 expression was calculated relative to m36b4, which was used as an internal control due to its resistance to hormonal regulation. Statistical analysis A P value.05 was considered as statistically significant in all analyses. SPSS software version 20.0 (IBM) was used for all statistical analyses of human in vivo data. Overall group differences between the 4 subgroups (control/t2dm, control/t2dm, CD/ T2DM, and CD/T2DM ) were assessed by nonparametric Kruskal-Wallis test with Bonferroni post hoc analysis. Differences between nominal variables, eg, T2DM status, were assessed by nonparametric Mann-Whitney U test. Furthermore, a two-way ANOVA was conducted to further examine the effects of T2DM and CD status on circulating Angptl8. Univariate correlations were analyzed by nonparametric Spearman s rank correlation method. Furthermore, multivariate linear regression analyses were performed. Before multivariate analysis and twoway ANOVA, distribution of continuous variables was tested for normality using the Shapiro-Wilk test and nonnormally distributed parameters were logarithmically transformed. In multivariate linear analysis, only parameters that correlated significantly with Angptl8 in univariate analysis were included. For covariates, eg, creatinine and egfr, the parameter with the strongest univariate correlation was included in the multivariate model. Furthermore, gender was included in multivariate analysis. For in vitro experiments, GraphPad Prism version 6 (Graph- Pad Software) was used. Here, Angptl8 expression adjusted for m36b4 after hormone and troglitazone treatment or during differentiation was analyzed relative to untreated control cells and preadipocytes, respectively. Results are shown as mean SEM. Differences between treatments were analyzed by unpaired Student s t tests with prior logarithmic transformation. Results Angptl8 in T2DM and renal dysfunction in vivo Baseline characteristics of the total sample Table 1 summarizes the clinical characteristics of the 4 subgroups (control/t2dm, control/t2dm, CD/ T2DM, and CD/T2DM ) studied. In the total sample, the median (interquartile range) serum Angptl8 level was 1.14 (0.42) g/l. Circulating Angptl8 was significantly different between the 4 subgroups (P.001) (Table 1). Furthermore, Angptl8 concentrations were significantly higher in women (1.21 [0.47] g/l) as compared with men (1.05 [0.44] g/l]) (P.013) in all patients. Notably, there was a significant interaction between T2DM and CD status on Angptl8 concentrations (F 1, , P.015) in two-way ANOVA (Table 1). Angptl8 in T2DM When investigating circulating Angptl8 in relation to T2DM status, patients with T2DM had significantly higher Angptl8 concentrations (1.19 [0.37] g/l) as compared with nondiabetic subjects (1.03 [0.47] g/l) (P.005) (Figure 1). Interestingly, Angptl8 serum levels remained significantly higher in patients with T2DM as compared with nondiabetic subjects even after adjustment for age, gender, and CD status (P.001). Furthermore, the main effect of T2DM on Angptl8 was significant (F 1, , P.002) in two-way ANOVA (Table 1). When investigating Angptl8 levels in nondiabetic control subjects not on CD in a separate analysis, median levels of the adipokine/hepatokine were not significantly different in subjects with normal glucose tolerance as compared with subjects with prediabetes as defined by a 75-g ogtt (data not shown). Angptl8 in CD When investigating circulating Angptl8 in relation to CD, Angptl8 serum levels were significantly lower in patients on CD (1.06 [0.40] g/l) as compared with subjects with an egfr 50 ml/min/1.73 m 2 (1.23 [0.45] g/l) (P.014). Interestingly, the main effect of CD status on circulating Angptl8 did also reach statistical significance (F 1, , P.007) in two-way ANOVA (Table 1). Univariate correlations in the total sample Serum Angptl8 concentrations in all individuals were positively and significantly correlated with BMI, FG, FI, HOMA-IR, HDL cholesterol, egfr, and leptin (P.05) (Table 2). In contrast, Angptl8 was significantly and negatively correlated with age, serum creatinine, and hsil-6 (P.05) (Table 2).
4 doi: /jc jcem.endojournals.org E2513 Table 1. Baseline Characteristics of the Study Population a Two-way ANOVA Control/T2DM Control/T2DM CD/T2DM CD/T2DM Multivariate regression analysis in the total sample Multiple linear regression analysis revealed that FG remained independently and positively associated with circulating Angptl8 after adjustment for age, gender, BMI, P T2DM P CD P T2DM CD n Angptl8, g/l 1.06 (0.49) 1.34 (0.50) b 1.01 (0.42) c 1.11 (0.34) c Age, y d 63 (19) 63 (16) 59 (22) 68 (14) Gender (M/F) 11/19 16/14 15/13 20/12 BMI, kg/m 2d 28.2 (5.6) 29.1 (5.2) 25.2 (6.5) c 27.9 (6.6) WHR 0.88 (0.12) 0.94 (0.10) 0.96 (0.18) 1.00 (0.14) b SBP, mm Hg 125 (21) 126 (20) 125 (38) 120 (25) DBP, mm Hg d 77 (10) 73 (15) 77 (20) 70 (18) FG, mmol/l d 5.1 (1.3) 7.6 (3.2) b 4.6 (1.2) c 5.2 (3.3) c FI, pmol/l d 45.1 (33.3) 47.9 (62.6) 28.2 (47.6) 50.1 (91.6) HOMA-IR d 1.3 (1.2) 2.7 (2.9) 0.8 (1.3) c 1.4 (3.1) Cholesterol, mmol/l d 5.3 (0.9) 4.9 (1.5) 4.4 (1.2) b 4.2 (1.3) b HDL cholesterol, mmol/l d 1.4 (0.4) 1.2 (0.5) 1.0 (0.5) b 1.0 (0.3) b,c LDL cholesterol, mmol/l d 3.5 (1.2) 2.9 (0.9) b 2.7 (0.9) b 2.1 (1.4) b TG, mmol/l d 1.1 (0.8) 1.4 (0.9) 1.6 (0.9) b 1.8 (1.4) b FFA, mmol/l d 0.5 (0.2) 0.6 (0.4) 0.6 (0.5) 0.7 (0.5) Creatinine, mol/l d 76 (17) 72 (22) 829 (431) b,c 717 (221) b,c GFR, ml/min/1.73 m 2d 77 (21) 84 (35) 6 (3) b,c 7 (3) b,c Leptin, g/l d 16.9 (27.9) 16.7 (26.4) 11.8 (37.9) 32.5 (67.5) hsil-6, ng/l d 1.87 (2.11) 2.07 (1.25) 6.14 (4.91) b,c 7.48 (7.30) b,c Abbreviations: DBP, diastolic blood pressure; FFA, free fatty acids; SBP, systolic blood pressure; WHR, waist-to-hip ratio. a Values for median (interquartile range) are shown. Parameters were analyzed by Kruskal-Wallis test followed by Bonferroni post hoc analysis. Exact P values for the effects of T2DM (P T2DM ) and CD (P CD ), as well as for interaction between T2DM and CD (P T2DM CD ), on the respective parameters were assessed by two-way ANOVA. b P 0.05 compared with control/t2dm. c P 0.05 compared with control/t2dm. d Nonnormally distributed variables. HDL cholesterol, creatinine, and hsil-6 (P.001) (Table 3). Furthermore, gender (gender coefficients were coded such that females have a larger value as compared with males), BMI, and HDL cholesterol were positive and in- Table 2. Univariate Correlations With Serum Angptl8 r P Age, y b a BMI, kg/m 2b a WHR SBP, mm Hg DBP, mm Hg b FG, mmol/l b a FI, pmol/l b a HOMA-IR b a Cholesterol, mmol/l b HDL cholesterol, mmol/l b a LDL cholesterol, mmol/l b TG, mmol/l b FFA, mmol/l b Creatinine, mol/l b a egfr, ml/min/1.73 m 2b a Leptin, g/l b a hsil-6, ng/l b a Figure 1. Box-and-whisker plot of Angptl8 serum levels in patients with T2DM (n 62) as compared with nondiabetic subjects (n 58). P value was assessed by nonparametric Mann-Whitney U test. Abbreviations: DBP, diastolic blood pressure; FFA, free fatty acids; SBP, systolic blood pressure; WHR, waist-to-hip ratio. a significant correlation as assessed by Spearman s correlation method. b Nonnormally distributed variables.
5 E2514 Ebert et al Angptl8 and Type 2 Diabetes Mellitus J Clin Endocrinol Metab, December 2014, 99(12):E2510 E2517 Table 3. Multivariate Regression Analysis With Angptl8 as Dependent Variable a Independent Variables P Age c b Gender b BMI c b FG c b HDL cholesterol c b Creatinine c hsil-6 c a Multivariate regression analysis between Angptl8 (dependent variable) and the independent variables shown. Standardized coefficients and P values are given. Gender coefficients were coded such that females have a larger value compared with males. b Significant correlation. c Nonnormally distributed variables were logarithmically transformed before testing. dependent predictors of Angptl8 serum concentrations, whereas age was independently and negatively associated with the adipokine/hepatokine (P.05) (Table 3). Interestingly, T2DM status remained significantly and positively associated with circulating Angptl8 when included in the multivariate model instead of FG (.374; P.001). Univariate correlations in the subgroups Of the associations remaining significant in multivariate analyses in the total sample (n 120; Table 3), Angptl8 was significantly associated with FG and HDL cholesterol in subjects not on CD, with age in non-t2dm, and with age, BMI, FG, and HDL cholesterol in T2DM in univariate analyses (data not shown). In contrast, Angptl8 was not significantly correlated with any of these parameters when CD patients were analyzed separately by univariate analysis (data not shown). When further segregating the study cohort into 4 subgroups (control/t2dm, control/ T2DM, CD/T2DM, and CD/T2DM ), HDL cholesterol was positively correlated with Angptl8 in control/ T2DM and age was negatively associated with Angptl8 in CD/T2DM in univariate analyses (data not shown). Regulation of Angptl8 by glucose in vivo To determine the influence of glucose on Angptl8 levels in more detail, dynamic regulation of circulating Angptl8 was elucidated in a cohort comprising 30 subjects with normal glucose tolerance during an ogtt. Here, mean SE Angptl8 was not significantly different at 30 minutes ( g/l) and 120 minutes ( g/l) after glucose exposure as compared with fasting baseline levels at 0 minutes ( g/l) (gender-adjusted P for overall differences.370) (Supplemental Figure 1). Effects of hormones, troglitazone, and differentiation on Angptl8 expression in 3T3-L1 cells in vitro Treatment of differentiated 3T3-L1 adipocytes with insulin for 16 hours stimulated Angptl8 expression in a dosedependent manner (all P.01) (Figure 2A). Here, a significant 8-fold induction of Angptl8 mrna synthesis was detectable at insulin concentrations as low as 1nM, and insulin increased Angptl8 expression up to 18.5-fold at 3.3nM (P.01) (Figure 2A). Furthermore, 100nM insulin upregulated Angptl8 expression also in a time-dependent fashion with significant 30-fold stimulation detectable as early as 2 hours after insulin addition (P.05) (Figure 2B). Moreover, maximal 76-fold induction was seen after 8 hours of insulin treatment (P.01) (Figure 2B). Angptl8 mrna production also significantly increased in a differentiation-dependent manner with 50-fold and 145-fold induction of the adipokine/hepatokine at days 6 and 9 of differentiation, respectively, as compared with undifferentiated controls (day 0, P.05) (Figure 2C). In contrast, chronic treatment of differentiated 3T3-L1 adipocytes with IL-6, IL-1, GH, and troglitazone did not significantly influence Angptl8 expression (Figure 2D). Discussion In the current study, we show that patients with T2DM have significantly higher Angptl8 serum levels as compared with nondiabetic subjects. Furthermore, T2DM and FG remain independent and positive predictors of circulating Angptl8 in multivariate analysis. Moreover, we demonstrate that insulin is a direct dose- and time-dependent stimulator of Angptl8 mrna expression in differentiated 3T3-L1 adipocytes in vitro similar to