The Ia-2β intronic mirna, mir-153, is a negative regulator of insulin and dopamine secretion through its effect on the Cacna1c gene in mice
|
|
- Teresa Taylor
- 5 years ago
- Views:
Transcription
1 Dietologi (5) 58:98 36 DOI.7/s ARTICLE The I introni mirna, mir53, is negtive regultor of insulin nd dopmine seretion through its effet on the Cn gene in mie Hunyu Xu & Liron Auhtzir & Gilerto N. Crmon & Surykirn Vdrevu & Leslie S. Stin & Aner L. Notkins Reeived: 3 Deemer /Aepted: June 5 /Pulished online: July 5 # SpringerVerlg (outside the USA) 5 Astrt Aims/hypothesis mir53 is n introni mirna emedded in the genes tht enode IA (lso known s PTPRN)nd IA (lso known s PTPRN). Islet ntigen (IA) nd IA re mjor utontigens in type dietes nd re importnt trnsmemrne proteins in dense ore nd synpti vesiles. mir53 nd its host genes re oregulted in pnres nd rin. The present experiments were initited to deipher the regultory network etween mir53 nd its host gene I (lso known s Ptprn). Methods Insulin seretion ws determined y ELISA. Identifition of mirna trgets ws ssessed using luiferse ssys nd y quntittive reltime PCR nd western lots in vitro nd in vivo. Trget protetor ws lso employed to evlute mirna trget funtion. Results Funtionl studies reveled tht mir53 mimi suppresses oth gluose nd potssiumindued insulin seretion (GSIS nd PSIS, respetively), wheres mir53 inhiitor enhnes oth GSIS nd PSIS. A similr effet on dopmine seretion lso ws oserved. Using mirna trget predition softwre, we found tht mir53 is predited to trget the Eletroni supplementry mteril The online version of this rtile (doi:.7/s ) ontins peerreviewed ut unedited supplementry mteril, whih is ville to uthorised users. Aner L. Notkins notkins@dir.nidr.nih.gov Experimentl Mediine Setion, Lortory of Sensory Biology, Ntionl Institute of Dentl nd Crniofil Reserh, Ntionl Institutes of Helth, 9 Rokville Pike, Bethesd, MD 89, USA Brehm Dietes Reserh Center, University of Mihign Medil Shool, Ann Aror, MI, USA 3 UTR region of the lium hnnel gene, Cn. Further studies onfirmed tht Cn mrna nd protein re downregulted y mir53 mimis nd upregulted y mir53 inhiitors in insulinsereting freshly isolted mouse islets, in the insulinsereting mouse ell line MIN6 nd in the dopminesereting ell line PC. Conlusions/interprettion mir53 is negtive regultor of oth insulin nd dopmine seretion through its effet on Cn expression, whih suggests tht IA nd mir53 hve opposite funtionl effets on the seretory pthwy. Keywords Cv.. IA. Insulin seretion. Introni mirna. MiroRNAs Arevitions CACNAC Clium hnnel voltgedependent, L type, αc suunit DCV Dense ore vesile DKO I/I doule knokout GSIS Gluosestimulted insulin seretion IA Islet ntigen I KO I knokout mie I KO I knokout mie mirna MiroRNA NIDCR Ntionl Institute of Dentl nd Crniofil Reserh PMA Phorolmyristte3ette PSIS Potssiumstimulted insulin seretion PTP Protein tyrosine phosphtse TP Trget protetor VDCC Voltgedependent lium hnnels WT Wildtype
2 Dietologi (5) 58: Introdution Islet ntigen (IA) nd IA re mjor utontigens in type dietes []. Previous studies hve shown tht they re integrl trnsmemrne proteins of dense ore vesiles (DCVs) nd/or synpti vesiles [, 3]. IA nd IA re widely expressed in neuroendorine ells throughout the ody (e.g. pnreti islets, rin, drenls nd gstrointestinl ells) [ 5]. They re memers of the trnsmemrne protein tyrosine phosphtse (PTP) fmily nd re enzymtilly intive with stndrd PTP sustrtes owing to two ritil mino id sustitutions in the PTP domin. However, reent studies suggest tht IA my hve low phosphtidylinositol phosphtse tivity [6]. IA nd IA hve een found to ply importnt roles in the seretion of hormones nd neurotrnsmitters suh s insulin, luteinising hormone (LH) nd folliulr stimulting hormone (FSH), nordrenline (norepinephrine, NE), dopmine, serotonin nd renin, nd redution of these hormones results in gluose intolerne, femle infertility, ehviourl hnges nd loss of irdin rhythm [3, 7 ]. Reently, we showed tht the mirorna, mir53, is emedded in intron 9 of oth IA (lso known s PTPRN nd ICA5) nd IA (lso known s PTPRN) in humns nd enodes two identil mture sequenes (mir53 nd mir53) [5]. In ontrst, in the mouse nd rt, mir53 isfoundinthei gene (lso known s Ptprn nd phogrin). The mir53 preursor gives rise to two mirna sequenes, mir533p nd mir535p, of whih only mir 533p is identil to the humn mir53 nd is highly onserved, evolutionrily, ross different speies [5]. It is estimted tht 37% of mmmlin mirnas re loted within introns of protein oding genes [6], nd oregultion of these intrgeni mirnas nd their host genes is ommon iologil phenomenon [5, 7]. Moreover, introni mirnas nd their host genes, often tend to work in prllel, forming regultory reltionships etween host genes nd introni mirnas [8]. Bsed on the funtion of its host gene, I, mir53 is potentilly linked to the seretion of hormones nd neurotrnsmitters. Moreover, in reent study we showed tht in I knokout mie, mir53 is t lest prtly oregulted with its host gene, I [5]. However, the ext reltionship etween IA, mir53, nd its trget genes remins unler. The present study ws initited to ssess the funtionl effet of mir53 on hormone nd neurotrnsmitter seretion nd to further our understnding of the reltionship etween the host gene I, its introni mir53 nd the gene trgets of mir53. Methods Mie Trgeted disruption of the individul I nd I genes (I KO nd I KO) nd genertion of I / /I / doule knokout (DKO) mie hve een desried previously [7, 5]. Animls used in this study were from C57/BL6 kground nd produed in our institute niml ore fility (Ntionl Institute of Dentl nd Crniofil Reserh [NIDCR], Bethesd, MD, USA). Lights were on from 6: to 8: nd food nd wter were ville d liitum. All tissue smples hrvested for this study were from ge nd sexmthed mie tht were rndomly seleted from their home ge. Animl studies