Supplemental Materials
|
|
- Jemima Hawkins
- 5 years ago
- Views:
Transcription
1 Supplemental Methods Spin trap and electron paramagnetic resonance spectroscopy Hypoxanthine (1 mmol=l) plus xanthine oxidase (.1 u=ml) were incubated in Krebs solution at 378C bubbled with 95% O 2 and 5% CO 2. Spin trap TEMPONE-H 1 mmol=l (1- Hydroxy-2,2,6,6-tetramethyl-4-oxo-piperidine HCl, Alexis) was added to the medium solution to trap superoxide radicals and peroxynitrite for 3 min. In order to inhibit reactions catalyzed by transition metals, DTPA 1 mmol=l (diethylenetriaminepentaacetate, Sigma) was added. The medium was then transferred to a glass tube and put in liquid nitrogen immediately before electron paramagnetic resonance spectroscopy (EPR) measurement. All inhibitors were added 1 min prior to TEMPONE-H. The EPR measurements are performed at room temperature using an EMX-A ESR spectrometer (Bruker, Hanau, Germany) as described previously. The EPRsettings were as follows: field swept: G; microwave power: 2 mw; magnetic field sweep time: 671s. Supplemental Materials Supplemental Table 1. pic 5 and Maximum Response (E max %) for ACh-Induced Vasodilatations Table for Fig. 1. Chronic Treatment of RAS Inhibitors of db=db Mice Treatment group Initial tension (mn) pic 5 E max (%) n db=m þ db=db db=db þ Valsartan db=db þ Enalapril Results are means SEM of n different mice; p <.1 and p <.1 relative to db=db group. Table for Fig. 2. Aortas from Nondiabetic db=m þ and Diabetic db=db Mice Treatment group Initial tension (mn) pic 5 E max (%) n db=m þ db=db db=db þ Losartan db=db þ Apocynin db=db þ Losartan þ Apocynin db=db þ Tempol Results are means SEM of n different mice. p <.1 relative to db=m þ group; p <.5 relative to db=db group. Table for Fig. 6. Renal Arteries from Diabetic Patients Treatment group Initial tension (mn) pic 5 E max (%) n Nondiabetic Diabetic Diabetic þ Losartan Results are means SEM of renal arteries from n patients. p <.1 relative to nondiabetic group; p <.1 versus diabetic group.
2 Table for Fig. 7. Aortas from Nondiabetic Mice Treatment group Initial tension (mn) pic 5 E max (%) n Normal glucose (NG) Mannitol High glucose (HG) HG þ Losartan Control Ang II Ang II þ Losartan Results are means SEM of n different mice. p <.1 versus HG or Ang II groups. A Body weight (g) 6 3 db/db db/m Weeks B Plasma Glucose (mmol/l) 4 2 db/db, 4 wks db/db, 12 wks db/db, 8 wks db/db, 16 wks db/m +, 16 wks Time (Min) SUPPLEMENTAL FIG. 1. (A) Gain in body weights of db=db mice from 4 to 16 weeks compared to the db=m þ lean mice. (B) Mice were fasted for 8 h prior to glucose administration to achieve a baseline blood glucose level. Blood drops were collected from the tail by a small cut and gently squeezing. Blood glucose were measured before (time ) and after the oral gavage of glucose solution (1.2 g=kg body weight) at 15, 3, 6, 12, and 18 min, using blood glucose meter (Ascensia ELITE Ò XL, Bayer, IN). Oral glucose tolerance test in db=m þ and db=db mice at 4, 8, 12, and 16 weeks. Data are mean SEM of 5 7 experiments. Statistical significance between groups is indicated by p <.1.
3 A Plasma glucose (mmol/l) C AUC (mmol/lx18 min) db/m + db/db db/db + Valsartan Time (min) db/db B Plasma glucose (mmol/l) D SBP (mmhg) 4 db/m + db/db db/db + Enalapril Time (min) db/db db m + Vehicle Valsartan Enalapril db m + Vehicle Valsartan Enalapril SUPPLEMENTAL FIG. 2. Effects of chronic treatment of valsartan (A) and enalapril (B) on oral glucose tolerance test (OGTT) in db=db mice. (C) Summarized figures showing area under curve (AUC) of OGTT in different groups of mice. (D) Systolic blood pressure (SBP) of db=m þ, db=db, db=db treated with valsartan and db=db treated with enalapril. Data are means SEM of 5 7 mice. p <.5 relative to db=m þ and p <.5 relative to db=db.