convincing results presented by Ren and co-workers (21). In agreement with our findings, increased expression of the adipokine/hepatokine has also been shown in animal models of insulin resistance and T2DM. Thus, Angptl8 mrna is upregulated 3- to 6-fold in the liver of S961- treated animals and ob/ob and db/db mice (5). Because insulin significantly induces Angptl8 mrna expression in differentiated 3T3-L1 adipocytes in vitro, it is tempting to speculate that hyperinsulinemia contributes to upregulation of the adipokine/hepatokine in T2DM. Notably, circulating Angptl8 is not affected by acute changes of glucose homeostasis during a 75-g ogtt in a cohort comprising of 30 subjects with normal glucose tolerance (Supplemental Figure 1). Furthermore, time-dependent induction of Angptl8 expression reaches a peak at 8 hours of insulin treatment, and the insulin effect on Angptl8 synthesis is almost completely lost 24 hours after insulin ad-
6 doi: /jc jcem.endojournals.org E2515 Figure 2. Regulation of Angptl8 mrna by insulin, other hormones, troglitazone, and during adipogenesis. A and B, Differentiated 3T3 L1 cells were serum starved for 6 hours (A) or overnight (B) before various concentrations of insulin (A) were added for 16 hours or 100nM insulin (B) was added for the indicated periods of time. C, Angptl8 expression was determined in undifferentiated 3T3 L1 cells (day 0), as well as 3, 6, and 9 days after induction of differentiation. D, After 5 hours serum starvation, differentiated 3T3 L1 adipocytes were cultured in the presence or absence of 30 ng/ml IL-6, 20 ng/ml IL-1, or 500 ng/ml GH for 24 hours and 10 M troglitazone (Trog) for 16 hours. Extraction of total RNA and quantitative real-time RT-PCR determining mrna levels normalized to 36B4 expression were performed as described in Subjects and Methods. Results are shown as mean SEM. **, P.01; *, P.05 as compared with untreated control (Con) (A, B, and D) and before induction of differentiation (0 days, C) as assessed by unpaired Student s t tests. dition. These findings suggest a rather subacute effect of insulin on Angptl8 expression in differentiated 3T3-L1 cells. Clearly, hormonal networks influencing Angptl8 serum levels need to be elucidated in more detail in future experiments. The pathophysiological significance of Angptl8 upregulation in T2DM remains to be determined. It is interesting to note in this context that Angptl8 has recently been introduced as a novel adipokine/hepatokine inducing insulin secretion from pancreatic -cells (5). In more detail, injecting mice with plasmids encoding Angptl8 results in a striking 17-fold increase in -cell replication as compared with control animals (5). Mechanistically, Angptl8- injected mice exhibit increased expression of cell cycle regulators and cell cycle-related transcription factors in islets, whereas cell cycle inhibitors decrease as compared with control mice (5). Taking these findings into consideration, it is tempting to speculate that Angptl8 upregulation in T2DM is a compensatory mechanism to limit the metabolic consequences of insulin resistance and to improve glucose tolerance. Alternatively, Angptl8 resistance might develop in T2DM similar to insulin and leptin resistance found in obesity (22). Clearly, these hypotheses and the physiological significance of increased Angptl8 levels in T2DM need to be addressed in future experiments. In our study, patients on CD have significantly lower Angptl8 levels as compared with subjects with an egfr 50 ml/min/1.73 m 2. These data suggest that Angptl8 is probably not eliminated by the kidneys. In contrast to Angptl8, other adipokines and hepatokines including leptin (23), adiponectin (24), retinol-binding protein-4 (8), progranulin (25), adipocyte fatty acid-binding protein (26), FGF21 (10), and chemerin (9) are significantly elevated in endstage renal disease. Interestingly, circulating Angptl8 was found to be significantly increased after as compared with before hemodialysis in a subset of the patients (n 31, mean SD level g/l as compared with g/l, P.001). First, these results suggest that the adipokine/hepatokine is not dialyzable. It is possible that hemoconcentration from the removal of fluid may have contributed to this change. Alternatively, Angptl8 secretion may be enhanced in tissues as a reaction to the hemodynamic or metabolic changes induced by dialysis. Furthermore, based on our results, one could speculate that Angptl8 decreases in renal failure as has been shown for other cytokines (27, 28). Clearly, additional experiments need to be performed to elucidate by which mechanisms circulating Angptl8 is regulated during renal failure and eliminated. Besides markers of glucose homeostasis and renal function, Angptl8 is directly and independently associated with age, gender, BMI, and HDL cholesterol in the current report. To date, no study has determined regulation of this adipokine/hepatokine in T2DM. Only one study has assessed circulating Angptl8 levels in 33 patients with T1DM revealing no correlation of Angptl8 with age, BMI, and HDL cholesterol (6). Clearly, the pathophysiological significance of these associations needs to be assessed in future studies. It is interesting to note in this context that a nonsynonymous variant in the Angptl8 gene affects plasma levels of LDL and HDL cholesterol without influencing TG (29). In the present study, Angptl8 serum levels were significantly higher in female as compared with male subjects in