were onduted under protools pproved y the Institutionl Animl Cre nd Use Committees of the Ntionl Institutes of Helth (NIH), USA. Cell lines The MIN6 ell line, 93T ell line nd PC ells ulture methods re desried in detil in the Eletroni Supplementry Mteril (ESM) Methods. Mouse islets Islets from 3 month old sexmthed mie were isolted with slight modifitions of the Collgense P (Rohe, Indinpolis, IN, USA) mnufturer s protool. See ESM Methods for further detils. Bioinformtis nlysis of potentil mir53 trgets Identifition of puttive trget genes of mir53 ws performed y two ioinformtis softwre progrms, Trgetsn 6. ( relese 6., essed 8 Ferury 3) nd Pitr ( essed 8 Ferury 3). We serhed for mir53 trgets using the term lium. Overlp of mir53 puttive trget genes y these two softwre progrms were seleted for further nlysis. MiroRNA mimi nd inhiitor trnsfetion MIN6 ells, mouse islets nd PC ells were trnsfeted with mir53 mimi or inhiitor (Qigen, Germntown, MD, USA) or srmle ontrol (AllStrs Negtive sirna, Qigen), using HiPerFet Trnsfetion Regent (Qigen) ording to the mnufturer s instrutions. After 7 h, the trnsfeted ells were further proessed for gluose or potssiumstimulted insulin seretion (GSIS or PSIS, respetively), gene expression nlyses or western lotting. For further detils, see ESM Methods. GSIS or PSIS Insulin seretion in MIN6 ells nd mouse islets ws mesured fter the ells were trnsfeted s desried ove. Fold hnge of insulin seretion ws lulted y ompring insulin levels efore nd fter stimultion. For further detils, see ESM Methods. Dopmine seretion test The dopmine seretion test in PC ells ws onduted t 7 h fter trnsfetion with mir53 mimi, mir53 inhiitor or ontrol. Fold hnge of dopmine seretion ws lulted y ompring dopmine levels efore nd fter stimultion with high K solution with
3 3 Dietologi (5) 58:98 36 or without phorolmyristte3ette (PMA). For further detils, see ESM Methods. Totl RNA, mirna nd quntittive PCR Totl RNA nd mirna were extrted using mirnesy Mini kit (Qigen) following mnufturer s protools. DNA synthesis for oth mrna nd mirna ws performed using misript II RT kit (Qigen). Quntittive reltime PCR ws performed using misript SYBR Green PCR kit (Qigen) for mir53 or n SYBR Green PCR Mster Mix (Life Tehnologies, Frederik, MD, USA) for I, Cn, Cn, Cmkg, Csk, Ci nd Gpdh (primer sequenes re ville in ESM Tle ), nd nlysed on 75 RelTime PCR system (Life Tehnologies). Genertion of Cn 3 UTR reporter onstrut The method for onstruting the wildtype (WT) nd mutnt luiferse reporter plsmids for mirna trget vlidtion ws dpted from previous report [9]. After sequening vlidtion, plsmid DNA ws prepred using Plsmid Miniprep kit (Qigen). For further detils, see ESM Methods. Trnsfetion nd luiferse reporter ssys 93T ells were otrnsfeted with luiferse reporter plsmids (either WT or mutnt plsmid) nd mir53 mimi (Qigen) or the srmle ontrol (Qigen), nd the Renill luiferse ontrol vetor (Promeg, Mdison, WI, USA), using Lipofetmine (Life Tehnologies) ording to the mnufturer s instrutions. The luiferse tivity ssy ws performed h fter trnsfetion, using the DulLuiferse Reporter Assy System (Promeg). Firefly luiferse tivity ws normlised to Renill luiferse tivity. Trget protetor funtionl nlysis mir53 misript trget protetor (mir53cn) ws designed to e omplementry to the predited mir53 inding site in the Cn 3 UTR (Qigen). Trnsfetion ws performed ording to the mnufturer s protool. GSIS ws performed 7 h lter, together with quntittive reltime PCR for Cn mrna to ssess the protetive effet of the trget protetor. For further detils, see ESM Methods. Clium mirofluorimetry [C ] i ws mesured using the rtiometri dye fur/am ( high ffinity, intrellulr lium inditor), with proedures modified from previous report []. For further detils, see ESM Methods. Protein extrtion nd western lot nlysis Proteins from ells or mouse tissues were isolted nd then nlysed y western lotting ording to stndrd proedures. See ESM Methods for further detils. Ritntilium hnnel, voltgedependent, L type, αc suunit (CACNAC) ntiody (:5 dilution, Snt Cruz Bioteh, Dlls, TX, USA) nd mousentiαtuulin ntiody (:5, dilution, Am, Cmridge, MA, USA) were employed s primry ntiodies. Blots were quntified using NIH Imge J Softwre. Sttistil nlysis Unless stted otherwise, eh experiment ws performed three times (n=3) nd ssyed in triplite. Dt re expressed s the men ± SEM of the three experiments. The Student s t test for two groups or ANOVA for multiple groups were used to determine sttistil signifine. In ll ses, p<.5 ws onsidered signifint. Results The effet of mir53 on insulin nd dopmine seretion To evlute the effet of mir53 on insulin seretion, we used the mouse insulinsereting ell line MIN6 nd freshly isolted pnreti islets from mie. Cells were trnsfeted with mir53 mimi or inhiitor (ESM Fig., ) nd nlysed for GSIS nd PSIS. Trnsfetion of MIN6 ells with mir53 mimi, followed y gluose stimultion, led to 5% redution in insulin seretion. In ontrst, mir53 inhiitor led to 3% inrese in insulin seretion following gluose stimultion (Fig. ). Similr results were otined using freshly isolted mouse islets (Fig. ). Stimultion with high potssium led to 5% redution in insulin seretion in the mir53 mimi group nd 3% inrese in insulin seretion in the mir53 inhiitor group (Fig., d, respetively). These results lerly show tht overexpression of mir53 suppressed oth GSIS nd PSIS, wheres inhiition of endogenous mir53 funtion enhned insulin seretion. Bsed on the high endogenous expression of mir53 in rin nd the role of its host genes in neurotrnsmitter seretion, we hypothesised tht mir53 would lso ply role in the seretion of neurotrnsmitters. To test this hypothesis, we overexpressed or inhiited mir53 in PC ells (ESM Fig. ), dopminesereting ell line, nd mesured dopmine seretion. PC ells trnsfeted with mir53 mimi, followed y potssium stimultion, led to 5% redution in dopmine seretion, wheres PC ells trnsfeted with mir53 inhiitor, followed y potssium stimultion, led to % inrese in dopmine seretion (Fig. e). Stimultion of PC ells with oth potssium nd the protein kinse C (PKC) stimultor PMA [], led to % derese in dopmine seretion in the mir53 mimi group nd 5% inrese in the mir53 inhiitor group (Fig. f). Tken together, these studies show tht mir53 is negtive regultor of oth insulin nd dopmine seretion. GSIS ours through the losure of ATPsensitive K hnnels in the et ell plsm memrne, resulting in ell depolristion, tivtion of voltgedependent lium hnnels (VDCC) nd rise in islet [C ] i. In order to sertin whether mir53 regultes the tivity of VDCCs, we used