4 SUPPLEMENTAL FIG. 3. Western blot analysis showing protein expression levels of AT1R (A) and AT2R (B) indb=m þ, db=db, db=db treated with valsartan and db=db treated with enalapril. (C) Summarized figure for AngII-induced contraction in mouse aortas from different groups of mice. Results are means SEM of 4 6 experiments. Statistical significance is indicated by p <.5 vs db=m þ and p <.5 vs db=db. SUPPLEMENTAL FIG. 4. Reduced level of phosphorylation of enos at Ser 1177 in db=db mouse aortas while the total enos (14 kda) remained unchanged. RAS inhibition by valsartan or enalapril did not affect enos phosphorylation. Data are means SEM normalized to b-actin and compared to db=m þ ; n ¼ 4, p <.5 vs db=m þ.
5 AT1R / β-actin (compared to non-diabetic) 4 2 Non-diabetic Diabetic SUPPLEMENTAL FIG. 5. Summarized data of Western blot analysis showing increased protein expression levels of AT 1 R in renal arteries from diabetic patients compared; n ¼ 4, p <.1 vs nondiabetic. A DHE Fluorescence (Compared to Control) Control AngII Apocynin+AngII DPI+AngII H 2 O 2 Catalase+H 2 O 2 Apocynin+H 2 O 2 DPI+H 2 O 2 B 1 Relaxation (% Phe tone) 5 Control DPI ACh (log mol/l) SUPPLEMENTAL FIG. 6. Representative blots showing p38 and ERK1=2 MAPK activities in db=m þ,db=db (Ctl), and db=db with valsartan (Val) or enalapril (Ena) treatment. Increased p38 MAPK phosphorylation and ERK1=2 phosphorylation in db=db mouse aorta were inhibited after valsartan or enalapril treatment. SUPPLEMENTAL FIG. 7. (A) DHE fluorescence showing 1 nmol=l angiotensin II (AngII) augmented ROS generation in db=m þ mouse aortas which was prevented by 1 mmol=l apocynin and.1 mmol=l DPI. While catalase (1 U=mL) could inhibit the ROS produced by hydrogen peroxide (H 2 O 2 ), apocynin or DPI had no effect on H 2 O 2 - induced ROS production. (B) DPI (.1 mmol=l, NADPH oxidase inhibitor) improved the impaired relaxations in db=db mouse aortas. p <.1 between diabetic and non-diabetic groups. p <.5 between treatment and control groups or between two curves. p <.5 compared with AngII group, and { p <.5 compared with H 2 O 2 group.
6 5 HXXO 5 HXXO + Losartan dx''/db HXXO + Tiron 5 Negative control dx''/db Magnetic Field (Gauss) Magnetic Field (Gauss) SUPPLEMENTAL FIG. 8. ESR spectrum of radical adducts detected by spin trap TEMPONE-H, showing that the formation of nitroxide radical TEMPONE from the reaction of TEMPONE-H with superoxide radicals was continuously formed after the addition of hypoxanthine plus xanthine oxidase (HX-XO, as a superoxide radical generating system), which was inhibited by the addition of 1 mmol=l tiron (ROS scavenger), but not 3 mmol=l losartan.
Supplementary Figure 1. DTPA does not interfere with the activity of catalase. Dependency of CAT activity on DTPA concentration at 25 C.
Supplementary Figure 1. DTPA does not interfere with the activity of catalase. Dependency of CAT activity on DTPA concentration at 25 C. CAT (40 nm) was pre-incubated for 120 min with DTPA (0-10 mm) before
More informationPlatelet Activating Factor affects Sigmoid Smooth Muscle Contraction in UC
Platelet Activating Factor affects Sigmoid Smooth Muscle Contraction in UC Sharad Kunnath 1, Victor E. Pricolo 2, Karen M. Harnett 3, Neal S. Leleiko 1, Weibiao Cao 3 1 Department of Pediatrics, 2 Surgery
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationSupplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
More informationRetrospective Dosimetry Based on Long Lived Free Radicals
Retrospective Dosimetry Based on Long Lived Free Radicals Harold Swartz, M.D., Ph.D. Geisel Medical School at Dartmouth Region near Fukushima reactor site Dose distribution from fallout about May 1, 2011
More informationEffects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts
Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Serena Del Turco, Teresa Navarra, Giuseppina Basta, Raffaele De
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationVascular oxidative stress and nitric oxide depletion in HIV-1 transgenic rats are reversed by glutathione restoration
Am J Physiol Heart Circ Physiol 294: H2792 H2804, 2008; doi:10.1152/ajpheart.91447.2007. Vascular oxidative stress and nitric oxide depletion in HIV-1 transgenic rats are reversed by glutathione restoration
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationReferences. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).
Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old
More informationTARGETING MITOCHONDRIA DESIGN, SYNTHESIS AND APPLICATION OF GS-NITROXIDES. Tanja Krainz Wipf Group Research Topic Seminar 16 th May, 2015
TARGETING MITOCHONDRIA DESIGN, SYNTHESIS AND APPLICATION OF GS-NITROXIDES Tanja Krainz Wipf Group Research Topic Seminar 16 th May, 2015 Tanja Krainz @ Wipf Group Page 1 of 26 5/20/2015 Mitochondria as
More informationROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
More informationSupporting Information. 58 Pages. 6 Figures 4 Tables
Light-Source-Dependent Effects of Main Water Constituents on Photodegradation of Phenicol Antibiotics: Mechanism and Kinetics Linke Ge, Jingwen Chen, * Xianliang Qiao, Jing Lin, Xiyun Cai Key Laboratory
More informationEffect of temperature on liposome structures studied using EPR spectroscopy
Spectroscopy 19 (2005) 37 42 37 IOS Press Effect of temperature on liposome structures studied using EPR spectroscopy W.W. Sułkowski a,,d.pentak a, W. Korus a and A. Sułkowska b a Department of Environmental
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationElectron Spin Resonance Characterization of Vascular Xanthine and NAD(P)H Oxidase Activity in Patients With Coronary Artery Disease
Electron Spin Resonance Characterization of Vascular Xanthine and NAD(P)H Oxidase Activity in Patients With Coronary Artery Disease Relation to Endothelium-Dependent Vasodilation Stephan Spiekermann, MD*;
More informationType 2 diabetes mellitus is anticipated by the development
Tumor Necrosis Factor- Induces Endothelial Dysfunction in the Prediabetic Metabolic Syndrome Andrea Picchi,* Xue Gao,* Souad Belmadani,* Barry J. Potter, Marta Focardi, William M. Chilian, Cuihua Zhang
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationa! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!
a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!
More informationNox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload
Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Giovanna Frazziano, PhD Vascular Medicine Institute Department of Pharmacology and Chemical Biology University of Pittsburgh
More informationEstimation of glucose in blood serum
Estimation of glucose in blood serum Enzymatic estimation of glucose uses a reagent containing two enzymes and a chromogen. Glucose oxidase catalyses the oxidation of glucose to gluconolactone with the
More informationType 2 diabetes mellitus is anticipated by the development
Tumor Necrosis Factor- Induces Endothelial Dysfunction in the Prediabetic Metabolic Syndrome Andrea Picchi,* Xue Gao,* Souad Belmadani,* Barry J. Potter, Marta Focardi, William M. Chilian, Cuihua Zhang
More informationTetramethylpyrazine scavenges superoxide anion and decreases nitric oxide production in human polymorphonuclear leukocytes
Life Sciences 72 (2003) 2465 2472 www.elsevier.com/locate/lifescie Tetramethylpyrazine scavenges superoxide anion and decreases nitric oxide production in human polymorphonuclear leukocytes Zhaohui Zhang
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationPorphyrins: Chemistry and Biology
Porphyrins: Chemistry and Biology 20.109 Lecture 6 24 February, 2011 Goals Explore some essential roles of heme in biology Appreciate how ature has used the same cofactor to achieve diverse functions Gain
More informationImmobilization of Samples on Slide 1.0 Hoskins Lab Last modified 03/28/2017 Chris DeCiantis
Immobilization of Samples on Slide 1. For a PEGylated slide, use 1X PBS sterile filtered buffer solution. 2. Wash the mpeg/peg-biotin using 1X PBS. Flow on 20 μl of the PBS using a 20 μl tip. The solution
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationA novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
More informationTHESIS SUMMARY. lipid peroxidation. However, the detailed mechanism for the initiation of lipid
1 THESIS SUMMARY Iron is well known to be an important initiator of free radical oxidations, such as lipid peroxidation. However, the detailed mechanism for the initiation of lipid peroxidation is extremely
More informationE and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.
