Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2.
|
|
- Colin Pitts
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2. mir D HF VS CTR ND HF VS CTR D HF VS ND HF FOLD CHANGE p FOLD CHANGE p FOLD CHANGE mir *** 10.9 *** 2.1 ns mir *** 2.7 * 2.3 ns mir-34c 5.5 *** 1.3 ns 4.2 *** mir ** 2.8 ** 1.4 ns mir-34b 3.4 ** 1.3 ns 2.7 ** mir-199b 2.8 ** 1.4 ns 2.0 * mir-199a 2.5 ** 1.3 ns 1.5 ns mir-485-5p 2.4 ** 1.6 * 1.4 ns mir * -1.3 ns 2.4 ** mir ns -1.8 ** 2.1 * mir ns -2.7 * 1.2 ns mir ns -2.3 ** 1.2 ns mir-133a -1.9 ** -1.7 ** -1.1 ns mir-10a -2.3 ns -2.5 ** 1.1 ns mir ns -6.9 ** 2.4 ** mir ** -5.4 *** 1.1 ns mir *** -4.4 *** -1.4 ns Statistically significant differences are in bold (*p=0.05; **p=0.01; ***p=0.001) p
2 Supplementary Table 2. Comparison of D HF deregulated mirnas expression in the remote and border zones of HF patients mir D HF vs CTR ND HF vs CTR D HF vs ND HF REM BZ REM BZ REM BZ mir-34c mir-34b mir mir-199b mir mir Legend: D HF=diabetic heart failure; CTR=control; ND HF=non-diabetic heart failure; REM=remote zone; BZ=border zone. Statistically significant differences are in bold (D HF, n=10; ND HF, n=23)
3 Supplementary Table 3. mirna-mrna interactions Gene expression profiles were measured and Class Comparison analysis identified differentially expressed genes. Then, we performed a bioinformatic analysis adopting the most widely used mirna target prediction algorithms and identified a list of putative direct target genes for each of the significantly modulated mirnas. Next, we intersected predicted mirna target genes and differently expressed genes, to discriminate those significantly deregulated genes that were putative targets of the identified mirnas. Given the inhibitory nature of mirna/mrna interaction, we applied a further selection criterion and considered only those predicted targets displaying opposite modulation with their corresponding mirna. Finally, we carried out a statistical correlation analysis between the expression levels of the HF deregulated mirnas in each patient and the HF-deregulated putative targets. We identified 140, 329 and 11 mirna/mrna interactions in the D-HF vs CTR, ND-HF vs CTR and D-HF vs ND-HF groups, respectively mirna-mrna interactions mir-10a mir-133a mir-182 mir-199a mir-199b mir-204 mir-210 mir-216 mir-221 mir-222 mir-223 mir-338 mir-372 mir-485-5p mir-650 ABCB4 ARHGAP6 HIST1H2AC JAGN1 ACPL2 AASS PARK7 AASS ANO1 HIST2H2BA AKAP7 ACADL ABRA AASS CCDC122 ALG10B ATXN7L1 RPS4Y1 REPS1 C16orf68 ABRA ACPL2 APBB2 IAH1 AMY1A AGPHD1 ACPL2 ANKRD2 DPM1 AMY1A CABLES1 YIPF7 C20orf24 ACPL2 ANKRD2 ART4 RAD54B AMY2A ALG10B CXorf40B ARAF EYA3 C20orf26 CTSK COPS6 ARAF ARAF BICD1 SPAM1 ANKRD31 AMY1A DHX16 FBXO10 IQUB CEP192 ELMO1 DHCR24 C19orf47 CAV2 BMP6 SPEF2 ASZ1 ANKRA2 DOCK3 FCN3 