Melatonin improves vascular reactivity of endotoxemia rats

Size: px
Start display at page:

Download "Melatonin improves vascular reactivity of endotoxemia rats"

Transcription

1 Acta Physiologica Sinica, June 25, 2005, 57 (3): , *,,,, (melatonin, MT) (lipopolysaccharide LPS) LPS LPS+MT MT (phenylephrine PE) (acetylcholine ACh) (malondialhyde MDA) (superoxide dismutes SOD) LPS 6 h PE (P<0.01), PE ( ~ mol/l) ACh (P<0.01) ACh ( ~ mol/l) MT LPS PE LPS LPS+MT PE ACh LPS MT LPS MDA SOD MT Q463; R363.2 Melatonin improves vascular reactivity of endotoxemia rats XING Han-Ying, LING Yi-Ling *, MENG Ai-Hong, ZHAO Xiao-Yun, HUANG Xin-Li Department of Pathophysiology, Hebei Medical University, Shijiazhuang , China Abstract: The purpose of the present study was to investigate the effect of melatonin (MT) on the abnormal reactivity of thoracic aorta and pulmonary artery induced by lipopolysaccharide (LPS) in rats. Sprague-Dawley rats were divided into four groups randomly: (1) Vehicle group; (2) LPS group: LPS (4 mg/kg, i.p.); (3) LPS+MT group: MT (5 mg/ml, i.p.) was given 30 min before LPS and 60 min after LPS (4 mg/kg,i.p); (4) MT group: received two doses of MT, 90 min after the first injection of MT another dose of MT was given. Six hours after LPS injection the rats were killed and both thoracic aortic rings (TARs) and pulmonary artery rings (PARs)were prepared. The reactivity of TARs and PARs in the four subgroups was tested separately. The contraction response to phenylephrine (PE) and the endothelium-dependent relaxation response (EDRR) to ACh were observed with the isolated artery ring technique. Concentration-response curves were generated with ACh or PE ( ~ mol/l). Superoxide dismutes (SOD) activity and the content of malondialhyde (MDA) in artery tissues were detected. For TARs, LPS significantly reduced the contraction response to PE compared with the vehicle group (P<0.01) and the curve of cumulative dose responses to PE in the LPS group shifted downward. Although EDRR to ACh in the LPS group had the tendency to decrease but still showed no significant difference compared with the vehicle group (P>0.05). For PARs, EDRR to ACh was depressed significantly in the LPS group (P<0.01), while no effect on contraction response to PE in the LPS group was observed, compared with the vehicle group (P> 0.05). Compared with the LPS group, TARs in the LPS+MT group exhibited an increased contraction response to PE, but were still lower than that in the vehicle group. Similarly, EDRR to ACh of PARs in the LPS+MT group was improved significantly and there was no difference between the LPS+MT group and the vehicle group.the vascular reactivity was unaffected in MT group compared with the vehicle group in both TARs and PARs. SOD activity Received Accepted * Corresponding author. Tel: ; Fax: ; lingyiling@tom.com

2 368 Acta Physiologica Sinica, June 25, 2005, 57(3): in the LPS +MT group increased significantly and the content of MDA decreased markedly compared with the LPS group. These results suggest that MT may improve the vascular reactivity in endotoxemia rats due to its antioxidant properties. Key words: melatonin; lipopolysaccharides; pulmonary artery; thoracic aorta (melatonin MT) MT MT [1] (lipopolysaccharide LPS) LPS [2,3] MT MT [4-6] MT MT LPS MT LPS ACh Sigma, (phenylephrine PE), (malondialhyde MDA) (superoxide dismutes SOD) 1.2 Sprague- Dawley 230~260 g 12 h 4 (1) (i.p.) (2) LPS LPS 4 mg/kg i.p.; (3) LPS+MT MT 5 mg/kg( 0.5%) i.p. 30 min LPS 4 mg/kg i.p. LPS 60 min MT 5 mg/kg (4) MT MT 5 mg/kg i.p. 90 min MT 5 mg/ kg LPS 6 h MT 5 h MT 8:30~10: (50 mg/ kg i.p.) 4 Krebs-Ringer bicarbonate (KRB) 95% O 2-5%CO 2 (ph 7.2~ 7.4) 3~4 mm (thoracic aortic rings, TARs) 2 mm (pulmonary artery rings PARs) 1 1 ( 80 MDA SOD ) ml KRB KRB mol/l ( ) 15 min 2 g 90 min 15 min 1 g 60 min 15 min (60~ 70 ) mol/l PE KRB (1) mol/l PE (2) mol/l ACh (3) mol/l PE ACh ( ~ mol/l) (4) ~ mol/l PE, KRB g/mg dw PE ( mol/l) 1.5 SOD MDA 80 10% (0.9%

3 : ) r/min 4 5 min SOD MDA 2~3 3~4 1.6 mean ± SD (one way ANOVA) Newman-Kuels q 369 P< LPS LPS 6 h mol/l PE (P<0.01) PE ( ~ mol/l), PE ( mol/l PE Table 1. Contractive response to PE in thoracic aortic rings and pulmonary artery rings from each group Group mol/l PE (g/mg dw) n Thoracic aortic rings n Pulmonary artery rings Vehicle ± ±0.22 LPS ±0.09 ** ±0.16 LPS+MT ±0.08 *## ±0.17 M T ± ±0.19 The rings were from rats treated with vehicle, LPS (4 mg/kg), LPS+MT (5 mg/kg 2) or MT only. mean ± SD. * P<0.05, ** P<0.01 vs vehicle; ## P<0.01 vs LPS mol/l ACh Table 2. Relaxation response to ACh in thoracic aortic rings and pulmonary artery rings from each group mol/l ACh (%) Group n Thoracic aortic rings n Pulmonary artery rings Vehicle ± ±7.38 LPS ± ±12.18 ** LPS+MT ± ±11.80 ## M T ± ±6.03 The relaxation responses were expressed as percentage reduction of mol/l PE-induced initial vascular tension. mean ± SD. ** P<0.01 vs vehicle, ## P<0.01 vs LPS ~ mol/l PE Fig.1. Contraction responses to cumulative doses of PE ( ~ mol/l) in thoracic aortic rings. mean ± SD. * P<0.05 vs vehicle, # P<0.05 vs LPS. 1 1) mol/l ACh (P> ) mol/l ACh (P<0.01) ACh ( ~ mol/l) ( 4); mol/l PE (P>0.05, 1 3) 2.2 MT LPS LPS+MT PE LPS (P<0.01) ( 1) PE LPS ( 1) mol/l ACh LPS (P>0.05) LPS+MT