7 E2516 Ebert et al Angptl8 and Type 2 Diabetes Mellitus J Clin Endocrinol Metab, December 2014, 99(12):E2510 E2517 agreement with findings for other adipokines and hepatokines including adiponectin (30), leptin (31, 32), vaspin (7), and FGF21 (10). It needs to be determined whether an inhibitory effect of androgens on expression of Angptl8 exists similar to adiponectin and leptin (30, 33). It should be noted that Angptl8 concentrations in our study were higher as compared with circulating levels of this novel adipokine/hepatokine in a previous study (6). Different patient characteristics and ELISA systems might well explain the observed variations. Taken together, circulating Angptl8 is independently and positively associated with T2DM and FG in vivo. Furthermore, insulin induces Angptl8 mrna expression in differentiated 3T3-L1 adipocytes in vitro. The physiological significance of these findings, as well as the factors contributing to Angptl8 regulation in humans, needs to be established in future experiments. Acknowledgments Addressallcorrespondenceandrequestsforreprintsto:ThomasEbert, MD, Leipzig University Medical Center, Liebigstrasse 20, Leipzig, Germany. Thomas.ebert@medizin.uni-leipzig.de. This study was supported by grants to M.F. from the Deutsche Forschungsgemeinschaft (DFG) (SFB 1052/1, C06) and the Federal Ministry of Education and Research (BMBF), Germany (FKZ: 01EO1001 [Integrated Research and Treatment Center AdiposityDiseases, project K7 58]), and the Deutsche Hochdruckliga ev, as well as grants to S.K. and T.E. from the German Diabetes Association (DDG). Furthermore, T.E. was supported by the BMBF, Germany (FKZ: 01EO1001 [Integrated Research and Treatment Center AdiposityDiseases, MetaRot program]) and by grant of MSD Sharp and Dohme GmbH (MSD Stipendium 2013 Diabetologie). Moreover, A.T. was supported by grants from the DFG (SFB 1052/1, C01 and SPP 1629 TO 718/2 1), from the DDG, and from the Diabetes Hilfs- und Forschungsfonds Deutschland. Author contributions: T.E., S.K., A.T., and M.F. wrote the manuscript and researched data. A.H., A.B., and J.K., researched data and reviewed/edited the manuscript. U.L. researched data. M.B. and M.S. contributed to the discussion and reviewed/edited the manuscript. Dr Thomas Ebert is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Disclosure Summary: No conflict of interest is declared. References 1. Considine RV, Sinha MK, Heiman ML, et al. Serum Immunoreactive-Leptin Concentrations in Normal-Weight and Obese Humans. N Engl J Med. 1996;334: Hou N, Luo JD. Leptin and cardiovascular diseases. Clin Exp Pharmacol Physiol. 2011;38: Kharitonenkov A, Shiyanova TL, Koester A, et al. FGF-21 as a novel metabolic regulator. J Clin Invest. 2005;115: Sarruf DA, Thaler JP, Morton GJ, et al. Fibroblast growth factor 21 action in the brain increases energy expenditure and insulin sensitivity in obese rats. Diabetes. 2010;59: Yi P, Park JS, Melton DA. Betatrophin: a hormone that controls pancreatic cell proliferation. Cell. 2013;153: Espes D, Lau J, Carlsson PO. Increased circulating levels of betatrophin in individuals with long-standing type 1 diabetes. Diabetologia. 2014;57: Seeger J, Ziegelmeier M, Bachmann A, et al. Serum levels of the adipokine vaspin in relation to metabolic and renal parameters. J Clin Endocrinol Metab. 2008;93: Ziegelmeier M, Bachmann A, Seeger J, et al. Serum levels of adipokine retinol-binding protein-4 in relation to renal function. Diabetes Care. 2007;30: Pfau D, Bachmann A, Lössner U, et al. Serum levels of the adipokine chemerin in relation to renal function. Diabetes Care. 2010;33: Stein S, Bachmann A, Lössner U, et al. Serum levels of the adipokine FGF21 depend on renal function. Diabetes Care. 2009;32: Levey AS, Bosch JP, Lewis JB, et al. A more accurate method to estimate glomerular filtration rate from serum creatinine: a new prediction equation. Modification of Diet in Renal Disease Study Group. Ann Intern Med. 1999;130: American Diabetes Association. Diagnosis and classification of diabetes mellitus. Diabetes Care. 2013;36:S67 S Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28: Mai M, Tönjes A, Kovacs P, Stumvoll M, Fiedler GM, Leichtle AB. Serum Levels of Acylcarnitines Are Altered in Prediabetic Conditions. PLoS One. 2013;8:e Ebert T, Wurst U, Kralisch S, Stumvoll M, Fasshauer M. The novel adipokine/hepatokine betatrophin is increased in gestational diabetes mellitus. Diabetes. 2014;63(Suppl 1):A212 A343; 1267-P. 16. Kralisch S, Sommer G, Weise S, et al. Interleukin-1 is a positive regulator of TIARP/STAMP2 gene and protein expression in adipocytes in vitro. FEBS Lett. 2009;583: Kralisch S, Klein J, Lossner U, et al. Isoproterenol, TNF, and insulin downregulate adipose triglyceride lipase in 3T3 L1 adipocytes. Mol Cell Endocrinol. 2005;240: Fasshauer M, Klein J, Neumann S, Eszlinger M, Paschke R. Hormonal regulation of adiponectin gene expression in 3T3 L1 adipocytes. Biochem Biophys Res Commun. 2002;290: Motoshima H, Wu X, Sinha MK, et al. Differential regulation of adiponectin secretion from cultured human omental and subcutaneous adipocytes: effects of insulin and rosiglitazone. J Clin Endocrinol Metab. 2002;87: Kralisch S, Weise S, Sommer G, et al. Interleukin-1 induces the novel adipokine chemerin in adipocytes in vitro. Regul Pept. 2009; 154: Zhang Y, Scarpace PJ. The role of leptin in leptin resistance and obesity. Physiol Behav. 2006;88: Ren G, Kim JY, Smas CM. Identification of RIFL, a novel adipocyteenriched insulin target gene with a role in lipid metabolism. Am J Physiol Endocrinol Metab. 2012;303:E334 E Merabet E, Dagogo-Jack S, Coyne DW, et al. Increased plasma leptin concentration in end-stage renal disease. J Clin Endocrinol Metab. 1997;82: Zoccali C, Mallamaci F, Tripepi G, et al. Adiponectin, metabolic risk factors, and cardiovascular events among patients with endstage renal disease. J Am Soc Nephrol. 2002;13: Richter J, Focke D, Ebert T, et al. Serum levels of the adipokine progranulin depend on renal function. Diabetes Care. 2013;36: Sommer G, Ziegelmeier M, Bachmann A, et al. Serum levels of