KLRD1 GABARAPL2 ENTPD1 DNAJC8 COBL DHX16 C7orf41 C1orf129 ANKRD20A2 ELL2 GLUL RGPD4 IAH1 ITGA8 FAM96B COPS6 DNAI2 CENPF C21orf99 ANKRD20B FADS1 NDUFS5 SLC6A15 IGBP1 MLL FBXO10 CSDA FBXO10 CPE C3orf57 ARHGAP19 MYOT PDE4D NBAS PIK3CG HMOX2 DHX16 FGF7 CRISPLD1 CALCR ATP6AP1L PALLD PHTF2 NUDT6 POGZ JAGN1 DOCK3 LPL HTR4 CASC2 ATXN7L1 RCAN1 RGAG1 PPIL6 PRELP MTCH1 FBXO10 PALLD HYDIN CLEC9A AVIL SLC7A2 SGPP2 PRTG RGL1 PRDX1 FCN3 PDE4D KCTD7 CMYA5 C12orf47 SRPX SLCO4A1 RGPD4 SESN3 PRDX6 FGF7 REPS1 KIAA1377 CPB2 C12orf63 THOC4 SSSCA1 SLCO4C1 SLC16A4 REPS1 HSPB7 RGAG1 MCOLN2 DCAF6 C1orf129 ABRA YIPF7 SUMO1 ZFP37 ASXL3 LPL SLC7A2 MGC21881 DDX4 C20orf19 ACPL2 AASS ZNF626 ALMS1 LRRFIP1 STRAP MYH10 DENND1B C21orf34 DHX16 ANKRD2 ARRDC3 MURC STXBP6 NEB DPH5 C21orf49 ELL2 ARAF ATXN7L1 PALLD TTC38 NOV DPP10 C21orf99 FADS1 CSRP3 C7orf58 PHB TUBA3D NRG1 EIF2B3 C3orf57 MYOT FCN3 CD302 PHTF2 UBE2D3 NRK EZH1 C5 RCAN1 GLUL CTSK REPS1 YBX1 POLQ GDPD1 C5orf4 SAP30BP LCLAT1 HAPLN1 SLC7A2 AASS RIN2 GTF2H5 C5orf56 SLC7A2 NRAP HLA-DPA1 SSR3 ACPL2 SLC16A9 HSFY2 C9orf93 SRPX PDE4D HLA-DRA STRAP ANKRD2 SMOC2 MAEL CASC1 THOC4 PHTF2 ITGA8 STXBP6 ARAF SPEF2 MGC21881 CCDC122 PSMD2 MAB21L1 TNIK CAV2 SSX2 MPPED2 CD96 RGAG1 MLL TTC38 DHX16 TMEM140 NAALAD2 CDH9 SGPP2 OLFML1 UGP2 FGF7 TTLL7 ODZ3 CDKL3 SLCO4A1 OMD AASS KBTBD10 WASF3 OR14A16 CEP120 WDR74 PDK3 ABRA NRAP ZNF479 PCDH15 CMYA5 PHC3 ACPL2 NUDT4P1 ZNF625 PLCZ1 CRYGS POGZ ARAF PDE4D APBB2 PMCHL2 DNAH14 PRELP C19orf47 PPA1 ART4 PRKAR2B DPH5 SEMA3D COBL PVR C7orf41 PXMP4 DPM1 SESN3 CSDA REPS1 CNTN4 RAD54B DPP10 SLC16A4 DHX16 RGAG1 CPE RGPD4 EFCAB6 ZFP37 EIF5AL1 SLC7A2 CRISPLD1 RNPC3 EFCAB7 ZFP90 FAM78B STRAP DSG1 RPS6KA6 EFHA2 ZNF280D FCN3 STXBP6 HDAC9 SCN2A EIF1AY FGF7 TUBA3D HMGB2 SCN3A EPHA7 HMGA1 HTR4 SLC26A7 FAM13A HSPB7 HYDIN SPRYD5 FAM72D KBTBD10 IAH1 SUMO1 FAM82A1 LRRFIP1 KCNMA1 USH2A FBXO32 D HF VS CTR MEIS1 KCTD7 WDR49 FDFT1 ND HF VS CTR PHTF2 KIAA1377 AMY2A FLJ37201 D HF VS ND HF PPA1 KLRK1 C3orf57 GABARAPL2 PPM1G LRP1B CPB2 GARNL3 PVR MCOLN2 DENND1B GBP5 REPS1 MGC21881 GTF2H5 GDPD1 SLC22A5 MYH10 MAEL GPAM SLC7A2 NEB ODZ3 GPLD1 SNRPB NETO1 SPRYD5 HEXA SSR3 NOV SUMO1 HRH4 STRAP NRK HSFY2 STXBP6 OR4K1 HTR4 TNIK OR5H14 IAH1 UGP2 POLQ IAPP PRKG2 IFT80 RAD54B IGBP1 RANBP17 IQUB RGPD4 IRAK1BP1 RHOBTB1 KIAA1009 RIN2 KIAA1109 SLC16A9 KIAA1377 SMOC2 KLRF1 SPEF2 LRP1B STON1 LRRC37A3 TMEM140 LY75 TRPC1 MGC21881 TTLL7 MKL2 WDR17 NAALAD2 ZNF479 NETO1 NME5 OR10A7 OR14A16 OR4K1 OR8K5 PEX7 PHF3 PLCZ1 PMS2L5 POLI POLQ POTED POTEF PRTG RAD54B RERGL RGPD4 SCN2A SLC16A9 SLCO4C1 SLFN13 SOX5 SPAM1 SPEF2 SPRYD5 SUMO1 SYT14L TAAR8 TDRD3 TFDP2 TRPC1 ZBBX ZBTB20 ZFP37 ZNF253 ZNF442 ZNF564 ZNF610 ZNF626 ZNF627 ZNF66 ZNF705D ZNF766 ZNF844 ZNF98