4 370 Acta Physiologica Sinica, June 25, 2005, 57(3): ~ mol/l ACh Fig. 2. Endothelium-dependent relaxation responses to cumulative doses of ACh ( ~ mol/l) in thoracic aortic rings. The relaxation responses were expressed as percentage reduction of mol/l PE-induced vascular tension. The responses to cumulative doses of ACh in LPS, LPS+MT or MT groups had no significant differences compared with the vehicle groups (P>0.05) ~ mol/l ACh Fig. 4. Endothelium-dependent relaxation responses to cumulative doses of ACh ( ~ mol/l) in pulmonary artery rings. The relaxation responses were expressed as percentage reduction of mol/l PE-induced vascular tension. * P<0.05 vs vehicle, # P<0.05 vs LPS ~ mol/l PE Fig. 3. Contraction responses to cumulative doses of PE ( ~ mol/l) in pulmonary artery rings. The responses to cumulative doses of PE in LPS, LPS+MT or MT groups had no significant differences compared with the vehicle groups (P>0.05) mol/l ACh LPS (P<0.01) ( 2) ~ mol/l ACh LPS ~ mol/l PE LPS ( 3 4) MT PE ACh (P>0.05) 2.3 MDA SOD LPS MDA SOD MT LPS MDA SOD ( 3) 3. MT MDA SOD Table 3. Effect of MT on MDA content and SOD activity in thoracic aorta and pulmonary artery from endotoxemia rats Group MDA (nmol/ml) SOD (U/ml) Thoracic aorta Pulmonary artery Thoracic aorta Pulmonary artery Vehicle 6.84± ± ± ±7.63 LPS 10.21±1.64 ** 13.33±1.08 ** 65.62±10.91 ** 65.63±8.60 * LPS+MT 6.79±1.55 ## 8.18±1.52 ## 79.57±6.66 ## 78.86±4.80 # M T 6.82± ± ± ±11.47 Thoracic aorta and pulmonary artery were from rats treated with vehicle, LPS (4 mg/kg), LPS+MT (5 mg/kg 2) or MT. mean ± SD, n=6. * P<0.05,, ** P<0.01 vs vehicle; # P<0.05, ## P<0.01 vs LPS.

5 : 3 MT PE 4 mg/ kg LPS MT 24 h [7] MT MT MT PE ACh ACh MT LPS LPS H 2 O 2 O 2 OH LPS inos [8] inos NO O 2 (ONOO ), OH LPS MDA MDA MT ONOO Gilad [9] ONOO MT DNA LPS+MT MDA LPS MT ONOO MT MT ONOO MT [10] ; ONOO OH [11,12] MT [13,14] MT 371 [15-18] MT SOD RNA LPS+MT SOD LPS MT LPS SOD O 2 H 2 O 2 O 2 ONOO MT MT MT SOD MT 1 Reiter RJ. Functional aspects of the pineal hormone melatonin in combating cell and tissue damage induced by free radicals. Eur J Endocrinol 1996; 134(4): Javesghani D, Hussain SN, Scheidel J, Quinn MT, Magder SA. Superoxide production in the vasculature of lipopolysaccharide-treated rats and pigs. Shock 2003; 19(5): Brandes RP, Koddenberg G, Gwinner W, Kim D, Kruse HJ, Busse R, Mugge A. Role of increased production of superoxide anions by NAD(P)H oxidase and xanthine oxidase in prolonged endotoxemia. Hypertension 1999; 33(5): Crespo E, Macias M, Pozo D, Escames G, Martin M, Vives F, Guerrero JM, Acuna-Castroviejo D. Melatonin inhibits expression of the inducible NO synthase in liver and lung and prevents endotoxemia in lipopolysaccharide-induced multiple organ dysfunction syndrome in rats. FASEB J 1999; 13 (12): Maestroni GJ. Melatonin as a therapeutic agent in experimental endotoxic shock. J Pineal Res 1996; 20(2): Wu CC, Chiao CW, Hsiao G, Chen A, Yen MH. Melatonin prevents endotoxin-induced circulatory failure in rats. J Pineal Res 2001; 30(3): Waldhauser F, Dietzel M. Daily and annual rhythms in human melatonin secretion: role in puberty control. Ann NY Acad SCI 1985; 453: Xia CF ( ), Hou Y,Xue L, Zhu GY, Tang CS. Influence of interleukin 10 on nitric oxide/nitric oxide synthase system of the aorta. Acta Physiol Sin ( ) 2001; 53(6): (Chinese,English abstract). 9 Gilad E, Cuzzocrea S, Zingarelli B, Salzman AL, Szabo C.

6 372 Melatonin is a scavenger of peroxynitrite. Life Sci 1997; 60 (10): PL169-PL Zhang H, Squadrito GL, Pryor WA. The reaction of melatonin with peroxynitrite: formation of melatonin radical cation and absence of stable nitrated products. Biochem Biophys Res Commun 1998; 251(1): Hardeland R, Reiter RJ, Poeggeler B, Tan DX. The significance of the metabolism of the neurohormone melatonin: antioxidative protection and formation of bioactive substances. Neurosci Biobehav Rev 1993; 17(3): Li XJ, Zhang LM, Gu J, Zhang AZ, Sun FY. Melatonin decreases production of hydroxyl radical during cerebral ischemia-reperfusion. Acta Pharmacol Sin ( ) 1997; 18(5): Costa EJ, Lopes RH, Lamy-Freund MT. Permeability of pure lipid bilayers to melatonin. J Pineal Res 1995; 19(3): Shida CS, Castrucci AM, Lamy-Freund MT. High melatonin Acta Physiologica Sinica, June 25, 2005, 57(3): solubility in aqueous medium. J Pineal Res 1994; 16(4): Melchiorri D, Reiter RJ, Attia AM, Hara M, Burgos A, Nistico G. Potent protective effect of melatonin on in vivo paraquatinduced oxidative damage in rats. Life Sci 1995; 56(2): Antolin I, Rodriguez C, Sainz RM, Mayo JC, Uria H, Kotler ML, Rodriguez-Colunga MJ, Tolivia D, Menendez-Pelaez A. Neurohormone melatonin prevents cell damage: effect on gene expression for antioxidant enzymes. FASEB J 1996; 10 (8): Acuna-Castroviejo D, Coto-Montes A, Gaia Monti M, Ortiz GG, Reiter RJ. Melatonin is protective against MPTP-induced striatal and hippocampal lesions. Life Sci 1997; 60(2): PL23-PL Wakatsuki A, Okatani Y, Shinohara K, Ikenoue N, Kaneda C, Fukaya T. Melatonin protects fetal rat brain against oxidative mitochondrial damage. J Pineal Res 2001; 30(1):

Melatonin reduces peroxynitrite-induced injury in aortic smooth muscle cells

Melatonin reduces peroxynitrite-induced injury in aortic smooth muscle cells 186 2004, Acta Pharmacologica Sinica Chinese Pharmacological Society Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com Melatonin reduces peroxynitrite-induced injury