8 doi: /jc jcem.endojournals.org E2517 adipocyte fatty acid binding protein are increased in chronic haemodialysis. Clin Endocrinol (Oxf). 2008;69: Ebert T, Focke D, Petroff D, et al. Serum levels of the myokine irisin in relation to metabolic and renal function. Eur J Endocrinol. 2014; 170: Ebert T, Bachmann A, Lössner U, et al. Serum levels of angiopoietinrelated growth factor in diabetes mellitus and chronic hemodialysis. Metabolism. 2009;58: Quagliarini F, Wang Y, Kozlitina J, et al. Atypical angiopoietin-like protein that regulates ANGPTL3. Proc Natl Acad SciUSA. 2012; 109: Nishizawa H, Shimomura I, Kishida K, et al. Androgens decrease plasma adiponectin, an insulin-sensitizing adipocyte-derived protein. Diabetes. 2002;51: Horn R, Geldszus R, Pötter E, von zur Mühlen A, Brabant G. Radioimmunoassay for the detection of leptin in human serum. Exp Clin Endocrinol Diabetes. 1996;104: Ma Z, Gingerich RL, Santiago JV, Klein S, Smith CH, Landt M. Radioimmunoassay of leptin in human plasma. Clin Chem. 1996; 42: Kapoor D, Clarke S, Stanworth R, Channer KS, Jones TH. The effect of testosterone replacement therapy on adipocytokines and C-reactive protein in hypogonadal men with type 2 diabetes. Eur J Endocrinol. 2007;156:
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationSerum Levels of the Adipokine Progranulin Depend on Renal Function
Pathophysiology/Complications O R I G I N A L A R T I C L E Serum Levels of the Adipokine Progranulin Depend on Renal Function JUDIT RICHTER, MS 1,2 DENISE FOCKE, MD 1 THOMAS EBERT, MD 1,2 PETER KOVACS,
More informationAssociation of serum adipose triglyceride lipase levels with obesity and diabetes
Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,
More informationSerum levels of the adipokine RBP-4 in relation to renal function
Diabetes Care Publish Ahead of Print, published online July 13, 2007 Serum levels of the adipokine RBP-4 in relation to renal function Michaela Ziegelmeier, MS 1#, Anette Bachmann, MD 1#, Jeannette Seeger,
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationResearch Article Increased Serum ANGPTL8 Concentrations in Patients with Prediabetes and Type 2 Diabetes
Hindawi Diabetes Research Volume 2017, Article ID 8293207, 7 pages https://doi.org/10.1155/2017/8293207 Research Article Increased Serum Concentrations in Patients with Prediabetes and Type 2 Diabetes
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More informationLetter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
More informationElevated serum levels of visfatin in gestational diabetes: a comparative study across various degrees of glucose tolerance
Diabetologia (2007) 50:1033 1037 DOI 10.1007/s00125-007-0610-7 SHORT COMMUNICATION Elevated serum levels of visfatin in gestational diabetes: a comparative study across various degrees of glucose tolerance
More information2011, Editrice Kurtis
J. Endocrinol. Invest. : -, 2011 DOI: 10.2/902 The role of visfatin in the pathogenesis of gestational diabetes mellitus D.E. Gok 1, M. Yazici 1, G. Uckaya 1, S.E. Bolu 1, Y. Basaran 2, T. Ozgurtas, S.
More informationAssociation between Raised Blood Pressure and Dysglycemia in Hong Kong Chinese
Diabetes Care Publish Ahead of Print, published online June 12, 2008 Raised Blood Pressure and Dysglycemia Association between Raised Blood Pressure and Dysglycemia in Hong Kong Chinese Bernard My Cheung,
More informationLEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationAdiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance.
ORIGINAL ARTICLE Adiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance. Bonneau GA y Pedrozo WR 1 Ministry of Public Health, Province of Misiones, 2 School of Exact, Chemical
More informationPongamorn Bunnag, MD Boonsong Ongphiphadhanakul, MD. Mahidol University
Roles oesof Fetuin-A in Hypertension Pongamorn Bunnag, MD Boonsong Ongphiphadhanakul, MD Ramathibodi Hospital Mahidol University Fetuin-A (Alpha-2-HS-glycoprotein) Multi-functional protein secreted by
More informationMETABOLIC SYNDROME IN REPRODUCTIVE FEMALES
METABOLIC SYNDROME IN REPRODUCTIVE FEMALES John J. Orris, D.O., M.B.A Division Head, Reproductive Endocrinology & Infertility, Main Line Health System Associate Professor, Drexel University College of
More informationATHEROSCLEROTIC cardiovascular complications are the leading cause of. Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease
Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease To Decrease Plasma Adiponectin Levels Kuei-Chuan CHAN, 1 MD, Hsi-Hsien CHOU, 1 PhD, Der-Jinn WU, 1 PhD, Yi-Liang WU, 1 MD, and Chien-Ning
More informationSerum uric acid levels improve prediction of incident Type 2 Diabetes in individuals with impaired fasting glucose: The Rancho Bernardo Study
Diabetes Care Publish Ahead of Print, published online June 9, 2009 Serum uric acid and incident DM2 Serum uric acid levels improve prediction of incident Type 2 Diabetes in individuals with impaired fasting
More informationTable S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).
Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52
More informationStudy of the correlation between growth hormone deficiency and serum leptin, adiponectin, and visfatin levels in adults
Study of the correlation between growth hormone deficiency and serum leptin, adiponectin, and visfatin levels in adults Z.-P. Li 1, M. Zhang 2, J. Gao 3, G.-Y. Zhou 3, S.-Q. Li 1 and Z.-M. An 3 1 Golden
More informationAssessment of glomerular filtration rate in healthy subjects and normoalbuminuric diabetic patients: validity of a new (MDRD) prediction equation
Nephrol Dial Transplant (2002) 17: 1909 1913 Original Article Assessment of glomerular filtration rate in healthy subjects and normoalbuminuric diabetic patients: validity of a new () prediction equation
More information300 Biomed Environ Sci, 2018; 31(4):
300 Biomed Environ Sci, 2018; 31(4): 300-305 Letter to the Editor Combined Influence of Insulin Resistance and Inflammatory Biomarkers on Type 2 Diabetes: A Population-based Prospective Cohort Study of
More informationPrediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects
Tokai J Exp Clin Med., Vol. 37, No. 4, pp. 12-16, 212 Prediction of Homeostasis Model Assessment of Insulin Resistance in Japanese Subjects Masako NEGAMI, Eiko TAKAHASHI, Hiroki OTSUKA and Kengo MORIYAMA
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationSerum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
More informationCirculating Betatrophin Levels Are Associated with the Lipid Profile in Type 2 Diabetes
Original Article www.cmj.ac.kr Circulating Betatrophin Levels Are Associated with the Lipid Profile in Type 2 Diabetes Hassan Ghasemi, Heidar Tavilani, Iraj Khodadadi, Massoud Saidijam 1 and Jamshid Karimi*
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationReview Article The Relationship between Betatrophin Levels in Blood and T2DM: A Systematic Review and Meta-Analysis
Hindawi Publishing Corporation Disease Markers Volume 2016, Article ID 9391837, 7 pages http://dx.doi.org/10.1155/2016/9391837 Review Article The Relationship between Betatrophin Levels in Blood and T2DM:
More informationNicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:
Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',
More informationMETABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
More informationFibroblast Growth Factor 21 (FGF21) in Human Cerebrospinal Fluid. Relationship With Plasma FGF21 and Body Adiposity
BRIEF REPORT Fibroblast Growth Factor 21 (FGF21) in Human Cerebrospinal Fluid Relationship With Plasma FGF21 and Body Adiposity Bee K. Tan, 1,2 Manfred Hallschmid, 3 Raghu Adya, 1 Werner Kern, 4 Hendrik
More informationA Novel Adipocytokine, Visceral Adipose Tissue-derived Serine Protease Inhibitor (Vaspin), and Obesity
The Journal of International Medical Research 2008; 36: 625 629 A Novel Adipocytokine, Visceral Adipose Tissue-derived Serine Protease Inhibitor (Vaspin), and Obesity Q LI 1,2, R CHEN 2,3, J MORIYA 2,
More informationPREVALENCE OF METABOLİC SYNDROME İN CHİLDREN AND ADOLESCENTS
PREVALENCE OF METABOLİC SYNDROME İN CHİLDREN AND ADOLESCENTS Mehmet Emre Atabek,MD,PhD Necmettin Erbakan University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Endocrinology and
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationObesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea
https://doi.org/10.7180/kmj.2016.31.2.157 KMJ Original Article Obesity and Insulin Resistance According to Age in Newly Diagnosed Type 2 Diabetes Patients in Korea Ju Won Lee, Nam Kyu Kim, Hyun Joon Park,
More informationAssociations of betatrophin levels with irisin in Chinese women with normal glucose tolerance
Xie et al. Diabetology & Metabolic Syndrome (2015) 7:26 DOI 10.1186/s13098-015-0019-2 DIABETOLOGY & METABOLIC SYNDROME RESEARCH Open Access Associations of betatrophin levels with irisin in Chinese women
More informationFat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women
ORIGINAL ARTICLE Fat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women Miwa Ryo 1, Tohru Funahashi 1, Tadashi Nakamura 1, Shinji Kihara 1, Kazuaki Kotani
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Clinical perspective It was recently discovered that small RNAs, called micrornas, circulate freely and stably in human plasma. This finding has sparked interest in the potential
More informationORIGINAL INVESTIGATION. C-Reactive Protein Concentration and Incident Hypertension in Young Adults
ORIGINAL INVESTIGATION C-Reactive Protein Concentration and Incident Hypertension in Young Adults The CARDIA Study Susan G. Lakoski, MD, MS; David M. Herrington, MD, MHS; David M. Siscovick, MD, MPH; Stephen
More informationPlasma Retinol-Binding Protein-4 Concentrations Are Elevated in Human Subjects With Impaired Glucose Tolerance and Type 2 Diabetes
Pathophysiology/Complications O R I G I N A L A R T I C L E Plasma Retinol-Binding Protein-4 Concentrations Are Elevated in Human Subjects With Impaired Glucose Tolerance and Type 2 Diabetes YOUNG MIN
More informationAndrejs Kalvelis 1, MD, PhD, Inga Stukena 2, MD, Guntis Bahs 3 MD, PhD & Aivars Lejnieks 4, MD, PhD ABSTRACT INTRODUCTION. Riga Stradins University
CARDIOVASCULAR RISK FACTORS ORIGINAL ARTICLE Do We Correctly Assess the Risk of Cardiovascular Disease? Characteristics of Risk Factors for Cardiovascular Disease Depending on the Sex and Age of Patients
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationCardiometabolic Side Effects of Risperidone in Children with Autism
Cardiometabolic Side Effects of Risperidone in Children with Autism Susan J. Boorin, MSN, PMHNP-BC PhD Candidate Yale School of Nursing 1 This speaker has no conflicts of interest to disclose. 2 Boorin
More informationSERUM VISFATIN LEVELS IN PATIENTS WITH SUBCLINICAL AND NEWLY DIAGNOSED TYPE 2 DIABETES MELLITUS