4 Dietologi (5) 58: MIN6/GSIS insulin level (fold hnge) 6 8 mir53 mimi mir53 inhiitor Islets/GSIS insulin level (fold hnge) mir53 mimi mir53 inhiitor MIN6/PSIS insulin level (fold hnge) 6 mir53 mimi mir53 inhiitor d Islets/PSIS insulin level (fold hnge) Fig. Impt of mir53 on insulin nd dopmine seretion. After stimultion with 5 mmol/l gluose (, ) or 5 mmol/l KCl (, d) in MIN6 ells, or primry mouse islets trnsfeted with srmled ontrol, mir53 mimi or mir53 inhiitor for 7 h, insulin seretion ws mesured. Dt re presented s fold hnge ompred with the level efore stimultion. Experiments were performed six times (n=6) in triplite. (e, f) Dopmine seretion (fold hnge) in PC ells stimulted 8 e PC/dopmine level (fold hnge) mir53 mimi mir53 inhiitor 3 mir53 mimi mir53 inhiitor f PC/dopmine level (fold hnge) g Islets/hnge in C response (rtio of R3/R38) mir53 mimi mir53 inhiitor mir53 mimi mir53 inhiitor with 5 mmol/l KCl without (e) or with(f) PMA ompred with sl levels, 7 h fter trnsfetion with mir53 mimi or mir53 inhiitor (n=3). (g) Chnge in mouse islet [C ] i responses fter islet trnsfetion with srmled ontrols, mir53 mimi or mir53 inhiitor for 7 h, followed y stimultion with 3 mmol/l KCl. p<.5 nd p<. vs ontrols FURA/AM to mesure KClindued hnges in [C ] i in ontrol islets, or islets treted with either the mir53 mimi or inhiitor. In the urrent study, we oserved tht 3 mmol/l KCl eliited roust inrese in [C ] i in ontrol islets, nd to lrger extent in islets treted with the mir53 inhiitor (Fig. g). Interestingly, the [C ] i response of islets treted with the mir53 mimi were redued ompred with ontrol islets or to the inhiitor group (Fig. g), inditing tht mir53tsonseretiontlest in prt y modulting VDCC tivity. Effet of mir53 on lium relted trget genes In order to identify potentil trgets of mir53 tht ould ffet insulin nd dopmine seretion, the ioinformtis softwre Trgetsn 6. nd Pitr were employed. Within the list of mir53 predited trgets, we found lium relted trgets. Five trgets were identified y oth softwre progrms: Cn, Cn, Cmkg, Csk nd Ci. To experimentlly vlidte the predition, MIN6 ells were trnsfeted with mir53 mimi or inhiitor. As seen in Fig., of the five trgets identified, only Cn nd Csk hd expression levels tht were signifintly redued or inresed fter trnsfetion with mir53 mimi or mir53 inhiitor. Given tht the Cn gene hs een implited in ltering insulin seretion s well s neurotrnsmitters in vitro nd in vivo [ 5], we hose to fous on the Cn gene for further investigtion. Vlidtion of n mir53 trget site in the Cn 3 UTR To onfirm tht Cn n e diretly regulted y mir53, portion of the mouse Cn gene 3 UTR ws loned into luiferse reporter vetor. A mutted onstrut ws lso generted, in whih the puttive mir53 inding site UAUGCAA ws mutted into UAggtA nd then loned into luiferse reporter vetor (Fig. ). When ompred with the reporter vetor lone, luiferse tivity ws signifintly redued following trnsient otrnsfetion of mir53 mimi with luiferse expression plsmid in 93T ells (Fig. ). In ontrst, trnsfetion of 93T ells with srmled ontrol did not hve ny effet on the luiferse tivity. However, muttions within the seed sequene inding site of Cn rogted the effet of mir53 mimi (Fig. ), therey onfirming tht Cn is diret trget of mir53. Regultion of endogenous Cn expression y mir53 in different ell lines Trnsfetion of ell lines with mir 53 mimi signifintly redued Cn mrna expression y nerly 5% s ompred with the ontrol in MIN6 ells, norml mouse islets nd PC ells. In ontrst, signifint inrese in Cn mrna expression ws oserved in ll three of these ells following trnsfetion with the mir53 inhiitor (Fig. 3 ). Western lot nlysis onfirmed the effets of mir53 on the CACNAC protein level in MIN6 ells nd PC ells (Fig. 3d,e). To rule out the possiility tht mir53 ws exerting its effet through hnges in the expression of its host gene, I, we determined I mrna levels following trnsfetion of the different ell lines with either mir53 mimi or mir53 inhiitor (Fig. 3f, g). Our results showed tht mir53 hs no effet on I mrna levels. Effet of mir53cn trget protetor To onfirm tht the redution of GSIS ws due to mir53 ting through its effet on the Cn gene, mir53cn trget protetor ws employed. The trget protetor is singlestrnded modified RNA tht is omplementry to the mir53 inding