More information

Multiple factors contributing to lipopolysaccharide-induced reactivity changes in rabbit pulmonary artery

Multiple factors contributing to lipopolysaccharide-induced reactivity changes in rabbit pulmonary artery Acta Physiologica Sinica, December 25, 2005, 57 (6): 737-741 http://www.actaps.com.cn 737 Research Paper Multiple factors contributing to lipopolysaccharide-induced reactivity changes in rabbit pulmonary

More information

Acutely administered melatonin reduces oxidative damage in lung and brain induced by hyperbaric oxygen

Acutely administered melatonin reduces oxidative damage in lung and brain induced by hyperbaric oxygen Acutely administered melatonin reduces oxidative damage in lung and brain induced by hyperbaric oxygen MARTA I. PABLOS, RUSSEL J. REITER, JIN-ING CHUANG, GENARO G. ORTIZ, JUAN M. GUERRERO, EWA SEWERYNEK,

More information

O R I G I N A L A R T I C L E

O R I G I N A L A R T I C L E Neuroendocrinology Letters Nos.1/2, Feb-Apr Vol.25, 2004 Copyright 2004 Neuroendocrinology Letters ISSN 0172 780X www.nel.edu Melatonin effects on Schiff s base levels induced by iodide administration

More information

Reactive oxygen species: Importance for ischemia/reperfusion (injury)

Reactive oxygen species: Importance for ischemia/reperfusion (injury) Physiologisches Institut Reactive oxygen species: Importance for ischemia/reperfusion (injury) Prof. Dr. Rainer Schulz Reactive oxygen species (ROS) in ischemia/reperfusion injury (IRI) ROS GOOD: Endogenous

More information

Comparative effects of melatonin,

Comparative effects of melatonin, J. Pineal Res. 2000; 29:100 107 Comparative effects of melatonin, L-deprenyl, Trolox and ascorbate in the suppression of hydroxyl radical formation during dopamine autoxidation in vitro Khaldy H, Escames

More information

D. Melatonin inhibits expression of the inducible NO synthase II in liver and lung and prevents

D. Melatonin inhibits expression of the inducible NO synthase II in liver and lung and prevents Melatonin inhibits expression of the inducible NO synthase II in liver and lung and prevents endotoxemia in lipopolysaccharide-induced multiple organ dysfunction syndrome in rats ELENA CRESPO,* MANUEL

More information

Protective effects of lovastatin on vascular endothelium injured by low density lipoprotein

Protective effects of lovastatin on vascular endothelium injured by low density lipoprotein Ma FX et al / Acta Pharmacol Sin 2003 Oct; 24 (10): 1027-1032 1027 2003, Acta Pharmacologica Sinica Chinese Pharmacological Society Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com

More information

Melatonin in septic shock: Some recent concepts

Melatonin in septic shock: Some recent concepts Journal of Critical Care (2010) 25, 656.e1 656.e6 Melatonin in septic shock: Some recent concepts Venkataramanujan Srinivasan PhD a, Seithikurippu R. Pandi-Perumal MSc b, D. Warren Spence BA c, Hisanori

More information

Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury

Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury K. Ran 1, D.-L. Yang 1, Y.-T. Chang 1, K.-M. Duan 2, Y.-W. Ou 2, H.-P. Wang 3 and Z.-J. Li 1 1 Department of Anesthesiology,

More information

Pregnanolone effects on the blood pressure of stress-induced hypertension in rats

Pregnanolone effects on the blood pressure of stress-induced hypertension in rats Acta Physiologica Sinica August June 25 25 2004 2004 56 56 (3) (4) 269-274 471-475 http//www.actaps.com.cn 471 * 130021 (pregnanolone ) (stress-induced hypertension SIH) (0.24 mg/kg) (angiotensin Ang )

More information

Endothelium. A typical endothelial cell is about 30mm long, Accounts for 1% or less of the arterial weight

Endothelium. A typical endothelial cell is about 30mm long, Accounts for 1% or less of the arterial weight Endothelium Discovered in 1845 A typical endothelial cell is about 30mm long, 10mm wide, and 0.2 3 mm thick Accounts for 1% or less of the arterial weight As recently as the late 1960s it was thought of

More information

, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica

, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica , 1999 2, 51 (1), 25 30 25 Acta Physiologica Si nica L2Arg/ NO 1997212227 1998203230 3 3 (, 524023 ; 3, 100083) ( IRI) (NO), 15 min, 45 min, 30 ml KH 15 min, (LDH) NO2 - NOS L2 (L2Arg), IRI LDH 411, 514

More information

Mol Biotechnol Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L.

Mol Biotechnol Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L. Mol Biotechnol. 2007 Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L. Source : Institute of Biochemistry, Polytechnic University of the

More information

Tetramethylpyrazine scavenges superoxide anion and decreases nitric oxide production in human polymorphonuclear leukocytes

Tetramethylpyrazine scavenges superoxide anion and decreases nitric oxide production in human polymorphonuclear leukocytes Life Sciences 72 (2003) 2465 2472 www.elsevier.com/locate/lifescie Tetramethylpyrazine scavenges superoxide anion and decreases nitric oxide production in human polymorphonuclear leukocytes Zhaohui Zhang

More information

PCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure

PCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure PCTH 400 LAST LECTURE Endothelial dysfunction and cardiovascular diseases. Classic Vascular pharmacology -chronic -systemic Local Vascular pharmacology -acute -targeted High blood pressure Blood pressure

More information

Peptides-Derived from Thai Rice Bran Improve Hemodynamics and Induce Vasorelaxation in Renovascular Hypertensive Rats

Peptides-Derived from Thai Rice Bran Improve Hemodynamics and Induce Vasorelaxation in Renovascular Hypertensive Rats Peptides-Derived from Thai Rice Bran Improve Hemodynamics and Induce Vasorelaxation in Renovascular Hypertensive Rats Orachorn Boonla 1, Phattharaphon Tuangpolkrung 1, Poungrat Pakdeechote 1, Upa Kukongviriyapan

More information

Protective effects of melatonin on doxorubicin induced cardiotoxicity in isolated rat heart

Protective effects of melatonin on doxorubicin induced cardiotoxicity in isolated rat heart ORIGINAL ARTICLE East J Med 21(3): 119-124, 2016 Protective effects of melatonin on doxorubicin induced cardiotoxicity in isolated rat heart Zeynep Erdogmus Ozgen*, Meral Erdinc, Hasan Akkoc, Ilker Kelle

More information

Low Level Ionizing Radiation and Non-Ionizing Radiation: Mitigating their Effects with Melatonin

Low Level Ionizing Radiation and Non-Ionizing Radiation: Mitigating their Effects with Melatonin Low Level Ionizing Radiation and Non-Ionizing Radiation: Mitigating their Effects with Melatonin Russel J. Reiter, Ph.D., M.D.(h.c.), D.Sc.(h.c.) University of Texas Health Science Center San Antonio,