Acta Medica Mediterranea, 2017, 33: 197 SERUM VISFATIN LEVELS IN PATIENTS WITH SUBCLINICAL AND NEWLY DIAGNOSED TYPE 2 DIABETES MELLITUS ASLAN ÇELEBI * MUJGAN GURLER **, DENIZ ÖGÜTMEN KOC *, ALI ABBAS OZDEMIR
More informationTypes of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline
INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation
More informationAssociations among Body Mass Index, Insulin Resistance, and Pancreatic ß-Cell Function in Korean Patients with New- Onset Type 2 Diabetes
ORIGINAL ARTICLE korean j intern med 2012;27:66-71 pissn 1226-3303 eissn 2005-6648 Associations among Body Mass Index, Insulin Resistance, and Pancreatic ß-Cell Function in Korean Patients with New- Onset
More informationLower levels sex hormone-binding globulin independently associated with metabolic syndrome in pre-elderly and elderly men in China
Journal of Geriatric Cardiology (2013) 10: 28 33 2013 JGC All rights reserved; www.jgc301.com Research Article Open Access Lower levels sex hormone-binding globulin independently associated with metabolic
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationHbA1c is associated with intima media thickness in individuals with normal glucose tolerance
Diabetes Care Publish Ahead of Print, published online October 6, 2009 Glucose metabolism and IMT HbA1c is associated with intima media thickness in individuals with normal glucose tolerance Thomas Bobbert,
More information25-Hydroxyvitamin D is closely related with the function of the pancreatic islet β cells
Original Article 25-Hydroxyvitamin D is closely related with the function of the pancreatic islet β cells Jingjing Guo 1, Zhengda Xiao 2, Xia Xue 3, Xin Liu 4, Yong Lu 5, Xiao Yin 6, Kun Ma 7 Open Access
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationSupplementary Online Content
Supplementary Online Content Kavousi M, Leening MJG, Nanchen D, et al. Comparison of application of the ACC/AHA guidelines, Adult Treatment Panel III guidelines, and European Society of Cardiology guidelines
More informationA novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
More informationSerum Retinol-binding Protein 4 Levels in Patients with Diabetic Retinopathy
The Journal of International Medical Research 2010; 38: 95 99 Serum Retinol-binding Protein 4 Levels in Patients with Diabetic Retinopathy Z-Z LI 1, X-Z LU 2, J-B LIU 1 AND L CHEN 1 1 Department of Endocrinology,
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationAssociation between serum IGF-1 and diabetes mellitus among US adults
Diabetes Care Publish Ahead of Print, published online July 16, 2010 Association between serum IGF-1 and diabetes mellitus among US adults Running title: Serum IGF-1 and diabetes mellitus Srinivas Teppala
More informationAn update on the obesity epidemics in CKD and in ESRD. Does it really matter?
EURECA-m 2011 An update on cutting-edge Cardiovascular and Renal Medicine themes. An update on the obesity epidemics in CKD and in ESRD. Does it really matter? Francesca Mallamaci BMI>30 25 Ireland 20
More informationDiabetes and Obesity Sex- and Gender-differences!
Oskar Kokoschka 1908 Das Mädchen Li und ich Diabetes and Obesity Sex- and Gender-differences! Alexandra Kautzky Willer IGM, Berlin 2015 Global Diabetes-Epidemic Increase (%) in age-standardised diabetes
More informationDiabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome
Diabetes and Cardiovascular Risks in the Polycystic Ovary Syndrome John E. Nestler, M.D. William Branch Porter Professor of Medicine Chair, Department of Internal Medicine Virginia Commonwealth University
More informationSupplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationCARDIOVASCULAR RISK FACTORS & TARGET ORGAN DAMAGE IN GREEK HYPERTENSIVES
CARDIOVASCULAR RISK FACTORS & TARGET ORGAN DAMAGE IN GREEK HYPERTENSIVES C. Liakos, 1 G. Vyssoulis, 1 E. Karpanou, 2 S-M. Kyvelou, 1 V. Tzamou, 1 A. Michaelides, 1 A. Triantafyllou, 1 P. Spanos, 1 C. Stefanadis
More informationSYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)
TITLE OF THE STUDY / REPORT No. / DATE OF REPORT INVESTIGATORS / CENTERS AND COUNTRIES Clinical Study Report Protocol BC20779: Multicenter, double-blind, randomized, placebo-controlled, dose ranging phase
More informationFAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat
Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004
More informationObesity in the pathogenesis of chronic disease
Portoroz October 16th 2013 Obesity in the pathogenesis of chronic disease Rocco Barazzoni University of Trieste Department of Medical, Surgical and Health Sciences Obesity Trends* Among U.S. Adults BRFSS,
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More informationObesity mediated hypertension and renal dysfunction
Obesity mediated hypertension and renal dysfunction Gergely Bodor Marion Hervouet Nicky Honnef Mariarosaria Malgadi Julie Robert Tutor: Pr Alina Parvu Objectives 1. Introduction 2. Renal structural and
More informationJMSCR Vol 06 Issue 12 Page December 2018
www.jmscr.igmpublication.org Impact Factor (SJIF): 6.379 Index Copernicus Value: 79.54 ISSN (e)-2347-176x ISSN (p) 2455-0450 DOI: https://dx.doi.org/10.18535/jmscr/v6i12.63 Insulinemic Status and Nonalcoholic
More informationEstablishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group
Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to
More informationChronic kidney disease (CKD) has received
Participant Follow-up in the Kidney Early Evaluation Program (KEEP) After Initial Detection Allan J. Collins, MD, FACP, 1,2 Suying Li, PhD, 1 Shu-Cheng Chen, MS, 1 and Joseph A. Vassalotti, MD 3,4 Background:
More informationChapter Two Renal function measures in the adolescent NHANES population