4 Supplementary Table 4. Regulation of mir-199a/b, and mir-210 by hypoxia and high glucose in vitro mir HF ncms HCAEC ND D HG HYP HG+ HYP HG HYP HG+ HYP mir-199a mir-199b mir Legend: HF=heart failure; ND=non-diabetic; D=diabetic; ncms=neonatal mouse cardiomyocytes; HG=high glucose; HYP=hypoxia; HCAEC= human coronary artery endothelial cells. Statistically significant differences are in bold (ncms, n=8; HCAEC, n=8).
5 Supplementary Table 5. Comparison with previous studies mir DISEASE MODULATION REF 10a Aortic Stenosis/Hypertrophic Cardiomyopathy DOWN Ikeda et al, a End Stage Dilated/Ischemic-Cardiomyopathy DOWN Sucharov et al, 2008 End Stage Dilated/Ischemic-Cardiomyopathy DOWN Schipper et al, 2008 Aortic Stenosis/Hypertrophic-Cardiomyopathy DOWN Carè et al, 2007 Aortic Stenosis/Hypertrophic-Cardiomyopathy DOWN Duisters et al, 2010 End Stage Dilated/Ischemic-Cardiomyopathy UP Matkovich et al, End Stage Dilated-Cardiomyopathy DOWN Thum et al, a End Stage Dilated-Cardiomyopathy UP van Rooij et al, 2006 End Stage Dilated/Ischemic Cardiomyopathy UP Matkovich et al, b End Stage Ischemic-Cardiomyopathy UP Da Costa Martins et al, End Stage Dilated-Cardiomyopathy UP Thum et al, End Stage Dilated/Ischemic-Cardiomyopathy DOWN Ikeda et al, End Stage Ischemic-Cardiomyopathy UP van Rooij et al, b End Stage Dilated-Cardiomyopathy UP Thum et al, End Stage Dilated-Cardiomyopathy UP Thum et al, 2007
6 Supplementary Figure 1. mrnas unsupervised hierarchical clustering analysis. Unsupervised hierarchical clustering analysis is displayed as 3-dimensional representation with a cloud of spheres in which each sphere represents a single sample.
7 Supplementary Figure 2. mrna Class Comparison Validation. After Class Comparison analysis the expression of some of the mrnas significantly deregulated was measured by qpcr in the relevant patient groups: D HF vs CTR (A); ND HF vs CTR (B) and ND HF vs D HF (C), (*p=0.05, **p=0.01, ***p=0.001; ND HF, n=16; D HF, n=6 and CTR, n=15).
8
9 Supplementary Figure 3. In vitro validation of mir-204 and -216a predicted targets HEK293 cells were transfected with plasmidic expression vectors encoding the precursor of mir-216a and mir-204, two of the most strongly modulated mirnas in our study. Expression vectors also carried puromycin as selection marker. The two pre-mirna encoding vectors or the null-vector as control, were transfected by Fugene 6 and fast selected by 2? g/ml puromycin for 24 hours, to decrease the influence of nontransfected cells. mrna expressions of nine selected targets were measured by qpcr. We found that seven transcripts were significantly down-regulated after mir-204 or mir-216 transfection (n=4).
Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.
Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived
More informationSupplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.
Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT
More informationSupplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing
Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging
More informationIntegrative Radiation Biology
Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of
More informationQuantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes
Quantitative Real Time PCR (RT-qPCR) First strand cdna was synthesized and RT-qPCR was performed using RT2 first strand kits (Cat#330401) and RT2 qpcr Master Mix (SABioscience, Frederick, MD). Experiments
More informationdevseek (Sequence(Analysis(Panel(for(Neurodevelopmental(Disorders
ACSL4 Mental/retardation,/XBlinked/63 XLBR ADSL Adenylosuccinase/Deficiency AR AFF2 Mental/retardation,/XBlinked,/FRAXE/type XLBR ALG6 Congenital/disorder/of/glycosylation/type/Ic AR ANK3 Mental/retardation,/autosomal/recessive/37
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. ADARs expression and efficiency of ADAR1 knockdown in endothelial cells. (a) Expression of ADAR1, ADAR2 and ADAR3 in HUVECs according to RNA sequencing (RNA-seq).
More informationAppendix table of content: Appendix Table S1. Appendix Table S2. Appendix Figure S1. Appendix Figure S2. Appendix Methods.
Appendix table of content: Appendix Table S Appendix Table S Appendix Figure S Appendix Figure S Appendix Methods Appendix Legends Appendix Methods mir--3p putative targets in silico analysis: Predictions
More informationp5+mir30: AATGATACGGCGACCACCGACTAAAGTAGCCCCTTGAATTC
SUPPORTING INFORMATION METHODS Massively parallel sequencing and shrna screen data analysis pipeline Genomic DNA extraction and purification from surviving MCF7 cells in the genome wide screen was carried
More informationDYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION
DYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION Gentzon Hall 1,2#, Brandon Lane 1,3#, Megan Chryst-Ladd 1,3, Guanghong Wu 1,3, Jen-Jar Lin 4, XueJun
More informationPushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%
Stanford University School of Medicine Department of Radiation Oncology Division of Radiation Physics Pushing%PET%Imaging%to%the% Cellular%Level:%Development%of%a% Radioluminescence%Microscope%! Guillem!Pratx,!PhD!
More informationSupplementary Fig.S1 Microarray quality control chart. Supplementary Fig.S2 Display of the overview of pathway network from Reactome online.
Supplementary Fig.S1 Microarray quality control chart. Data after normalization. X-axis: sample; Y-axis: log2 expression value. Box plot showed the distribution of value data for the samples we selected
More informationSupplementary information: Forstner, Hofmann et al.
Supplementary information: Forstner, Hofmann et al., Genome-wide analysis implicates micrornas and their target genes in the development of bipolar disorder Table of contents Supplementary Figure 1: Regional
More informationSupplementary Information
1 Supplementary Information Human TSC2 Null Fibroblast-Like Cells Induce Hair Follicle Neogenesis and Hamartoma Morphogenesis Shaowei Li 1, Rajesh L. Thangapazham 1, Ji-an Wang 1, Sangeetha Rajesh 1, Tzu-Cheg
More informationChromoFic, Chromosome SNP Microarray 750K, High Resolution
SPECIMEN Peripheral blood ChromoFic, Chromosome SNP Microarray 750K, High Resolution CLINICAL INDICATION Failure to thrive, dysmorphism, triangular face, long philtrum, congenital heart disease, increased
More informationTable S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t1/2 ± SD (hrs)
Table S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t 1/2 ± SD (hrs) n TNF -CDE 37 -V2 AGATCCTTCAGACAGACATGTTTTCTGTGAAAACGGAGCTGAGCTAGATCT
More informationTable 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
More informationTable S5: List of 152 differentially expressed genes in anti-gal-1 versus scramble JJN3
Table S5: List of 152 differentially expressed genes in anti-gal-1 versus scramble JJN3 comparison specific after re-oxygenation process. Gene.symbol Variation Gene Name FOS -1.049641012 v-fos FBJ murine
More informationSupplementary Information to
Supplementary Information to Exome sequencing to identify de novo mutations in sporadic ALS trios Alessandra Chesi 1,11, Brett T. Staahl 2, Ana Jovicic 1, Julien Couthouis 1, Maria Fasolino 3, Alya R.