More information

A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial. Ischemia/Reperfusion Injury

A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial. Ischemia/Reperfusion Injury Supporting Information A Long-Term and Slow-Releasing Hydrogen Sulfide Donor Protects against Myocardial Ischemia/Reperfusion Injury Xiaotian Sun 1 *, Wenshuo Wang 2, Jing Dai 3, Sheng Jin 4, Jiechun Huang

More information

ARF ARF. NOx. NOS nmol NOx formed/30 min/kidney Wet Weight; ± ± 1.81 ARF. acute renal failure: ARF

ARF ARF. NOx. NOS nmol NOx formed/30 min/kidney Wet Weight; ± ± 1.81 ARF. acute renal failure: ARF Vol. 29, pp.673 ~ 679, 2001 13 12 20 ARF 50% ARF ARF ARF ARF NO ARF NO NOS NO NO2 /NO3 NOx Griess NO NOx 1 72 7 NOx NOS 1 7 NOx µmol/kidney Wet Weight; Sham 0.116 ± 0.005 0.168 ± 0.006 24 0.185 ± 0.004

More information

Vascular action of the hypoglycaemic agent gliclazide in diabetic rabbits

Vascular action of the hypoglycaemic agent gliclazide in diabetic rabbits Diabetologia (1998) 41: 9--15 Springer-Verlag 1998 Vascular action of the hypoglycaemic agent gliclazide in diabetic rabbits P. J. Pagano 1, M. C. Griswold 1, D. Ravel 2, R. A. Cohen 1 1 Vascular Biology

More information

Sulaiman Amal A IRJP 2 (3)

Sulaiman Amal A IRJP 2 (3) INTERNATIONAL RESEARCH JOURNAL OF PHARMACY ISSN 2230 8407 Available online http://www.irjponline.com Research Article PROTECTIVE EFFECTS OF MELATONIN AGAINST IDIOSYNCRATIC LIVER INJURY IN RATS CHALLENGED

More information

Effect of Ginkgo biloba leaf extract on electroencephalography of rat with cerebral ischemia and reperfusion

Effect of Ginkgo biloba leaf extract on electroencephalography of rat with cerebral ischemia and reperfusion 157 2003, Acta Pharmacologica Sinica Chinese Pharmacological Society Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com Effect of Ginkgo biloba leaf extract on electroencephalography

More information

Supplemental Materials

Supplemental Materials Supplemental Methods Spin trap and electron paramagnetic resonance spectroscopy Hypoxanthine (1 mmol=l) plus xanthine oxidase (.1 u=ml) were incubated in Krebs solution at 378C bubbled with 95% O 2 and

More information

Glutathione / Thioredoxin Nrf2 & Hyperoxia

Glutathione / Thioredoxin Nrf2 & Hyperoxia Glutathione / Thioredoxin Nrf2 & Hyperoxia Trent E. Tipple, MD Principal Investigator, Center for Perinatal Research The Research Institute at Nationwide Children s Hospital Assistant Professor of Pediatrics,

More information

Effects of pinealectomy and exogenous. have on the brains, testes, duodena and

Effects of pinealectomy and exogenous. have on the brains, testes, duodena and European Review for Medical and Pharmacological Sciences Effects of pinealectomy and exogenous melatonin on the brains, testes, duodena and stomachs of rats S. TASDEMIR 1, E. SAMDANCI 2, H. PARLAKPINAR

More information

The analysis on the expression of gasotransmitters in early trauma patients

The analysis on the expression of gasotransmitters in early trauma patients ORIGINAL ARTICLE Wang Z et al. The analysis on the expression of gasotransmitters in early trauma patients Zhiyong Wang 1, Mignxing Fang 1, Jianying Guo 1, Yong Yang 1, Fengjun Tian 2 * 1 Department of

More information

Dynamic changes of found in inflammatory zone 1 protein and mrna expression in the lung with experimental pulmonary fibrosis of the rat

Dynamic changes of found in inflammatory zone 1 protein and mrna expression in the lung with experimental pulmonary fibrosis of the rat Acta Physiologica Sinica, August 25, 2005, 57 (4): 493-497 http://www.actaps.com.cn 493 FIZZ1 mrna 1 2, * 1 1 1 430022 2 430030 FIZZ1 (found in inflammatory zone 1) (5 mg/kg ) HE Masson FIZZ1 mrna (1)

More information

Effects of pollen extract EA-10, P 5. on chronic prostatitis or infertility with chronic prostatitis

Effects of pollen extract EA-10, P 5. on chronic prostatitis or infertility with chronic prostatitis Cheng HJ et al / Act a Pharmacol Sin 2002 Nov; 23 (11): 1035-1039 2002, Act a Pharmacologica Si nica ISSN 1671-4083 Shanghai Institute of Materia Medica Chinese Academy of Sciences http:/ /www.chinaphar.com

More information

E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.

E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al. 1) Ferrari, R., Visoli, O., Guarnieri, C. et al.: Vitamin E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, 1983. 2) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.: Canine

More information

Relaxation responses of aortic rings from salt-loaded high calcium fed rats to potassium chloride, calcium chloride and magnesium sulphate

Relaxation responses of aortic rings from salt-loaded high calcium fed rats to potassium chloride, calcium chloride and magnesium sulphate Pathophysiology 4 (1998) 275 280 Relaxation responses of aortic rings from salt-loaded high calcium fed rats to potassium chloride, calcium chloride and magnesium sulphate B.J. Adegunloye, O.A. Sofola

More information

Increased Production of Nitric Oxide Contributes to Renal Oxidative Stress in Endotoxemic Rat

Increased Production of Nitric Oxide Contributes to Renal Oxidative Stress in Endotoxemic Rat American Journal of Infectious Diseases 1 (2): 111-115, 2005 ISSN 1553-6203 2006 Science Publications Increased Production of Nitric Oxide Contributes to Renal Oxidative Stress in Endotoxemic Rat 1 Bahar

More information

Effects and mechanisms of Fenofibrate on the secretion of vascular endothelial contraction factors in hypertensive rats

Effects and mechanisms of Fenofibrate on the secretion of vascular endothelial contraction factors in hypertensive rats Effects and mechanisms of Fenofibrate on the secretion of vascular endothelial contraction factors in hypertensive rats Y. Zhu 1, H.-S. Wang 1, X.-M. Li 1 and C. Qu 2 1 Department of Cardiac Surgery, General

More information

Melatonin: its possible role in the management of viral infections-a brief review

Melatonin: its possible role in the management of viral infections-a brief review Silvestri and Rossi Italian Journal of Pediatrics 2013, 39:61 ITALIAN JOURNAL OF PEDIATRICS REVIEW Open Access Melatonin: its possible role in the management of viral infections-a brief review Michela

More information

Most stroke patients are ineligible for recombinant tissue

Most stroke patients are ineligible for recombinant tissue Administration of Melatonin After Onset of Ischemia Reduces the Volume of Cerebral Infarction in a Rat Middle Cerebral Artery Occlusion Stroke Model Zhong Pei, MBBS, MMed; Shiu Fun Pang, PhD; Raymond Tak

More information

Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload

Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Giovanna Frazziano, PhD Vascular Medicine Institute Department of Pharmacology and Chemical Biology University of Pittsburgh

More information

Protective role of melatonin against MPTP-induced mouse brain cell DNA fragmentation and apoptosis in vivo

Protective role of melatonin against MPTP-induced mouse brain cell DNA fragmentation and apoptosis in vivo Neuroendocrinology Letters ISSN 0172 780X Copyright 2001 Neuroendocrinology Letters Protective role of melatonin against MPTP-induced mouse brain cell DNA fragmentation and apoptosis in vivo Genaro G.