0 Chapter Two Renal function measures in the adolescent NHANES population In youth acquire that which may restore the damage of old age; and if you are mindful that old age has wisdom for its food, you
More informationClinical Trial Results Disclosure Synopsis
Clinical Trial Results Disclosure Synopsis Short Title: The SPLENDOR study Name of Sponsor: Takeda Italia S.p.A. Via Elio Vittorini, 129 00144 Rome, Italy Title of Study: Effects of Pioglitazone on endothelial
More informationInflammatory Biomarkers (Il-18, Hs-Crp) and Serum Lipids: A Novel Approach to Screen Early Diabetic Nephropathy
Inflammatory Biomarkers (Il-18, Hs-Crp) and Serum Lipids: A Novel Approach to Screen Early Diabetic Nephropathy Dr. Yeshavanth G 1*, Dr. Sachin Bongale 2 1* MBBS, MD, S.S. institute of medical sciences
More informationDiabetes Care Publish Ahead of Print, published online October 17, 2008
Diabetes Care Publish Ahead of Print, published online October 17, 2008 Serum FABPs and diabetic nephropathy Circulating levels of adipocyte and epidermal fatty acid-binding proteins in relation to nephropathy
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationBariatric Surgery versus Intensive Medical Therapy for Diabetes 3-Year Outcomes
The new england journal of medicine original article Bariatric Surgery versus Intensive Medical for Diabetes 3-Year Outcomes Philip R. Schauer, M.D., Deepak L. Bhatt, M.D., M.P.H., John P. Kirwan, Ph.D.,
More informationAssociation between arterial stiffness and cardiovascular risk factors in a pediatric population
+ Association between arterial stiffness and cardiovascular risk factors in a pediatric population Maria Perticone Department of Experimental and Clinical Medicine University Magna Graecia of Catanzaro
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schauer PR, Kashyap SR, Wolski K, et al. Bariatric surgery
More informationClinical Study Factors Associated with the Decline of Kidney Function Differ among egfr Strata in Subjects with Type 2 Diabetes Mellitus
International Endocrinology Volume 2012, Article ID 687867, 6 pages doi:10.1155/2012/687867 Clinical Study Factors Associated with the Decline of Kidney Function Differ among egfr Strata in Subjects with
More informationDr. Dermot Phelan MB BCh BAO PhD European Society of Cardiology 2012
Relative Apical Sparing of Longitudinal Strain Using 2- Dimensional Speckle-Tracking Echocardiography is Both Sensitive and Specific for the Diagnosis of Cardiac Amyloidosis. Dr. Dermot Phelan MB BCh BAO
More informationPlasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationObesity, metabolic dysfunction, and the risk of obesity-related cancer
Boston University OpenBU Theses & Dissertations http://open.bu.edu Boston University Theses & Dissertations 2016 Obesity, metabolic dysfunction, and the risk of obesity-related cancer Chadid, Susan https://hdl.handle.net/2144/16734
More informationBetatrophin is correlated with glucagon and insulin release rather than insulin resistance marker in type 2 diabetes mellitus Iraqi women
International Journal of Research in Medical Sciences Mohammed AK et al. Int J Res Med Sci. 2016 Oct;4(10):4264-4271 www.msjonline.org pissn 2320-6071 eissn 2320-6012 Research Article DOI: http://dx.doi.org/10.18203/2320-6012.ijrms20163119
More informationSerum leptin levels in psoriatic patients with non-alcoholic fatty liver disease
Original Article Serum leptin levels in psoriatic patients with non-alcoholic fatty liver disease Zahra Hallaji, MD 1,2 Vahideh Lajevardi, MD 1,2 Robabeh Abedini, MD 1,2 Amir Soleymani, MD 1 Azadeh Goodarzi,
More informationA STUDY ON DYSLIPIDAEMIA IN CHRONIC KIDNEY DISEASE (CKD) WITH SPECIAL REFERENCE TO HAEMODIALYSIS
A STUDY ON DYSLIPIDAEMIA IN CHRONIC KIDNEY DISEASE (CKD) WITH SPECIAL REFERENCE TO HAEMODIALYSIS Shweta Sharma 1, Sandhya Gautam 2, Dhanveer Singh 3, Prachi Sharma 4, Avriti Baweja 5 1Assistant Professor,
More informationNaohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT
Naohito AOKI, Erina ARAKAWA and Miyuki ITO Department of Life Science, Graduate School of Bioresources, Mie University Tsu 514-857 ABSTRACT C57BL/6J mice (male, 4wk old) were fed low fat diet (LF), high
More informationObesity may attenuate the HbA1c-lowering effect of sitagliptin in Japanese type 2 diabetic patients
ORIGINAL ARTICLE Obesity may attenuate the HbA1c-lowering effect of sitagliptin in Japanese type 2 diabetic patients Yukihiro Bando, Hideo Kanehara, Keiko Aoki, Azusa Hisada, Daisyu Toya, Nobuyoshi Tanaka
More informationSupplementary Material 1. Statistical methods used to conduct power calculations.
Supplementary Material 1. Statistical methods used to conduct power calculations. Post-hoc power calculations and patient numbers needed to detect changes were conducted considering (i) the observed partial
More informationInsulin Resistance as a Key Factor in the Development of Metabolic and Inflammatory Biomarkers in Obese Children
Research Article imedpub Journals http://www.imedpub.com/ International Journal of Digestive Diseases Insulin Resistance as a Key Factor in the Development of Metabolic and Inflammatory Biomarkers in Obese
More informationFibroblast Growth Factor 21 and Fetuin-A in Obese Adolescents With and Without Type 2 Diabetes
ORIGINAL ARTICLE Fibroblast Growth Factor 21 and Fetuin-A in Obese Adolescents With and Without Type 2 Diabetes Thomas Reinehr, Beate Karges, Thomas Meissner, Susanna Wiegand, Maria Fritsch, Reinhard W.
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationAdiponectin/leptin ratio and insulin resistance in pregnancy
Research Note Adiponectin/leptin ratio and insulin resistance in pregnancy Journal of International Medical Research 41(1) 123 128! The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalspermissions.nav
More information