5 3 Dietologi (5) 58:98 36 Reltive mrna expression (fold hnge) 3 CUAGUGAAAACACUGAUACGUU 5 Normlised luiferse tivity (fold hnge) mmumir CUGUCCCACGAGAUAUGCAAAAGCAAUGC... 3 H. spiens Cn 3 UTR 5...CUGUCCCACGAGAUAUGCAAAAGCAAUGC... 3 R. norvegius inding sites 5...CUGUCCCACGAGAUAUGCAAAAGCAAUGC... 3 M. musulus CUGUCCCACGAGAUAggtAAAGCAAUGC 3 UTR mutnt site Cn Cn.5..5 WT Cn 3 UTR Srmled ontrol mir53 mimi Mutted Cn 3 UTR Cmkg Fig. Effet of mir53 mimi or inhiitor on lium genes: puttive mir53 trget site in the Cn 3 UTR. () Expression nlysis of mir53 predited trgets y quntittive reltime PCR 7 h fter trnsfetion with srmled ontrol (lk rs), mir53 mimi (grey rs) or mir53 inhiitor (white rs). All dt were normlised to Gpdh (n=3). () mir53 predited trget site in mouse Cn 3 UTR nd mutted 3 UTR sequene with four nuleotide replements (lower se letters). There is strong sequene onservtion in mie, rts nd humns. () Luiferse reporter ssy demonstrting funtionl tivity of mir 53 mimi on WT Cn 3 UTR in 93T ells, ut not on mutted Cn 3 UTR. Normlised to Renill luiferse tivity (n=3). p<.5 nd p<. vs ontrols Csk Ci Cn mrna reltive expression (fold) f d I mrna reltive expression (fold) CACNAC protein reltive expression (fold) mir53 mimi mir53 inhiitor mir53 mimi mir53 inhiitor mir53 mimi mir53 inhiitor CACNAC αtuulin g Cn mrna reltive expression (fold) I mrna reltive expression (fold).5..5 e CACNAC protein reltive expression (fold) mir53 mimi mir53 inhiitor mir53 mimi mir53 inhiitor Cn mrna reltive expression (fold) mir53 mimi mir53 inhiitor h I mrna reltive expression (fold).5..5 CACNAC αtuulin mir53 mimi mir53 inhiitor mir53 mimi mir53 inhiitor Fig. 3 Regultion of Cn expression y mir53. Effets of mir53 mimi nd mir53 inhiitor on Cn expression y quntittive reltime PCR: () MIN6 ells; () mouse islets; () PC ells. (n=3). Western lots for CACNAC nd αtuulinproteinlevelsinmin6ells(d) nd PC ells (e). The reltive expression vlues were determined y Imge J (n=3). I mrna levels were unhnged in MIN6 ells (f), mouse islets (g) nd PC ells (h) following trnsfetion with mir53 mimi or inhiitor. (n=3), p<.5 nd p<. vs ontrols site on the Cn 3 UTR nd speifilly disrupts the intertion etween mir53 nd Cn 3 UTR. As seen in MIN6 ells (Fig. ) nd freshly isolted mouse islets (Fig. ), trnsfetion with the mir53cn trget protetor rogted, t lest in prt, the suppressive effet of exogenous mir53 mimi on GSIS. This provides further evidene tht the effet of mir53 mimi on insulin seretion is medited, t lest in prt, through Cn gene regultion. To determine the effet of mir53cn trget protetor on Cn mrna expression, quntittive reltime PCR ws employed. In MIN6 ells (Fig. ) nd freshly isolted mouse islets (Fig. d), otrnsfetion of ells with mir53 mimi nd mir53cn trget protetor lso rogted, t lest in prt, the suppressive effet of exogenous mir53 mimi on Cn mrna levels. Although in freshly isolted mouse islets, otrnsfetion of mir53
6 Dietologi (5) 58: MIN6/GSIS insulin level (fold hnge) MIN6/Cn mrna reltive expression (fold hnge) 6 TP mir53 mimi TPmiR53 mimi TP mir53 mimi TPmiR53 mimi Islets/GSIS insulin level (fold hnge) Islets/Cn mrna reltive expression (fold hnge) mimi with mir53cn trget protetor did not fully restore Cn mrna expression to norml levels, positive trend ws oserved (Fig. d). The most likely explntion for the filure of the protetor to fully restore GSIS is tht it is speifi to Cn nd therefore ould not protet the degrdtion of other potentil mir53 trgets involved in seretion. mir53 nd Cn expression in I KO mie To determine whether the expression of Cn is ontrolled y mir53 in vivo, I KO nd DKO mie, in whih mir53 levels re drmtilly redued [5], were used for expression orreltion nlysis. Our results showed tht mir53 levels re drmtilly redued in pnreti islets from I KO nd DKO mie (Fig. 5) nd lso lthough d 8 TP mir53 mimi TPmiR53 mimi TP mir53 mimi TPmiR53 mimi Fig. Effet of mir53cn trget protetor. Gluose stimultes insulin seretion (fold hnge) in MIN6 ells () nd mouse islets (), fter trnsfetion with mir53 mimi with nd without mir53 Cn trget protetor (TP), showing tht the trget protetor prtly rogted the inhiitory effet of mir53 on GSIS (n=3). Cn expression nlysis y quntittive reltime PCR in MIN6 ells () nd mouse islets (d) fter trnsfetion with mir53 mimi with nd without its trget protetor. All dt were normlised to Gpdh. n=3, p<.5 vs ontrols, p<.5, mir53 mimi vs TPmiR53 mimi to lesser extent in the rin from these mie (Fig. 5). These oservtions re onsistent with previous studies [5]. In ontrst, mir53 levels remin unhnged in pnreti islets nd rin from I KO mie, thus supporting the ide tht in mie mir53 is only expressed from I.Bsed on this informtion, we speulted tht Cn mrna would e elevted in islets nd rins from I KO nd DKO mie due to low expression of mir53, ut would not e elevted in I KO mie. As ntiipted, we found signifint inrese in Cn mrna (Fig. 5, d) nd protein (Fig. 5e, f) in oth the islets nd rin of I KO nd DKO mie, wheres no ovious hnge ws oserved in I KO mie (Fig. 5 f). These findings support the ontention tht the expression of Cn in vivo is regulted, t lest in prt, y mir53. Disussion Previously we showed tht the knokout of the DCV trnsmemrne genes, I nd I in mie, led to derese inthenumerofdcvsndresultedindereseinthe seretion of hormones nd neurotrnsmitters [3, 7, ]. This in turn results in vriety of pthophysiologil hnges inluding gluose intolerne, femle infertility, lerning nd ehviourl disorders nd dysregultion of irdin rhythm [3, 7, 9, ]. The present experiments dd support to previous studies tht showed tht the knokout of I, ut not I, results in derese in mir53, whihisemeddedinintron9ofthei gene [5]. The urrent experiments lso show tht mir53 mimis suppress hormone nd neurotrnsmitter (e.g. insulin nd dopmine) seretion, wheres mir53 inhiitors enhne hormone nd neuroendorine seretion. Sine mirna funtion is medited through its effet on speifi set of trget genes, we undertook ioinformtis serh to identify mir53 predited trget genes tht might ply role in seretion. Our serh identified lium hnnel relted genes. Five of these gene trgets were ommon in the two different predition softwre lgorithms tht we used. Vlidtion experiments in MIN6 ells onfirmed the effet of mir53 on the endogenous levels of two of these trget genes, Cn nd Csk. We foused on Cn euse of its wellknown involvement in seretion nd found tht mir53 mimi downregulted the expression of Cn mrna nd protein, wheres mir53 inhiitor upregulted the expression of Cn mrna nd protein in MIN6 ells, norml mouse islets nd dopminesereting PC ells. Thus, there is omplex reltionship etween IA nd mir53.