More informationNature Neuroscience: doi: /nn.4295
Supplementary Figure 1 Gene expression profiling of EGFRvIII-expressing human brain tumor stem cells (BTSCs) and mouse astrocytes (a) The protein lysates of human BTSCs were analyzed by immunoblotting
More informationSubject ID: Date Test Started: Specimen Type: Peripheral Blood Date of Report: Date Specimen Obtained:
TEST PERFORMED Whole exome sequencing (WES) with Focused Diagnostic Panel(s): Neuropathy, Leukodystrophy, Myopathy See below for a complete list of genes analyzed. RESULTS 1 sequence variant with potential
More informationThe pluripotency factor NANOG promotes the formation of squamous cell carcinomas
SUPPLEMENTAL DATA The pluripotency factor NANOG promotes the formation of squamous cell carcinomas Adelaida R. Palla, Daniela Piazzolla, Noelia Alcazar, Marta Cañamero, Osvaldo Graña, Gonzalo Gómez-López,
More informationSupplementary Figure 1. Microarray data mining and validation
Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to
More informationTable SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK
Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.
More informationNovel Insights into Breast Cancer Genetic Variance through RNA Sequencing
Insights into Breast Cancer Genetic Variance through RNA Sequencing SUPPLEMENTARY DATA Anelia Horvath, 1,2* Suresh Babu Pakala, 2* Prakriti Mudvari, 1* Sirigiri Divijendra Natha Reddy, 2 Kazufumi Ohshiro,
More informationSupplementary Online Content
Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published
More informationIs genomic grading killing histological grading?
Is genomic grading killing histological grading? Christos Sotiriou MD PhD Fonds National de Recherche Scientifique (FNRS) Université Libre de Bruxelles (ULB) Institut Jules Bordet Histological Grade and
More informationIdentifying Thyroid Carcinoma Subtypes and Outcomes through Gene Expression Data Kun-Hsing Yu, Wei Wang, Chung-Yu Wang
Identifying Thyroid Carcinoma Subtypes and Outcomes through Gene Expression Data Kun-Hsing Yu, Wei Wang, Chung-Yu Wang Abstract: Unlike most cancers, thyroid cancer has an everincreasing incidence rate
More informationSupplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
More informationNature Biotechnology: doi: /nbt # m
Supplementary Figure 1. Cell seeding in microwells. Cells were stained with SYBR green and visualized under a microscope. Arrows point to single cells (green). Each image is a different position within
More informationSupplemental Tables and Figures
Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,
More informationCilioPathy panel. 3-Jul-2018 (102 genen) Centrum voor Medische Genetica Gent. versie. OMIM gene ID
versie 3-Jul-2018 (102 genen) CilioPathy panel Centrum voor Medische Genetica Gent Gene OMIM gene ID Associated phenotype, OMIM phenotype ID, phenotype mapping key and inheritance pattern AHI1 608894 Joubert
More informationRNA-mediated paternal heredity of diet-induced obesity and metabolic disorders
RNA-mediated paternal heredity of diet-induced obesity and metabolic disorders Valérie Grandjean 1,2,3 $, Sandra Fourré 4, Diana Andrea Fernandes De Abreu 5, Marie-Alix Derieppe 1,2,3, Jean-Jacques Remy
More informationLions and Tigers and Bears.Oh My!
Lions and Tigers and Bears.Oh My! TAKING THE FEAR OUT OF GENETIC TESTING Lisa Butterfield, MS, CGC Genetic Counselor Clinical Assistant Professor University of Kansas Health System Why is Genetic Testing
More informationSupplementary Materials
Supplementary Materials Supplemental figure 1. Absolute cell count of naïve/memory compartment of CD4 and CD8 T cells in early years Absolute cell number of naïve (CD45RA+CCR7+), Stem cell memory T cell
More informationTable S1: List of the 646 known pathogenic genes targeted in the present study and their associated mode of inheritance. ARID: autosomal-recessive
Table S1: List of the 646 known pathogenic genes targeted in the present study and their associated mode of inheritance. : autosomal-recessive intellectual disability; : autosomal-dominant intellectual
More informationAn integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida
Supplementary information for: An integrated transcriptomic and functional genomic approach identifies a type I interferon signature as a host defense mechanism against Candida albicans in humans Sanne
More informationSomatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas
1 Somatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas 2 3 FIGURE S1: Sensitivity & Specificity receiver operator characteristics (ROC) of Signature Cancer-Associated
More informationProteome Analysis of Human Perilymph using an Intraoperative Sampling Method
Supporting Information Article Title Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method Authors Heike A. Schmitt 1,3, Andreas Pich 2, Anke Schröder 2, Verena Scheper 1,3, Giorgio
More informationOptimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information
Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information Florent Baty 1 florent.baty@unibas.ch Michel P Bihl 1 michel.bihl@unibas.ch
More informationDravet Syndrome: What Warrants Further Testing
Dravet Syndrome: What Warrants Further Testing or SCN1A in the Modern Era and SCN1A-negative Dravet syndrome Annapurna Poduri, MD, MPH Director, Epilepsy Genetics Program Division of Epilepsy & Clinical
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG
More informationTargeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels
Targeted s and Methodology Details for Epilepsy/Seizure tic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Epilepsy/Seizure tic Panels Epilepsy Expanded Panel Epilepsy Expanded
More informationPOT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia
POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia Andrew J. Ramsay, Víctor Quesada, Miguel Foronda, Laura Conde, Alejandra Martínez-Trillos, Neus Villamor, David Rodríguez, Agnieszka
More informationLarge-Scale Discovery of Enhancers from Human Heart Tissue
Large-Scale Discovery of Enhancers from Human Heart Tissue Dalit May, Matthew J. Blow, Tommy Kaplan, David J. McCulley, Brian C. Jensen, Jennifer A. Akiyama, Amy Holt, Ingrid Plajzer-Frick, Malak Shoukry,
More informationSupplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji
More informationMicro-RNAs in cancer: novel origins and sequence variation. Feng Yu
Micro-RNAs in cancer: novel origins and sequence variation Feng Yu M.Sc., B.Sc. This thesis is submitted in fulfilment of the requirements for the Doctor of Philosophy School of Medicine The University
More informationGlobal mirna expression analysis identifies novel key regulators of plasma cell differentiation and malignant plasma cell
Published online 29 April 2017 Nucleic Acids Research, 2017, Vol. 45, No. 10 5639 5652 doi: 10.1093/nar/gkx327 Global mirna expression analysis identifies novel key regulators of plasma cell differentiation
More informationg. RA Bardot et al., 2016 Supplementary Figure 1 RV LV E15.5 E6.5 E18.5 E7.5 VE RV LV E8.5 RV LV E10.5 Brightfield Foxa2Cre:YFP Brightfield
Bardot et al., 216 Supplementary Figure 1 a. VE e. RA LA LA RV LV E15.5 E6.5 b. E7.5 VE f. RA E18.5 LA c. E8.5 ML N CM g. RA RV LV LA P7 PHT RV LV d. E1.5 Brightfield Foxa2Cre:YFP H Brightfield Foxa2Cre:YFP
More informationSupplementary Note. (Quesada et al., Exome-Sequencing Identifies Recurrent Mutations of the Splicing Factor SF3B1 in Chronic Lymphocytic Leukemia)
Supplementary Note (Quesada et al., Exome-Sequencing Identifies Recurrent Mutations of the Splicing Factor SF3B1 in Chronic Lymphocytic Leukemia) The clinical and biological characteristics of the 105
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More informationMirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion
Mirsynergy: detect synergistic mirna regulatory modules by overlapping neighbourhood expansion Yue Li yueli@cs.toronto.edu October 30, 2017 1 Introduction MicroRNAs (mirnas) are 22 nucleotide small noncoding
More informationPaternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
More informationHeterotaxie PCD (Primaire ciliaire dyskinesie) panel
Heterotaxie PCD (Primaire ciliaire dyskinesie) panel versie V1 (92 genen) Centrum voor Medische Genetica Gent Gene OMIM gene ID Associated phenotype, OMIM phenotype ID, phenotype mapping key and inheritance
More informationInfrequently expressed mirnas influence survival after diagnosis with colorectal cancer
/, 2017, Vol. 8, (No. 48), pp: 83845-83859 Infrequently expressed mirnas influence survival after diagnosis with colorectal cancer Martha L. Slattery 1, Andrew J. Pellatt 2, Frances Y. Lee 2, Jennifer
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationFig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
More informationCharacterization of Micro RNA Signature in Peripheral Blood of Schizophrenia Patients using µparaflo TM mirna Microarray Assay
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 7 (2016) pp. 503-512 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.507.055
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationSALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
More informationSupplement Results, Figures and Tables
Supplement Results, Figures and Tables Results PET imaging The SUV was significantly higher in tumours of the parental HSC-3 cell line than tumours of the EV and the MMP-8 overexpressing cell lines (Figure
More informationSupporting Information
Supporting Information Rampal et al. 10.1073/pnas.1407792111 Fig. S1. Genetic events in leukemic transformation of chronic-phase MPNs. (A) Survival of post-mpn AML patients according to mutational status
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
More informationCOMPLETE A FORM FOR EACH SAMPLE SUBMITTED ETHNIC BACKGROUND REPORTING INFORMATION