More information

Effects of pollen extract EA-10, P5 on chronic prostatitis or infertility with chronic prostatitis

Effects of pollen extract EA-10, P5 on chronic prostatitis or infertility with chronic prostatitis Flower Pollen Extract and its Effect on the Prostate with chronic prostatitis CHEN Hong-Jie 1, WANG Zhi-Ping 2, CHEN Yi-Rong, QIN Da-Shan, FU Sheng-Jun, MA Bao-Liang Institute of Urology, 2nd Affiliated

More information

The neuroprotective effects of grape seed proanthocyanidin on rat brain injury caused by chronic intermittent hypoxia

The neuroprotective effects of grape seed proanthocyanidin on rat brain injury caused by chronic intermittent hypoxia Neurology Asia 2014; 19(4) : 399 403 The neuroprotective effects of grape seed proanthocyanidin on rat brain injury caused by chronic intermittent hypoxia 1,2 Ya-Ning Zhao, 1 Xia Guo, 2 Hong-Yang Wang,

More information

Sulfur dioxide relaxes rat aorta by endothelium-dependent and. -independent mechanisms

Sulfur dioxide relaxes rat aorta by endothelium-dependent and. -independent mechanisms Sulfur dioxide relaxes rat aorta by endothelium-dependent and -independent mechanisms Yang-Kai WANG 1 #, An-Jing REN 1 #, Xiang-Qun YANG 1, Li-Gang WANG 1, Wei-Fang RONG 3, Chao-Shu TANG 4, Wen-Jun YUAN

More information

Effects of Total Alkaloids in Buxus microphylla Leaves on Aorta Smooth Muscle of Rats and Their Mechanisms

Effects of Total Alkaloids in Buxus microphylla Leaves on Aorta Smooth Muscle of Rats and Their Mechanisms 136 Zhang HQ et al. Chinese Herbal Medicines, 212, 4(2): 136-141 Effects of Total Alkaloids in Buxus microphylla Leaves on Aorta Smooth Muscle of Rats and Their Mechanisms ZHANG Hui-qin 1, LIU Yan-yan

More information

The Role of Massage in Blood Circulation, Pain Relief, and the Recovery Process: Implications of Existing Research

The Role of Massage in Blood Circulation, Pain Relief, and the Recovery Process: Implications of Existing Research The Role of Massage in Blood Circulation, Pain Relief, and the Recovery Process: Implications of Existing Research I. Basic Physiology of Circulation A. The Vascular Endothelium The endothelium is a complex

More information

Melatonin as an antioxidant: biochemical mechanisms and pathophysiological implications in humans

Melatonin as an antioxidant: biochemical mechanisms and pathophysiological implications in humans Vol. 50 No. 4/2003 1129 1146 QUARTERLY Review Melatonin as an antioxidant: biochemical mechanisms and pathophysiological implications in humans Russel J. Reiter 1, Dun-xian Tan 1, Juan C. Mayo 1, Rosa

More information

IN VITRO PROTECTIVE ROLE OF MELATONIN AGAINST HEMOLYSIS INDUCED BY SODIUM FLUORIDE IN HUMAN RED BLOOD CELLS

IN VITRO PROTECTIVE ROLE OF MELATONIN AGAINST HEMOLYSIS INDUCED BY SODIUM FLUORIDE IN HUMAN RED BLOOD CELLS 77 77 IN VITRO PROTECTIVE ROLE OF MELATONIN AGAINST HEMOLYSIS INDUCED BY SODIUM FLUORIDE IN HUMAN RED BLOOD CELLS Mandava V Rao, a,* Dhara D Vyas, a Ravindra B Meda, a Sunita L Chawla a Ahmedabad, India

More information

The Antihypertensive Effect of Sesame Seed-derived Products

The Antihypertensive Effect of Sesame Seed-derived Products Bulletin of saka University of Pharmaceutical Sciences 1 (2007) Brief Reviews *,a b c The Antihypertensive Effect of Sesame Seed-derived Products Daisuke NAKAN, *, a Yoshinobu KIS, b Yasuo MATSUMURA c

More information

Effect of melatonin on the generation of nitric oxide in murine macrophages

Effect of melatonin on the generation of nitric oxide in murine macrophages European Journal of Pharmacology 501 (2004) 25 30 www.elsevier.com/locate/ejphar Effect of melatonin on the generation of nitric oxide in murine macrophages Shen Zhang a,1, Wei Li b,1, Qiuhua Gao b, Taotao

More information

Irreversible shock can defined as last phase of shock where despite correcting the initial insult leading to shock and restoring circulation there is

Irreversible shock can defined as last phase of shock where despite correcting the initial insult leading to shock and restoring circulation there is R. Siebert Irreversible shock can defined as last phase of shock where despite correcting the initial insult leading to shock and restoring circulation there is a progressive decline in blood pressure

More information

Melatonin Salvages Neural Tissue from Ischemia/Reperfusion Injury

Melatonin Salvages Neural Tissue from Ischemia/Reperfusion Injury 112 The Open Neuroendocrinology Journal, 2010, 3, 112-120 Melatonin Salvages Neural Tissue from Ischemia/Reperfusion Injury Open Access Russel J. Reiter*, Dun-Xian Tan, Lorena Fuentes-Broto, Sergio D.

More information

Effect of Melatonin Supplementation on Biomarkers of Oxidative Stress and Serum Vitamin and Mineral Concentrations in Heat-Stressed Japanese Quail

Effect of Melatonin Supplementation on Biomarkers of Oxidative Stress and Serum Vitamin and Mineral Concentrations in Heat-Stressed Japanese Quail 2004 Poultry Science Association, Inc. Effect of Melatonin Supplementation on Biomarkers of Oxidative Stress and Serum Vitamin and Mineral Concentrations in Heat-Stressed Japanese Quail K. Sahin,*,1 M.