7 3 Dietologi (5) 58:98 36 mir53 reltive expression (fold) WT islets I KO islets I KO islets DKO islets mir53 reltive expression (fold)..5 WT rin I rin I rin DKO rin Cn mrna reltive expression (fold) WT islets I KO islets I KO islets DKO islets d Cn mrna reltive expression (fold) Fig. 5 mir53 nd Cn expression in I KO mie. Quntittive reltime PCR nlysis of mir53 levels (, )nd Cn mrna (, d) in rin nd islets from WT, I KO, I KO nd DKO mie, normlised to Gpdh. (e, f) CACNAC expression ws determined y WT rin I KO rin I KO rin DKO rin ecacnac protein reltive expression (fold) WT pnres I KO pnres I KO pnres DKO pnres CACNAC αtuulin f CACNAC protein reltive expression (fold) WT rin I KO rin I KO rin DKO rin CACNAC αtuulin western lot in pnres nd rin from WT, I KO, I KO nd DKO mie. The reltive expression vlues were determined y Imge J. n=5, p<.5 nd p<. vs ontrols Hormone exoytosis nd neurotrnsmitter relese re fundmentl ell iology proesses nd their regultion is essentil for mintining norml islet nd rin funtion. The relese of insulin nd dopmine is tightly regulted nd dependent on lium entering ells following ell memrne depolristion, with susequent tivtion of voltgegted lium hnnels [ 8]. Cn is wellstudied gene. The glol knokout of Cn in mie results in deth t irth [9], wheres et ellspeifi Cn knokout does not result in deth, ut does result in strong inhiition of GSIS [3]. Other studies hve shown tht CACNAC is physilly oupled to numer of vesilerelese mhinery proteins inluding the R3interting moleules (RIMs), Snp5 nd Syntxin [3]. Interestingly, Snp5 nd Syntxin lso re predited trgets of mir53 [5, 3]. To determine the in vivo importne of this mirorna on the seretion of insulin nd dopmine, speifi knokout or overexpression of mir53 in mie is required. The development of these knokout nd trnsgeni mie is underwy in our lortory, ut the lredy existing I knokout mie myprovidesomeluesstowhttoexpet.thei, ut not the I, knokout mie, showed signifint derese of mir53 nd signifint inrese of oth Cn mrna nd protein in the islets nd rin. Thus, it is not unresonle to expet n inrese of CACNAC in vivo following the speifi knokout of mir53. However, this predition must e viewed with ution sine mir53 trgets numer of genes unrelted to lium hnnel genes whih ould diretly or indiretly ffet seretion. Although in the urrent study we foused on the role of mir53 on insulin nd dopmine seretion, mir53 hs een shown to oth suppress nd enhne tumour growth nd ply role in ell prolifertion, migrtion nd invsion [3 37]. In ddition, mir53 is dysregulted in some ses of Prkinson s disese nd Alzheimer s disese where it ffets the expression of severl diseserelted trgets suh s αsynulein, myloid preursor protein nd myloid preursorlike protein [38 ]. In onlusion, stimultion of the I gene inreses oth IA protein nd mir53 expression (Fig. 6). The inrese in IA protein inreses the numer of DCV nd in turn neuroendorine seretion [3, 7,, ]. In ontrst, the inrese in mir53, whih is negtive regultor, dereses Cn expression nd in turn suppresses neuroendorine seretion. Thus, IA nd mir53 hve opposite funtionl effets on the seretory pthwy. IA DCV Hormone seretion Stimultors e.g. gluose I mir53 mir53 Fig. 6 Model illustrting the dul, ut opposite, effets on seretion resulting from the stimultion of oth the I gene nd the expression of its introni mirorna, mir53. The inrese in IA protein CACNAC Hormone seretion filittes seretion y inresing the numer of DCV, wheres n inrese in the expression of mir53, negtive regultor, dereses seretion y inhiiting the expression of lium hnnel gene, Cn
8 Dietologi (5) 58: Aknowledgements The uthors thnk T. Ci (NIDCR, NIH, Bethesd, MD, USA) for his dvie nd meningful disussions. Funding This work ws supported y the Intrmurl Reserh Progrm of the NIDCR, NIH, Bethesd, MD, USA. Reserh in LSS s l is funded y RODK69. Dulity of interest The uthors delre tht there is no dulity of interest ssoited with this mnusript. Author ontriutions HYX rried out the study design, quisition nd nlysis of the dt, nd drfting of the mnusript. LA, GNC nd S V performed dt quisition nd nlysis nd ontriuted to writing the mnusript. ALN nd LSS were responsile for the oneption nd design of the study, quisition nd nlysis of the dt, nd drfting of the mnusript. ALN is the gurntor of this work. All uthors were involved in the disussion nd revision of the mnusript, nd pproved the finl version to e pulished. Referenes. Notkins AL, Lernmrk A () Autoimmune type dietes: resolved nd unresolved issues. J Clin Invest 8:7 5. Solimen M, Dirkx R, Hermel JM et l (996) ICA 5, n utontigen of type I dietes, is n intrinsi memrne protein of neuroseretory grnules. EMBO J 5: 3. Nishimur T, Kuoski A, Ito Y, Notkins AL (9) Disturnes in the seretion of neurotrnsmitters in IA/IAet null mie: hnges in ehvior, lerning nd lifespn. Neurosiene 59: Gomi H, KuotMurt C, Ysui T, Tsukise A, Torii S (3) Immunohistohemil nlysis of IA fmily of protein tyrosine phosphtses in rt gstrointestinl endorine ells. J Histohem Cytohem 6: Tkeym N, Ano Y, Wu G et l (9) Loliztion of insulinom ssoited protein, IA in mouse neuroendorine tissues using two novel monolonl ntiodies. Life Si 8: Cromile LA, Ognesin A, Cots SA, Seifert RA, BowenPope DF () The neuroseretory vesile protein phogrin funtions s phosphtidylinositol phosphtse to regulte insulin seretion. J Biol Chem 85: Ci T, Hiri H, Zhng G et l () Deletion of I nd/or Iet in mie dereses insulin seretion y reduing the numer of dense ore vesiles. Dietologi 5: Kim SM, Theilig F, Qin Y et l (9) Denseore vesile proteins IA nd IA ffet renin synthesis nd seretion through the drenergi pthwy. Am J Physiol Ren Physiol 96:F38 F Kuoski A, Nkmur S, Notkins AL (5) Dense ore vesile proteins IA nd IAet: metoli ltertions in doule knokout mie. Dietes 5(Suppl ):S6 S5. Kuoski A, Gross S, Miur J et l () Trgeted disruption of the IAet gene uses gluose intolerne nd impirs insulin seretion ut does not prevent the development of dietes in NOD mie. Dietes 53: Seki K, Zhu M, Kuoski A, Xie J, Ln MS, Notkins AL () Trgeted disruption of the protein tyrosine phosphtselike moleule IA results in ltertions in gluose tolerne tests nd insulin seretion. Dietes 5:8 85. Kuoski A, Nkmur