DATE SAMPLE DRAWN: SAMPLE TYPE: BLOOD OTHER (SPECIFY): COMPLETE A FORM FOR EACH SAMPLE SUBMITTED PATIENT FIRST NAME: LAST NAME: DOB: SEX: M F UNKNOWN ADDRESS: HOME PHONE: ( ) WORK: ( ) EUROPEAN CAUCASIAN
More informationAutism/ID Xpanded Panel Gene List (~2000)
Autism/ID Xpanded Panel Gene List (~2000) Approximately 84% of the genes are covered >99% at 10X and the average coverage of a gene at 10X for this panel is >98%. A2M A2ML1 AAAS AARS AARS2 AASS ABAT ABCA1
More informationSupplemental Figures/Tables. Methylation forward GTCGGGGCGTATTTAGTTC. Methylation reverse AACGACGTAAACGAAAATATCG
Supplemental Figures/Tables Supplementary Tables Table S1. Primer sequences MSP Primers SPARC2 Unmethylation forward TTTTTTAGATTGTTTGGAGAGTG Unmethylation reverse AACTAACAACATAAACAAAAATATC Methylation
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation
More informationSupplementary Figure 1. c Human
Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF
More informationSI_05 Supplementary Table 5
Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines Systems Biology and Cancer Metabolism, Program for Quantitative
More informationComprehensive genetic testing for hearing and vision loss
Comprehensive genetic testing for hearing and vision loss Hearing and vision loss can result from both genetic and non-genetic etiologies In general, there is a genetic basis for up to 50% of prelingual
More informationEnabling Informed Clinical Decisions with Deep Insights. Routine Multi-gene Testing for Inherited Neuromuscular Disorders
Enabling Informed Clinical Decisions with Deep Insights Routine Multi-gene Testing for Inherited Neuromuscular Disorders Introduction Multi-gene Testing for Inherited Neuromuscular Disorders Inherited
More informationSupplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature12912 Figure S1. Distribution of mutation rates and spectra across 4,742 tumor-normal (TN) pairs from 21 tumor types, as in Figure 1 from Lawrence et al. Nature
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationWhat Do We Know About Individual Variability and Its
What Do We Know About Individual Variability and Its Contribution to Disease? Nathaniel Rothman, MD, MPH, MHS Occupational and Environmental Epidemiology Branch, Division of Cancer Epidemiology and Genetics,
More informationA. Complete list of 177 genes overexpressed in replicative senescence
Table S1. A. Complete list of 177 genes overexpressed in replicative senescence Value Gene Description UniGene RefSeq 2.440 WNT16 wingless-type MMTV integration site family, member 16 (WNT16), transcript
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationSup. Fig. 1. Densitometry and IHC analysis. (a) Densitometry analysis showing
# # # # # # # Supplemental Figure a.5# *" b c MNK# MNK#.5# p)eif4e# MNK# *" RelaAve#protein#level#.0# 0.5# 0.0# *" *" *" *" GM084# SUDHL)6# Pfeiffer# HLY)# TMD8# RelaAve#protein#level#.0# 0.5# 0.0# *"
More informationReprogramming through micrornas Stefanie Dimmeler
Klinikum der Johann Wolfgang Goethe Universität Frankfurt am Main Reprogramming through micrornas Stefanie Dimmeler Conflict of interest: T2cure GmbH, Miragen Non-coding DNA & RNA and micrornas Human Genome
More informationHuman lung epithelial cells progressed to malignancy through specific oncogenic. manipulations
Supplementary Material for: Human lung epithelial cells progressed to malignancy through specific oncogenic manipulations Mitsuo Sato* 1,10, Jill E. Larsen* 1, Woochang Lee 1,11, Han Sun 2, David S. Shames
More informationMessenger RNA profile analysis deciphers new Esrrb responsive genes in prostate cancer cells
DOI 10.1186/s12867-015-0049-1 BMC Molecular Biology RESEARCH ARTICLE Messenger RNA profile analysis deciphers new Esrrb responsive genes in prostate cancer cells Yuan Lu 1,2,5, Jilong Li 2,3,4, Jianlin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12439 Supplementary Table 1. Coriell IDs for all exome sequenced 264 infantile spasms (IS) and Lennox- Gastaut syndrome (LGS) trios. Coriell ID Trio ID Proband
More informationGenomic Service List
Document ID: MBG-C009 Effective Date: 10 Jan 018 Page: 1 of 5 WHOLE GENOME SEQUENCING Human Whole Genome Sequencing 1 HGG-15 Human Whole Genome Sequencing HGG-157 (FASTQ data only) WHOLE EXOME SEQUENCING
More informationSupplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
More informationRegulation of eif4 and p70s6k signaling. Chondroitin and dermatan biosynthesis Interferon signaling
Supplemental Information Table S1: Differentially regulated pathways in cortical versus cerebellar human astrocytes following treatment with PBS or IFN-β Pathway Regulation of eif4 and p70s6k signaling
More informationMathIOmica: Dynamic Transcriptome
Printed from the Complete Wolfram Language Documentation 1 MathIOmica: Dynamic Transcriptome Loading the MathIOmica Package Classification, Clustering and Visualization of Transcriptome Time eries Importing
More informationSupplementary Table 2. Identified causative mutations and/or mutation candidates.