More information

Speaker: Paul De Smet. Thursday June 4th 2015

Speaker: Paul De Smet. Thursday June 4th 2015 Speaker: Paul De Smet Thursday June 4th 2015 Your logo Stress Support: the nutritional answer to stress, infection and disease Thursday June 4th 2015 Table of content Stress Support: the nutritional answer

More information

Moh Tarek + Faisal Massad. Tala Saleh ... Naif

Moh Tarek + Faisal Massad. Tala Saleh ... Naif 19 Moh Tarek + Faisal Massad Tala Saleh... Naif Last lecture we ve talked about the main antioxidant system which are the enzymes found in our body, mainly: 1. Glutathione peroxidase 2. Super oxide dismutase(sod)

More information

I ncreased production of reactive metabolites of nitrogen has

I ncreased production of reactive metabolites of nitrogen has 667 ORIGINAL ARTICLE Change of nitric oxide in experimental colitis and its inhibition by melatonin in vivo and in vitro Q Mei, J-M Xu, L Xiang, Y-M Hu, X-P Hu, Z-W Xu... See end of article for authors

More information

Canqiu Yu 1, Jinwei Chen 2, Li Huang 3*

Canqiu Yu 1, Jinwei Chen 2, Li Huang 3* A STUDY ON THE ANTITUMOUR EFFECT OF TOTAL FLAVONOIDS FROM PTERIS MULTIFIDA POIR IN H22 TUMOUR-BEARING MICE 459 Canqiu Yu 1, Jinwei Chen 2, Li Huang 3* 1 Department of General Surgery, The Second Xiangya

More information

,, - [5, 11]., -, (NO)., NO,,. NO NO- (NOS). (nnos NOS1) (enos NOS3) NO-,, 2+- NO- (inos NOS2),,,,, [5]., NOS (nnos enos), inos. inos - ( ),, ( ),. NO

,, - [5, 11]., -, (NO)., NO,,. NO NO- (NOS). (nnos NOS1) (enos NOS3) NO-,, 2+- NO- (inos NOS2),,,,, [5]., NOS (nnos enos), inos. inos - ( ),, ( ),. NO , 70,9 ± 1,3% 58,0±0,86%. 3... 1.. /..,.. // today. 2004. 1-2.. 30-31. 2.. /.,..,.. //-.: -, -2006. - 240. 3... /.., C. B.,.. [.] //. -2008. - 5.-C.33-36. 4..., - /..,.. // - 2007. - 1. -. 38-41. 5...

More information

Antiarrhythmic effect of endothelin-a receptor antagonist on acute ischemic arrhythmia in isolated rat heart 1

Antiarrhythmic effect of endothelin-a receptor antagonist on acute ischemic arrhythmia in isolated rat heart 1 Xu H et al / Acta Pharmacol Sin 2003 Jan; 24 (1): 37-44 37 2003, Acta Pharmacologica Sinica Chinese Pharmacological Society Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com

More information

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA

More information

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54

Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54 CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects

More information

Lujain Hamdan. Faisal Nimri

Lujain Hamdan. Faisal Nimri 20 Lujain Hamdan Faisal Nimri...... Sources of NADPH [ The pentose phosphate pathway is the primary source of the NADPH and is the only source in RBC.] Cytosolic conversion of oxaloacetate to pyruvate

More information

China. Keywords: Synergistic Effects, Antioxidant, Ginkgo Leaves Flavonoid, Loquat Leaves Flavonoid, Response Surface Method(RSM).

China. Keywords: Synergistic Effects, Antioxidant, Ginkgo Leaves Flavonoid, Loquat Leaves Flavonoid, Response Surface Method(RSM). 2016 International Conference on Energy Development and Environmental Protection (EDEP 2016) ISBN: 978-1-60595-360-1 Antioxidant Synergistic Effect and Formulation Optimization of Ginkgo Leaves Flavonoid

More information

902 Biomed Environ Sci, 2014; 27(11):

902 Biomed Environ Sci, 2014; 27(11): 902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type

More information

Protective effect of melatonin on myocardial infarction

Protective effect of melatonin on myocardial infarction Am J Physiol Heart Circ Physiol 284: H1618 H1624, 2003; 10.1152/ajpheart.00874.2002. Protective effect of melatonin on myocardial infarction Zhongyi Chen, Chu Chang Chua, Jinping Gao, Ronald C. Hamdy,

More information

[1 3 9 % 33 %, AV : (1) ; (2) ; (3) (30 35 mg/, ip), Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved.

[1 3 9 % 33 %, AV : (1) ; (2) ; (3) (30 35 mg/, ip), Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved. 3 272, 1999 6, 51 (3), 272 278 Acta Physiologica Sinica ( 305,, 100017), His A, H, V (AA), His (AH), His (HV) (AV) :, 20 AH 14 (A ), 6 (B ) B, AH,, AA A1B AH : ( ) :,,, : Q463 (AV), [1 3 ] AV 9 % 33 %,

More information

Modulation of vascular reactivity in normal, hypertensive and diabetic rat aortae by a non-antioxidant flavonoid

Modulation of vascular reactivity in normal, hypertensive and diabetic rat aortae by a non-antioxidant flavonoid Pharmacological Research 55 (2007) 385 391 Modulation of vascular reactivity in normal, hypertensive and diabetic rat aortae by a non-antioxidant flavonoid Machha Ajay a,,1, Francis I. Achike b, Mohd Rais

More information

EVALUATION OF THE ANTIPEROXIDATIVE EFFECTS OF MELATONIN IN AMMONIUM ACETATE-TREATED WISTAR RATS

EVALUATION OF THE ANTIPEROXIDATIVE EFFECTS OF MELATONIN IN AMMONIUM ACETATE-TREATED WISTAR RATS Copyright 2003 by Institute of Pharmacology Polish Academy of Sciences Polish Journal of Pharmacology Pol. J. Pharmacol., 2003, 55, 1031 1036 ISSN 1230-6002 EVALUATION OF THE ANTIPEROXIDATIVE EFFECTS OF

More information

Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury

Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury Evidences obtained from the past two decades showed that there is an involvement of reactive oxygen species in cerebral ischemia (Christophe

More information

Protective effect of ischemic postconditioning on lung ischemia-reperfusion injury in rats and the role of heme oxygenase-1

Protective effect of ischemic postconditioning on lung ischemia-reperfusion injury in rats and the role of heme oxygenase-1 . 162. Original articles Protective effect of ischemic postconditioning on lung ischemia-reperfusion injury in rats and the role of heme oxygenase-1 XIA Zhong-yuan 夏中元 *, GAO Jin 高瑾 and Ameer Kumar Ancharaz

More information

Differential responses to endothelial dependent relaxation of the thoracic and abdominal aorta from male Sprague-Dawley rats