1) Ferrari, R., Visoli, O., Guarnieri, C. et al.: Vitamin E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, 1983. 2) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.: Canine
More informationInvolvement of MAPKs in ICAM-1 Expression in Glomerular Endothelial Cells in Diabetic Nephropathy
11 5 757 Involvement of MPKs in ICM-1 Expression in Glomerular Endothelial Cells in Diabetic Nephropathy a a,b* a a a a c a a a c b 5 11 9 5 Watanabe et al. cta Med. Okayama Vol. 5, No. cholate, and 1mM
More informationHow does Exercise Work at the Cellular/Molecular Level
How does Exercise Work at the Cellular/Molecular Level Volker Adams, PhD ESC, Paris 28. Aug. 211 UNIVERSITÄT LEIPZIG H E R Z Z E N T R U M Nothing to disclose Survival Exercise Training in Patients With
More informationSUPPLEMENTAL DATA. Lumen area ( m 2 )
Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental
More informationSupplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
More informationSupplemental Figure I
Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationSUPPLEMENTARY DATA. Short title: Adipocyte MR induces vascular dysfunction.
Adipocyte-specific mineralocorticoid receptor overexpression in mice is associated with metabolic syndrome and vascular dysfunction - role of redox-sensitive PKG-1 and Rho kinase. Aurelie NGUYEN DINH CAT
More informationBoldine improves endothelial function in diabetic db/db mice through inhibition of angiotensin II-mediated BMP4-oxidative stress cascade
British Journal of Pharmacology DOI:10.1111/bph.12350 www.brjpharmacol.org RESEARCH PAPER Boldine improves endothelial function in diabetic db/db mice through inhibition of angiotensin II-mediated BMP4-oxidative
More informationImmune cell-induced synthesis of NO and reactive oxygen species in lymphoma cells causes their death by apoptosis
FEBS 9556 FEBS Letters 579 (005) 833 841 Immune cell-induced synthesis of NO and reactive oxygen species in lymphoma cells causes their death by apoptosis De-En Hu, Kevin M. Brindle * Department of Biochemistry,
More informationOxidative Damage and Reactive Species
Oxidative Damage and Reactive Species Understanding the complexities of redox signaling control and subsequent molecular damage to lipids, proteins, DNA, etc. requires technical approaches that offer precision
More informationCHAPTER 2. Detection of nitric oxide and reactive oxygen species
CHAPTER 31 Chapter Introduction Nitric oxide (NO) is one of the key players in the vasculature. It is involved in vessel dilation, inhibition of platelet and leukocyte adhesion, and inhibition of proliferation
More informationAllopurinol reduces left ventricular hypertrophy and endothelial dysfunction in patients with chronic kidney disease
Allopurinol reduces left ventricular hypertrophy and endothelial dysfunction in patients with chronic kidney disease Michelle P Kao, Donald S Ang, Steve Gandy, Chim C Lang, Allan D Struthers Division of
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More information4 Development of an ESR online-method for the monitoring of in vitro fat digestion
4 Development of an ESR online-method for the monitoring of in vitro fat digestion 4.1 Introduction When regarding the oral administration of lipid-based nanocapsules, gastrointestinal digestion will play
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationThe rabbit femoral artery was prepared and each arterial ring was permeabilized
Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized
More informationMechanisms of vascular disease: divergent roles for suppressor of cytokine signaling 3 in angiotensin IIinduced vascular dysfunction
University of Iowa Iowa Research Online Theses and Dissertations Fall 2014 Mechanisms of vascular disease: divergent roles for suppressor of cytokine signaling 3 in angiotensin IIinduced vascular dysfunction
More information1. Most organisms are active in a limited temperature range
1. Most organisms are active in a limited temperature range Identify the role of enzymes in metabolism, describe their chemical composition and use a simple model to describe their specificity on substrates
More informationApplication(s) of Alanine
Application(s) of Alanine Simon Duane Radiotherapy Standards User Group, 5 June 2007 Outline Alanine/EPR dosimetry characteristics, usage (dis)advantages for reference dosimetry Traceable dosimetry for
More informationPrenatal hypoxia causes long-term alterations in vascular endothelin-1 function in aged male but not female offspring
1 2 3 4 5 6 7 8 9 1 11 12 13 14 Supplementary information for: Prenatal hypoxia causes long-term alterations in vascular endothelin-1 function in aged male but not female offspring Stephane L Bourque,
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationDisclosure of Relationships
Disclosure of Relationships Over the past 12 months Dr Ruilope has served as Consultant and Speakers Bureau member of Astra-Zeneca, Bayer, Daiichi-Sankyo, Menarini, Novartis, Otsuka, Pfizer, Relypsa, Servier
More informationSuperoxide Dismutase Microplate Assay Kit User Manual
Superoxide Dismutase Microplate Assay Kit User Manual Catalog # CAK1010 Detection and Quantification of Superoxide Dismutase (SOD) Activity in Urine, Serum, Plasma, Tissue extracts, Cell lysate, Cell culture
More informationEffects of Catechins on Superoxide and Hydroxyl Radical
February 1999 Chem. Pharm. Bull. 47(2) 279 283 (1999) 279 Effects of Catechins on Superoxide and Hydroxyl Radical Midori KASHIMA Department of Endodontics, Nihon University School of Dentistry at Matsudo
More informationSUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*
Supplementary Table S1. Clinical characteristics of the study subjects.* T2D ND n (F/M) 66 (21/45) 25 (7/18) Age (years) 61.8 ± 6.9 49.4 ± 7.3 # Body weight (kg) 95 ± 16 105 ± 13 # Body mass index (kg.