S, Clrk A, Morris JF, Notkins AL (6) Disruption of the trnsmemrne dense ore vesile proteins IA nd IAet uses femle infertility. Endorinology 7: Crmon GN, Nishimur T, Shindler CW, Pnlilio LV, Notkins AL () The dense ore vesile protein IA, ut not IAet, is required for tive voidne lerning. Neurosiene 69:35. Kim SM, Power A, Brown TM et l (9) Deletion of the seretory vesile proteins IA nd IAet disrupts irdin rhythms of rdiovsulr nd physil tivity. FASEB J 3: Mndemkers W, Auhtzir L, Xu H et l (3) Coregultion of intrgeni mirorna mir53 nd its host gene I et: identifition of mir53 trget genes with funtions relted to IAet in pnres nd rin. Dietologi 56: Kim VN, Hn J, Siomi MC (9) Biogenesis of smll RNAs in nimls. Nt Rev Mol Cell Biol : Bskerville S, Brtel DP (5) Mirorry profiling of mirornas revels frequent oexpression with neighoring mirnas nd host genes. RNA : 7 8. Go X, Qio Y, Hn D, Zhng Y, M N () Enemy or prtner: reltionship etween introni mirorns nd their host genes. IUBMB life 6: Niols FE () Experimentl vlidtion of mirorna trgets using luiferse reporter system. Methods Mol Biol 73:39 5. Nunemker CS, Zhng M, Wssermn DH et l (5) Individul mie n e distinguished y the period of their islet lium osilltions: is there n intrinsi islet period tht is imprinted in vivo? Dietes 5: Nishimur T, Hrshim S, Yfng H, Notkins AL () IA modultes dopmine seretion in PC ells. Mol Cell Endorinol 35:8 86. Nitert MD, Ngorny CL, Wendt A, Elisson L, Mulder H (8) CV. rther thn CV.3 is oupled to gluosestimulted insulin seretion in INS 83/3 ells. J Mol Endorinol : 3. Shull V, Renstrom E, Feil R et l (3) Impired insulin seretion nd gluose tolerne in et ellseletive C(v). C hnnel null mie. EMBO J : Mortensen OV (3) MKP3 elimintes depolriztiondependent neurotrnsmitter relese through downregultion of Ltype lium hnnel Cv. expression. Cell Clium 53: 3 5. Hofmnn F, Flokerzi V, Khl S, Wegener JW () Ltype CV. lium hnnels: from in vitro findings to in vivo funtion. Physiol Rev 9: Gisno HY () Here ome the newomer grnules, etter lte thn never. Trends Endorinol Met 5: Sudhof TC () Clium ontrol of neurotrnsmitter relese. Cold Spring Hr Perspet Biol : Rorsmn P, Brun M, Zhng Q () Regultion of lium in pnreti lph nd etells in helth nd disese. Cell Clium 5: Seisenerger C, Speht V, Welling A et l () Funtionl emryoni rdiomyoytes fter disruption of the Ltype lphc (Cv.) lium hnnel gene in the mouse. J Biol Chem 75: Gndini MA, Felix R () Funtionl intertions etween voltgegted C() hnnels nd R3interting moleules (RIMs): new insights into stimulusseretion oupling. Biohim Biophys At 88: Wei C, Thther EJ, Olen AF et l (3) mir53 regultes SNAP5, synpti trnsmission, nd neuronl development. PLoS One 8:e AnyRuiz M, Ced J, DelgdoLopez G, SnhezVzquez ML, PerezSntos JL (3) mir53 silening indues poptosis in the MDAMB3 rest ner ell line. Asin P J Cner Prev : Wu Z, He B, He J, Mo X (3) Upregultion of mir53 promotes ell prolifertion vi downregultion of the PTEN tumor suppressor gene in humn prostte ner. Prostte 73: Xu Q, Sun Q, Zhng J, Yu J, Chen W, Zhng Z (3) Downregultion of mir53 ontriutes to epithelil
9 36 Dietologi (5) 58:98 36 mesenhyml trnsition nd tumor metstsis in humn epithelil ner. Crinogenesis 3: Zhng L, Pikrd K, Jenei V et l (3) mir53 supports oloretl ner progression vi pleiotropi effets tht enhne invsion nd hemotherpeuti resistne. Cner Res 73: Yun Y, Du W, Wng Yet l (5) Suppression of AKTexpression y mir53 produed ntitumor tivity in lung ner. Int J Cner 36: Shn N, Shen L, Wng J, He D, Dun C (5) MiR53 inhiits migrtion nd invsion of humn nonsmllell lung ner y trgeting ADAM9. Biohem Biophys Res Commun 56: Ling C, Zhu H, Xu Y et l () MiroRNA53 negtively regultes the expression of myloid preursor protein nd myloid preursorlike protein. Brin Res 55: Doxkis E () Posttrnsriptionl regultion of lphsynulein expression y mir7 nd mir53. J Biol Chem 85: Long JM, Ry B, Lhiri DK () MiroRNA53 physiologilly inhiits expression of myloidet preursor protein in ultured humn fetl rin ells nd is dysregulted in suset of Alzheimer disese ptients. J Biol Chem 87: Kim HJ, Prk G, Jeon BS, Prk WY, Kim YE (3) A mir53 inding site vrition in SNCA in ptient with Prkinson's disese. Mov Disord 8: Hrshim S, Clrk A, Christie MR, Notkins AL (5) The dense ore trnsmemrne vesile protein IA is regultor of vesile numer nd insulin seretion. Pro Ntl Ad Si U S A :87 879
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationARTICLE. Keywords Lipotoxicity. MicroRNA. Pancreatic beta cells. Stearic acid
Dietologi (6) 59:7 57 DOI.7/s5639 ARTICLE Elevted irulting steri id leds to mjor lipotoxi effet on mouse pnreti et ells in hyperlipidemi vi mir35pmedited PERK/p53dependent pthwy Huimin Lu & Liuyi Ho &
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationMicroRNA 125b promotes tumor metastasis through targeting tumor protein 53 induced nuclear protein 1 in patients with non small cell lung cancer
Li et l. Cner Cell Int (15) 15:8 DOI 1.118/s1935-15-33-x PRIMARY RESEARCH MiroRNA 15 promotes tumor metstsis through trgeting tumor protein 53 indued nuler protein 1 in ptients with non smll ell lung ner
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationRole of HCP5-miR-139-RUNX1 Feedback Loop in Regulating Malignant Behavior of Glioma Cells
originl rtile The Amerin Soiety of Gene & Cell Therpy Role of HCP-miR-19-RUNX1 Feedk Loop in Regulting Mlignnt Behvior of Gliom Cells Ho Teng 1,2, Ping Wng, Yixue Xue, Xioi Liu 1,2, Jun M, Heng Ci 1,2,
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationInvolvement of thioredoxin-interacting protein (TXNIP) in glucocorticoid-mediated beta cell death
Dietologi (12) 55:148 157 DOI 1.7/s125-11-2422-z ARTICLE Involvement of thioredoxin-interting protein (TXNIP) in gluoortioid-medited et ell deth E. Reih & A. Tmry & R. Vogt Sionov & D. Melloul Reeived:
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationRapamycin toxicity in MIN6 cells and rat and human islets is mediated by the inhibition of mtor complex 2 (mtorc2)
Dietologi (212) 55:1355 1365 DOI 1.17/s125-12-2475-7 ARTICLE myin toxiity in MIN6 ells nd rt nd humn islets is medited y the inhiition of mtor omplex 2 (mtorc2) A. D. Brlow & J. Xie & C. E. Moore & S.