Differential responses to endothelial dependent relaxation of the thoracic and abdominal aorta from male Sprague-Dawley rats Niger. J. Physiol. Sci. 27(December 12) 117 122 www.njps.com.ng Differential responses to endothelial dependent relaxation of the thoracic and abdominal aorta from male Sprague-Dawley rats 1 Oloyo, Ahmed

More information

TARGETING MITOCHONDRIA DESIGN, SYNTHESIS AND APPLICATION OF GS-NITROXIDES. Tanja Krainz Wipf Group Research Topic Seminar 16 th May, 2015

TARGETING MITOCHONDRIA DESIGN, SYNTHESIS AND APPLICATION OF GS-NITROXIDES. Tanja Krainz Wipf Group Research Topic Seminar 16 th May, 2015 TARGETING MITOCHONDRIA DESIGN, SYNTHESIS AND APPLICATION OF GS-NITROXIDES Tanja Krainz Wipf Group Research Topic Seminar 16 th May, 2015 Tanja Krainz @ Wipf Group Page 1 of 26 5/20/2015 Mitochondria as

More information

SCIENCE CHAGA MUSHROOM

SCIENCE CHAGA MUSHROOM SCIENCE 2 CHAGA mushroom INONOTUS OBLIQUUS Basiodiomycota fungus comprise a vast and yet largely untapped source of powerful new pharmaceutical products. In particular, and most importantly for modern

More information

Methods to Quantify Nitric Oxide en vivo: Concepts and Considerations

Methods to Quantify Nitric Oxide en vivo: Concepts and Considerations Methods to Quantify Nitric Oxide en vivo: Concepts and Considerations R Atmospheric Nitrogen Oxides Los Angeles Nitric Oxide N O Colorless Gas Free Radical Potent Vasodilator (EDRF) NO Production by Nitric

More information

Melatonin: Its Role in Limiting Macromolecular Toxicity Due to Partially Reduced Oxygen Metabolites

Melatonin: Its Role in Limiting Macromolecular Toxicity Due to Partially Reduced Oxygen Metabolites Russel J. Reiter* 1 Melatonin: Its Role in Limiting Macromolecular Toxicity Due to Partially Reduced Oxygen Metabolites Introduction Melatonin, originally thought to be exclusively of pineal origin (Wurtman

More information

TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury

TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury Cuihua Zhang, Xiangbin Xu, Barry J. Potter, Wei Wang, Lih Kuo, Lloyd Michael, Gregory J. Bagby, William M. Chilian Background

More information

RESUME Sep National Medical License, Taiwan Oct Board of Interal Medicine, Taiwan Aug Board of Cardiology, Internal Medicine, Taiwan

RESUME Sep National Medical License, Taiwan Oct Board of Interal Medicine, Taiwan Aug Board of Cardiology, Internal Medicine, Taiwan RESUME Ye-Hsu Lu, M.D. Office Address: No.100, Ziyou 1st Rd., Sanmin Dist., Kaohsiung City 80708, Taiwan TEL: +886-7-3121101 ext. 7741 (Office), +886-918867017 (Cell) FAX: +886-7-3234845 E-mail: yehslu@gmail.com

More information

Arthritis is a very common medical condition estimated to affect around. seven million people in the UK. However, it is not a single disease but comes

Arthritis is a very common medical condition estimated to affect around. seven million people in the UK. However, it is not a single disease but comes Chapter 6: Antiarthritic activity of cultured mycelium of Volvariella volvacea 6.1. Introduction Arthritis is a very common medical condition estimated to affect around seven million people in the UK.

More information

Interleukin-10 (IL-10) is a potent immunosuppressant (antiinflammatory

Interleukin-10 (IL-10) is a potent immunosuppressant (antiinflammatory Vascular Effects of Lipopolysaccharide Are Enhanced in Interleukin-10 Deficient Mice Carol A. Gunnett, PhD; Daniel J. Berg, MD; Frank M. Faraci, PhD Background and Purpose The role in blood vessels of

More information

The 1,4-dihydropyridine known as nifedipine is a commonly

The 1,4-dihydropyridine known as nifedipine is a commonly Synergistic Antihypertensive Effects of Nifedipine on Endothelium Concurrent Release of NO and Scavenging of Superoxide Viktor Brovkovych, Leszek Kalinowski, Reiner Muller-Peddinghaus, Tadeusz Malinski

More information

38 Noble ] mm. Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved. ; icv M ; icv H 1 (250 , NT

38 Noble ] mm. Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved. ; icv M ; icv H 1 (250 , NT 140, 1999 4, 51 (2), 140 146 Acta Physiologica Sinica 1998202219 1998206205 (, 210029) Sprague2Dawley, (112 g/ kg) (icv) (NT) (10, 20 g), icv 1 (115 g/ 3 l), NT ; icv M (215 g/ 3 l), NT ; icv H 1 (50 g/

More information

hypoxic pulmonary hypertension

hypoxic pulmonary hypertension Br. J. Pharmacol. (1992), 17, 47-413 '." Macmillan Press Ltd, 1992 Reduced relaxant potency of nitroprusside on pulmonary artery preparations taken from rats during the development of hypoxic pulmonary

More information

Screening of Monacolin K-high-yielding Monascus strain by combinative mutation treatment

Screening of Monacolin K-high-yielding Monascus strain by combinative mutation treatment 264507~5162007 Mycosystema 1 550002 2 100039 3 550002 4 550000 Monascus purpureus 45s 1.0 Monacolin K Monascus purpureus ZT32 5 Monacolin K 219.9µg/mL 2 Monacolin K 8.33mg/g 3.3 Q939.5 A 1672-6472200704-0507-0516

More information

Protective Effect of Melatonin and Catalase in Bovine Neutrophil-induced Model of Mammary Cell Damage 1

Protective Effect of Melatonin and Catalase in Bovine Neutrophil-induced Model of Mammary Cell Damage 1 J. Dairy Sci. 85:562 569 American Dairy Science Association, 2002. Protective Effect of Melatonin and Catalase in Bovine Neutrophil-induced Model of Mammary Cell Damage 1 V. Boulanger*, X. Zhao, and P.

More information

(A) [DOI] /j.issn

(A) [DOI] /j.issn Med J Chin PLA, Vol. 41, No. 3, March 1, 2016 175 [ ] 30 SD 5 (A) (B) (C) (D) (E) 0.206 0.514 1.028mg/(kg d) ELISA HE Masson (TGF- ) 9(MMP-9) C D E A B (P

More information

Visualization and simulated animations of pathology and symptoms of Parkinson s disease

Visualization and simulated animations of pathology and symptoms of Parkinson s disease Visualization and simulated animations of pathology and symptoms of Parkinson s disease Prof. Yifan HAN Email: bctycan@ust.hk 1. Introduction 2. Biochemistry of Parkinson s disease 3. Course Design 4.