Supplementary Table 2. Identified causative mutations and/or mutation candidates. Nonsense mutations base change aa change Average depth Result of next generation in 432 patient Hereditary form of the
More informationDeciphering molecular circuits from genetic variation underlying transcriptional responsiveness to stimuli
Deciphering molecular circuits from genetic variation underlying transcriptional responsiveness to stimuli Irit Gat-Viks,2,, Nicolas Chevrier,3,4, Roni Wilentzik 2, Thomas Eisenhaure,5, Raktima Raychowdhury,
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSUPPLEMENTARY INFORMATION. Exome Sequencing Reveals Frequent Inactivating Mutations in BAP1, ARID1A, and PBRM1 in Intrahepatic Cholangiocarcinomas
SUPPLEMENTARY INFORMATION Exome Sequencing Reveals Frequent Inactivating Mutations in BAP1, ARID1A, and PBRM1 in Intrahepatic Cholangiocarcinomas Yuchen Jiao, Timothy M. Pawlik, Robert A. Anders, Florin
More informationA transcriptional mirna-gene network associated with lung adenocarcinoma metastasis based on the TCGA database
ONCOLOGY REPORTS 35: 2257-2269, 2016 A transcriptional mirna-gene network associated with lung adenocarcinoma metastasis based on the TCGA database Yubo Wang, Rui Han, Zhaojun Chen, Ming Fu, Jun Kang,
More informationSupplemental figure 1. Genome-wide plots of P-values for all 17 traits.
Supplemental figure 1. Genome-wide plots of P-values for all 17 traits. Supplemental figure 2. Regional plots for (A) the 10p11.21 NDSS drive/priority locus, (B) the 15q22.2 FTND time to first cigarette
More informationG enes R egulated by ODM S timulation (B: BMP2, I: IGF2) Also regulated after stimulation with. Fold change
S upplementary T able 1. G enes R egulated by ODM S timulation (B: BMP2, I: IGF2) PIP Prolactin-induced protein 40.79 FKBP5 FK506-binding protein 5 19.84 CORIN Corin, serine peptidase 13.74 ADH1C Alcohol
More informationSupplementary Figure 1 b
Supplementary Figure 1 b 7 c BT-474 MDA-MB-231 migrated cells/field m G oc F k BR P-s i BRL-s L- i1 si BR N 2 M C S1 L 7 BR M S1 N C FP -s i BR Lsi 1 BR Lsi 2 G m oc k L a 3 ****** 2 ### 1 BT-474 MDA-MB-231
More informationPol Andrés Benito 1, Jesús Moreno 1, Ester Aso 1, Mónica Povedano 2 1, 3, 4, 5. , Isidro Ferrer. Research Paper ABSTRACT INTRODUCTION
dominant but also recessive and X-linked in some families. However, about 13% of sals cases bear a gene mutation linked to fals. Main pathological features in sals are loss of myelin and axons in the pyramidal
More informationIPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy
IPATIMUP Translational Research Unit Matching IPATIMUP s Expertise with Company s Research/Clinical Strategy Innovative Projects Questions & Needs André Albergaria INDUSTRY Pharma R&D Clinical Research
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More information