More informationDirect blood pressure monitoring was done using radiotelemetry (DataSciences
Supplemental Methods: Blood Pressure Monitoring Direct blood pressure monitoring was done using radiotelemetry (DataSciences International; DSI). Surgical implantation of TA11PA-C1 transmitters was performed
More informationAT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY
AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY SA Oliveira Jr, MP Okoshi, PF Martinez, DM Guizoni, BP Torres, M Dal Pai-Silva, K Okoshi,
More informationRetinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin
Retinol-binding protein 7 is an endothelium-specific PPARγ cofactor mediating an antioxidant response through adiponectin Chunyan Hu, 1 Henry L. Keen, 1 Ko-Ting Lu, 1 Xuebo Liu, 1 Jing Wu, 1 Deborah R.
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationEnzymes Adapted from Air All Around: Oxygen Investigation
Enzymes Adapted from Air All Around: Oxygen Investigation Author: Doris Pun & Brittland DeKorver Institute for Chemical Education and Nanoscale Science and Engineering Center University of Wisconsin-Madison
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2001) offered
More informationSOD1 inhibition reduces non-small cell lung cancer by inducing cell death
SUPPLEMENTAL INFORMATION SOD1 inhibition reduces non-small cell lung cancer by inducing cell death Andrea Glasauer, Laura A. Sena, Lauren P. Diebold, Andrew P. Mazar & Navdeep S. Chandel Inventory of Supplemental
More informationWhat is an antioxidant? How do antioxidants work?
What is an antioxidant? How do antioxidants work? Garry R. Buettner and Freya Q. Schafer Free Radical and Radiation Biology Program and ESR Facility The University of Iowa Iowa City, IA 52242-1101 Tel:
More informationSupporting Information
Supporting Information Kuroda et al. 10.1073/pnas.1002178107 SI Methods Monoclonal Antibodies Against Nox4. Generation of the anti-nox4 mouse monoclonal antibody (3D2), which detects Nox4 and does not
More informationOxidative Stress in Cardiovascular Disease
Indian Journal of Biochemistry & Biophysics Vol. 46, December 2009, pp 421-440 Review Oxidative Stress in Cardiovascular Disease S V Vijaya Lakshmi 1, G Padmaja 1, Periannan Kuppusamy 2 and Vijay Kumar
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary Figure 1
Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis
More informationValerian E. Kagan Macrophage Response to Single Walled Carbon Nanotubes: Oxidative Stress and Inflammatory Consequences.