More information

Alpha Lipoic Acid Snapshot Monograph

Alpha Lipoic Acid Snapshot Monograph vitamins minerals nutrients Alpha Lipoic Acid Snapshot Monograph Alpha lipoic Acid Most Frequent Reported Uses: - Antioxidant - Peripheral neuropathy - Improves insulin signaling and regulation of appetite

More information

Reversal by L-arginine of a dysfunctional arginine/nitric oxide pathway in the endothelium of the genetic diabetic BB rat

Reversal by L-arginine of a dysfunctional arginine/nitric oxide pathway in the endothelium of the genetic diabetic BB rat Diabetologia (1997) : 91 915 Springer-Verlag 1997 Reversal by L-arginine of a dysfunctional arginine/nitric oxide pathway in the endothelium of the genetic diabetic BB rat G.M. Pieper, W. Siebeneich, G.

More information

Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation

Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Introduction Feng-Yen Lin, Ph.D. 1, and Shing-Jong Lin, M.D., PhD. 2, 1 Department

More information

Vascular mechanisms of cyanidin-3-glucoside response in streptozotocin-diabetic rats

Vascular mechanisms of cyanidin-3-glucoside response in streptozotocin-diabetic rats Pathophysiology 18 (2011) 273 278 Vascular mechanisms of cyanidin-3-glucoside response in streptozotocin-diabetic rats Sima Nasri a, Mehrdad Roghani b,, Tourandokht Baluchnejadmojarad c, Tahereh Rabani

More information

Diphasic Effects of Astragalus membranaceus BUNGE (Leguminosae) on Vascular Tone in Rat Thoracic Aorta

Diphasic Effects of Astragalus membranaceus BUNGE (Leguminosae) on Vascular Tone in Rat Thoracic Aorta 1450 Biol. Pharm. Bull. 28(8) 1450 1454 (2005) Vol. 28, No. 8 Diphasic Effects of Astragalus membranaceus BUNGE (Leguminosae) on Vascular Tone in Rat Thoracic Aorta Bi-Qi ZHANG, a Shen-Jiang HU,*,a,d Li-Hong

More information

Relationship Between Redox State of Whole Arterial Blood Glutathione and Left Ventricular Function After Acute Myocardial Infarction

Relationship Between Redox State of Whole Arterial Blood Glutathione and Left Ventricular Function After Acute Myocardial Infarction J Cardiol 2004 Oct; 44 4 : 141 146 Relationship Between Redox State of Whole Arterial Blood Glutathione and Left Ventricular Function After Acute Myocardial Infarction Miyuki Rie Yukihiro Osamu Hiroshi

More information

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao

More information

In vitro and In vivo Assessment of the Antioxidant Activity of Melatonin and Related Indole Derivatives

In vitro and In vivo Assessment of the Antioxidant Activity of Melatonin and Related Indole Derivatives Gen. Physiol. Biophys. (2002), 21, 153 162 153 In vitro and In vivo Assessment of the Antioxidant Activity of Melatonin and Related Indole Derivatives V. Štětinová 1,L.Smetanová 1, V. Grossmann 1 and P.

More information

Purine nucleotides reduce superoxide production by nitric oxide synthase in a murine sepsis model

Purine nucleotides reduce superoxide production by nitric oxide synthase in a murine sepsis model ISSN 0100-879X Volume 42 (11) 993-1118 November 2009 BIOMEDICAL SCIENCES AND CLINICAL INVESTIGATION Braz J Med Biol Res, November 2009, Volume 42(11)1050-1057 Purine nucleotides reduce superoxide production

More information

Fengman District, Jilin City, Jilin Province, China 2

Fengman District, Jilin City, Jilin Province, China 2 2017 2 nd International Conference on Test, Measurement and Computational Method (TMCM 2017) ISBN: 978-1-60595-465-3 Melatonin Improves Learning and Memory Impairment in Chronic Stress Rats Jing LI 1,

More information

Treatment with Hydralazine and Nitrates Uri Elkayam, MD

Treatment with Hydralazine and Nitrates Uri Elkayam, MD Treatment with Hydralazine and Nitrates Uri Elkayam, MD Professor of Medicine University of Southern California School of Medicine Los Angeles, California elkayam@usc.edu Hydralazine and Isosorbide Dinitrate

More information

Lung transplantation has become an effective therapeutic

Lung transplantation has become an effective therapeutic Melatonin Attenuates Posttransplant Lung Ischemia-Reperfusion Injury Ilhan Inci, MD, Demet Inci, MD, André Dutly, MD, Annette Boehler, MD, and Walter Weder, MD Divisions of Thoracic Surgery and Pulmonary

More information

Preparation of Liposome Containing Bacteriorhodopsin with Natural. Preferred Orientation of Its Transient Photoresponse

Preparation of Liposome Containing Bacteriorhodopsin with Natural. Preferred Orientation of Its Transient Photoresponse ISSN 0582-9879 ACTA BIOCHIMICA et BIOPHYSICA SINICA 2003, 35(4): 391-395 CN 31-1300/Q Preparation of Liposome Containing Bacteriorhodopsin with Natural Preferred Orientation of Its Transient Photoresponse

More information

Department of Intensive Care Medicine UNDERSTANDING CIRCULATORY FAILURE IN SEPSIS

Department of Intensive Care Medicine UNDERSTANDING CIRCULATORY FAILURE IN SEPSIS Department of Intensive Care Medicine UNDERSTANDING CIRCULATORY FAILURE IN SEPSIS UNDERSTANDING CIRCULATORY FAILURE IN SEPSIS a mismatch between tissue perfusion and metabolic demands the heart, the vasculature

More information

Astragaloside IV Improves Metabolic Syndrome and Endothelium Dysfunction in Fructose-Fed Rats

Astragaloside IV Improves Metabolic Syndrome and Endothelium Dysfunction in Fructose-Fed Rats Molecules 2011, 16, 3896-3907; doi:10.3390/molecules16053896 Article OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Astragaloside IV Improves Metabolic Syndrome and Endothelium Dysfunction

More information

OSAS oxidative stress and atherosclerosis Who is the culprit: AHI or ODI

OSAS oxidative stress and atherosclerosis Who is the culprit: AHI or ODI OSAS oxidative stress and atherosclerosis Who is the culprit: AHI or ODI Arie Wollner MD, FCCP Department of Respiratory Care and Rehabilitation Sheba Medical Center OSA as a major public health problem

More information

J. Afr. Ass. Physiol. Sci. 3 (1): 36-40, July 2015.

J. Afr. Ass. Physiol. Sci. 3 (1): 36-40, July 2015. J. Afr. Ass. Physiol. Sci. 3 (1): 36-40, July 2015. Journal of African Association of Physiological Sciences Official Publication of the African Association of Physiological Sciences http://www.jaaps.aapsnet.org

More information