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationThe nucleotide exchange factor SIL1 is required for glucose-stimulated insulin secretion from mouse pancreatic beta cells in vivo
Dietologi (1) 7:11 119 DOI 1.17/s1-1-33-z ARTICLE The nuleotide exhnge ftor SIL1 is required for gluose-stimulted insulin seretion from mouse pnreti et ells in vivo Arne A. Ittner & Josefine Bertz & Tse
More informationARTICLE. Keywords ACE-2. Akita mice. Angiotensinogen. Diabetes. Heterogeneous nuclear ribonucleoprotein F. Hypertension. Renal fibrosis.
Dietologi (5) 58:44 454 DOI.7/s5-5-7-y ARTICLE Overexpression of heterogeneous nuler rionuleoprotein F stimultes renl Ae- gene expression nd prevents TGF-β-indued kidney injury in mouse model of dietes
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationHydrogen sulfide-induced inhibition of L-type Ca 2+ channels and insulin secretion in mouse pancreatic beta cells
Dietologi (213) 56:533 541 DOI 1.17/s125-12-286-8 ARTICLE Hydrogen sulfide-indued inhiition of L-type C 2 hnnels nd insulin seretion in mouse pnreti et ells G. Tng & L. Zhng & G. Yng & L. Wu & R. Wng Reeived:
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationAMP-activated protein kinase regulates glucagon secretion from mouse pancreatic alpha cells
Dietologi (2) 54:25 34 DOI.7/s25--929-z ARTICLE AMP-tivted protein kinse regultes glugon seretion from mouse pnreti lph ells I. Leler & G. Sun & C. Morris & E. Fernndez-Milln & M. Nyirend & G. A. Rutter
More informationEndogenous GIP ameliorates impairment of insulin secretion in proglucagon-deficient mice under moderate beta cell damage induced by streptozotocin
Dietologi (216) 59:1533 1541 DOI 1.17/s125-16-3935-2 ARTICLE Endogenous GIP meliortes impirment of insulin seretion in proglugon-defiient mie under moderte et ell dmge indued y streptozotoin Atsushi Iid
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationFates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos
ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationSETD1A modulates cell cycle progression through a mirna network that regulates p53 target genes
SETDA modultes ell yle progression through mirna network tht regultes p5 trget genes The Hrvrd ommunity hs mde this rtile openly vilble. Plese shre how this ess benefits you. Your story mtters Cittion
More informationGLP-1 oestrogen attenuates hyperphagia and protects from beta cell failure in diabetes-prone New Zealand obese (NZO) mice
Dietologi () 8:64 614 DOI.7/s1-14-3478-3 ARTICLE GLP-1 oestrogen ttenutes hyperphgi nd protets from et ell filure in dietes-prone New Zelnd oese (NZO) mie Roert W. Shwenk & Christin Bumeier & Brin Finn
More informationARTICLE. I. Chopra & H. F. Li & H. Wang & K. A. Webster
Dietologi (212) 55:783 794 DOI 1.17/s125-11-247-y ARTICLE Phosphoryltion of the insulin reeptor y AMP-tivted protein kinse (AMPK) promotes lignd-independent tivtion of the insulin signlling pthwy in rodent
More informationANGPTL binding ANGPTL binding ANGPTL4 GST ANGPTL5 ANGPTL6 ANGPTL7. A5+LILRB2 Fc. A5+Tie-2 Fc 10,000 7,500. Tie-2 Fc LILRB2 Fc. 5,000 K d = 5.
doi:1.138/nture1195 ; Inhiitory reeptors ind ANGPTLs nd support < lood stem ells nd leukemi development Junke Zheng 1,2, Msto Umikw 1,3, Chngho Cui 1, Jiyun Li 1, Xioli Chen 1, Chozheng Zhng 1, HongDinh
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationThe soy isoflavone genistein promotes apoptosis in mammary epithelial cells by inducing the tumor suppressor PTEN
Crinogenesis vol. no.1 pp.1793 183, 5 doi:1.193/rin/gi131 dvne ess pulition My 19, 5 The soy isoflvone genistein promotes poptosis in mmmry epithelil ells y induing the tumor suppressor huvnesh Dve 1,,
More informationThioredoxin-interacting protein links oxidative stress to inflammasome activation
A rt i l e s Thioredoxin-interting protein links oxidtive stress to inflmmsome tivtion Rongin Zhou 1, Aury Trdivel 1, Bernrd Thorens 2, Inpyo Choi 3 & Jürg Tshopp 1 29 Nture Ameri, In. All rights reserved.
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationCAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY
CAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY 1 1 2 R. K. Frnk, M. W. Vorhies, nd M. M. Chengpp Summry Cuses of dirrhe, pneumoni, nd
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationMiR-29a Assists in Preventing the Activation of Human Stellate Cells and Promotes Recovery From Liver Fibrosis in Mice
originl rtile The Amerin Soiety of Gene & Cell Therpy MiR-9 Assists in Preventing the Ativtion of Humn Stellte Cells nd Promotes Reovery From Liver Firosis in Mie Yoshinri Mtsumoto,,3, Sori Itmi, Mshiko
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationTranscription factor Ets-1 links glucotoxicity to pancreatic beta cell dysfunction through inhibiting PDX-1 expression in rodent models
Dietologi () 9: DOI.7/s ARTICLE Trnsription ftor Ets links gluotoxiity to pnreti et ell ysfuntion through inhiiting PDX expression in roent moels Fng Chen & Min Sh & Ynyng Wng & Tijun Wu & Wei Shn & Ji
More informationLight at night acutely impairs glucose tolerance in a time-, intensity- and wavelength-dependent manner in rats
Dietologi (21) :1 1 DOI 1.1/s12-1-22-y ARTILE Light t night utely impirs gluose tolerne in time-, intensity- nd wvelength-dependent mnner in rts Anne-Loes Opperhuizen 1,2 & Dirk J. Stenvers 2, & Remi D.