Valerian E. Kagan Macrophage Response to Single Walled Carbon Nanotubes: Oxidative Stress and Inflammatory Consequences. Center For Free Radical and Antioxidant Health, Department of Environmental and
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationOxiSelect Hydrogen Peroxide Assay Kit (Colorimetric)
Product Manual OxiSelect Hydrogen Peroxide Assay Kit (Colorimetric) Catalog Number STA-343 5 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Oxidative stress is a physiological
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationNAM JUNE PAIK: Rhapsody in Video
NAM JUNE PAIK: Rhapsody in Video 혈관연구회추계학회 2007.10.13 Renin-angiotensin-aldosterone System Kwang Kon Koh, MD, FACC, FAHA Cardiology Gachon University Gil Medical Center Incheon, Korea Cytokines oxldl Ang
More informationINTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells
Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,
More informationCardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016
Cardiovascular disease physiology Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016 Content Introduction The number 1 killer in America Some statistics Recommendations The disease process
More informationThe Antihypertensive Effect of Sesame Seed-derived Products
Bulletin of saka University of Pharmaceutical Sciences 1 (2007) Brief Reviews *,a b c The Antihypertensive Effect of Sesame Seed-derived Products Daisuke NAKAN, *, a Yoshinobu KIS, b Yasuo MATSUMURA c
More informationMacrovascular disease is the major cause of
Insulin Generates Free Radicals by an NAD(P)H, Phosphatidylinositol 3 -Kinase Dependent Mechanism in Human Skin Fibroblasts Ex Vivo Giulio Ceolotto, 1 Michela Bevilacqua, 1 Italia Papparella, 1 Elisabetta
More informationReaction of Myoglobin with Hydrogen Peroxide Forms a Peroxyl Radical Which Oxidizes Substrates*
THE JOURNAL OF BIO~ICAL CHEMISTRY Vol. 269, No. 10, Issue of March 11. pp. 7458-7463, 1994 Printed in U.S.A. Reaction of Myoglobin with Hydrogen Peroxide Forms a Peroxyl Radical Which Oxidizes Substrates*
More informationEndothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
More informationPseudomonas and Neutrophil Products Modify Transferrin and Lactoferrin to Create Conditions That Favor Hydroxyl Radical Formation
Pseudomonas and Neutrophil Products Modify Transferrin and Lactoferrin to Create Conditions That Favor Hydroxyl Radical Formation Bradley E. Britigan*" and Brian L. Edekert *Research Service and Department
More informationPOLYCARBONATE CHROMATOGRAPHY COLUMN TO BE USED IN A 99 MO/ 99M TC GENERATOR IRRADIATED IN SALINE SOLUTION WITH ELECTRON BEAM AND GAMMA RAYS
POLYCARBONATE CHROMATOGRAPHY COLUMN TO BE USED IN A 99 MO/ 99M TC GENERATOR IRRADIATED IN SALINE SOLUTION WITH ELECTRON BEAM AND GAMMA RAYS Yasko Kodama 1a,*, Regina C. G. Carneiro 1b, Maura V. Rossi 2,
More informationTreatment with Hydralazine and Nitrates Uri Elkayam, MD
Treatment with Hydralazine and Nitrates Uri Elkayam, MD Professor of Medicine University of Southern California School of Medicine Los Angeles, California elkayam@usc.edu Hydralazine and Isosorbide Dinitrate
More informationMelatonin improves vascular reactivity of endotoxemia rats
Acta Physiologica Sinica, June 25, 2005, 57 (3): 367-372 http://www.actaps.com.cn 367, *,,,, 050017 (melatonin, MT) (lipopolysaccharide LPS) LPS LPS+MT MT (phenylephrine PE) (acetylcholine ACh) (malondialhyde
More informationRelationship between serum glutathione peroxidase-1activity with endothelial dysfunction level in patients with coronary artery diseases
Relationship between serum glutathione peroxidase-1activity with endothelial dysfunction level in patients with coronary artery diseases Introduction Reactive oxygen species (ROS),such as superoxide and
More informationBilirubin and biliverdin protect rodents against diabetic nephropathy by downregulating NAD(P)H oxidase
http://www.kidney-international.org & 21 International Society of Nephrology Bilirubin and biliverdin protect rodents against diabetic nephropathy by downregulating NAD(P)H oxidase Masakazu Fujii 1, Toyoshi
More informationSupplementary Data. Supplementary Materials and Methods Measurement of NO formation by ozone-based chemiluminescence. Supplementary References
Supplementary Data Supplementary Materials and Methods Measurement of NO formation by ozone-based chemiluminescence Nitric oxide (NO) production was measured by ozonebased chemiluminescence using a Sievers
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationRadiation Environment and Medicine 2017 Vol.6, No Regular Article
Radiation Environment and Medicine 2017 Vol.6, No.1 1 5 Regular Article Attempts of Radiation Dose Measurement in the Teeth of Mice Living around the Nuclear Power Plant in Fukushima Using Electron Spin
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2001) offered
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationThe Effect of High Dose IV Vitamin C on Plasma Antioxidant Capacity and Level of Oxidative Stress in Cancer Patients and Healthy Subjects
The Effect of High Dose IV Vitamin C on Plasma Antioxidant Capacity and Level of Oxidative Stress in Cancer Patients and Healthy Subjects N.A Mikirova, Ph.D.; J.A. Jackson, Ph.D., MT(ASCP); Neil H Riordan,
More informationSupplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between
More information