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationInhibition of mtor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease
Inhiition of mtor indues utophgy nd redues toxiity of polyglutmine expnsions in fly nd mouse models of Huntington disese Brind Rvikumr 1,6, Corlie Vher 1,6, Zdenek Berger 1,2, Jnet E Dvies 1, Shouqing
More informationA maternal junk food diet in pregnancy and lactation promotes an exacerbated taste for junk food and a greater propensity for obesity in rat offspring
British Journl of Nutrition (27), pge 1 of 9 q The uthors 27 doi: 1.117/S7114781237 mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity for oesity in rt
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationFAK integrates growth-factor and integrin signals to promote cell migration
integrtes growth-ftor nd integrin signls to promote ell migrtion rtiles Dvid J. Sieg*, Christof R. Huk*, Dusko Ili, Cndie K. Klingeil*, Erik Shefer, Croline H. Dmsky nd Dvid D. Shlepfer* *Deprtment of
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationNucleosome positioning as a determinant of exon recognition
Nuleosome positioning s determinnt of exon reognition Hgen Tilgner 1,3, Christoforos Nikolou 1,3, Sonj Althmmer 1, Mihel Smmeth 1, Miguel Beto 1, Jun Vlárel 1,2 & Roderi Guigó 1 200 Nture Ameri, In. All
More informationRedundant roles of the phosphatidate phosphatase family in triacylglycerol synthesis in human adipocytes
Dietologi (216) 59:1985 1994 DOI 1.17/s125-16-418- ARTICLE Redundnt roles of the phosphtidte phosphtse fmily in triylglyerol synthesis in humn dipoytes An Temprno 1,2 & Hiroshi Semongi 3,4 & Gil-Soo Hn
More informationSUPPLEMENTARY INFORMATION
~ 5 % ltion > 99 % ltion 25 2 15 5 Gly yemi (mmol/l) 3 7 15 3 Time fter -ell ltion (dys) Survivl (%) & ~ 5 % ltion 75 > 99% ltion 5 25 25 5 (dys) 7.4 d 1.25 lood ph 73 7.3 7.2 7.1 7. 7d ody weight h nge
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationPlant Physiology Preview. Published on February 21, 2017, as DOI: /pp
Plnt Physiology Preview. Pulished on Ferury 21, 217, s DOI:1.114/pp.16.1928 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 Running title: Spliing regultor STA1 in het stress dpttion Corresponding Author:
More informationThe histone H3K9 methyltransferase SUV39H links SIRT1 repression to myocardial infarction
Reeived 8 Jun 6 Aepted Fe 7 Pulished Mr 7 DOI:.8/nomms9 OPEN The histone HK9 methyltrnsferse SUV9H links SIRT repression to myordil infrtion Gung Yng,, Xinyu Weng,,,, Yuho Zho, Xinjin Zhng, Yunping Hu,
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationregulates stem cells through Wnt/β-catenin signalling
LETTERS O regultes stem ells through Wnt/β-tenin signlling Jolly Mzumdr,,7, W. Timothy O Brien, Rndll S. Johnson, Joseph C. LMnn, Jun C. Chvez 5, Peter S. Klein nd M. Celeste Simon,, Stem ells reside in
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationN6-methyladenosine (m6a) is the most prevalent messenger
https://oi.org/8/s556-8-7- m 6 A mrna methyltion regultes tivity to promote the prolifertion n tumorigeniity of enometril ner Jun Liu,,, Mrk A. Ekert,, Bryn T. Hr,,, Song-Mei Liu,, Zhike Lu,, Kngkng Yu,,5,
More informationMinimum effective dose of chenic acid for gallstone patients: reduction with bedtime administration and
Gut, 1982, 23, 28-284 Minimum effetive dose of heni id for gllstone ptients: redution with bedtime dministrtion nd low holesterol diet D P MUDGL, R M KUPFER, ND T C NORTHFIELD* From the Normn Tnner Gstroenterology
More informationIntestine specific MTP deficiency with global ACAT2 gene ablation lowers acute cholesterol absorption with chylomicrons and high density lipoproteins
Intestine speifi MTP defiieny with glol ACAT2 gene ltion lowers ute holesterol sorption with hylomirons nd high density lipoproteins 1,2 Jhngir Iql, 1,2 Mohmed Boutjdir, 3 Lwrene L. Rudel, 1,2 M. Mhmood
More informationLipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)
Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell
More informationMechanisms underlying cross-orientation suppression in cat visual cortex
Mehnisms underlying ross-orienttion suppression in t visul ortex 6 Nture Pulishing Group http://www.nture.om/ntureneurosiene Nihols J Priee & Dvid Ferster In simple ells of the t primry visul ortex, null-oriented
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationAlternative rapamycin treatment regimens mitigate the impact of rapamycin on glucose homeostasis and the immune system.
Aging Cell (216) 15, pp28 38 Doi: 1.1111/el.1245 Alterntive rpmyin tretment regimens mitigte the impt of rpmyin on gluose homeostsis nd the immune system Aging Cell Sestin I. Arriol Apelo, 1,2 Joshu C.
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationThe Journal of Physiology
J Physiol 595.23 (217) pp 7185 722 7185 Heteromeri α/β glyine reeptors regulte exitility in prvlumin-expressing dorsl horn neurons through phsi nd toni glyinergi inhiition M. A. Grdwell 1,2,K.A.Boyle 3,R.J.llister
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationAdipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
Reeived 11 Jul 1 Aepted Fe Pulished 11 Mr DOI: 1.138/nomms795 OPEN Adipose tissue NAPE-PLD ontrols ft mss development y ltering the rowning proess nd gut miroiot Luie Geurts 1, Amndine Everrd 1,, Mtthis
More informationA. B. C. Succiniclasticum. Paraprevotella. Control DPA EPA DHA Control DPA EPA DHA a b. a a. b c.
389 Session 2: Miroil eosystem nd herivore nutrition Effet of dietry ddition of EPA, DPA nd DHA on rumen teril ommunity in ows nd ewes. An in vitro pproh Dvid Crreño 1, Álvro Belenguer 1, Eri Pinlohe 2,
More informationRole of the EGF receptor in PPARγ-mediated sodium and water transport in human proximal tubule cells
Dietologi (213) 56:1174 1182 DOI 1.17/s125-13-2835-y ARTICLE Role of the EGF reeptor in PPARγ-meite soium n wter trnsport in humn proximl tuule ells S. S & J. Zhng & R. Yong & D. Yghoin & M. G. Wong &
More informationImaging analysis of clock neurons reveals light buffers the wake-promoting effect of dopamine
Imging nlysis of lok neurons revels light uffers the wke-promoting effet of dopmine Yuhu Shng 1,2, Pul Hynes 2, Niolás Pírez 2, Kyle I Hrrington 3, Fng Guo 1,2, Jordn Pollk 3, Pengyu Hong 3, Leslie C Griffith
More informationF-FDG PET/CT for Monitoring the Response of Breast Cancer to mir-143-based Therapeutics by Targeting Tumor Glycolysis
Cittion: Moleulr Therpy Nulei Aids () 5, e57; doi:.8/mtn..7 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn F-FDG PET/CT for Monitoring the Response of Brest Cner to -Bsed Therpeutis
More informationUnidirectional transfer of microrna-loaded exosomes from T cells to antigen-presenting cells
Reeived 9 Aug Aepted Mr Pulished 9 Apr DOI:.8/nomms8 Unidiretionl trnsfer of mirorna-loded exosomes from T ells to ntigen-presenting ells Mrí Mittelrunn,, Cristin Gutiérrez-Vázquez,, Crolin Villrroy-Beltri,
More informationDifferential expression of cyclin G2, cyclin dependent kinase inhibitor 2C and peripheral myelin protein 22 genes during adipogenesis..
The Ohio Stte University From the SeletedWorks of Jiin Zhng Summer My 5, 214 Differentil expression of ylin G2, ylin dependent kinse inhiitor 2C nd peripherl myelin protein 22 genes during dipogenesis..pdf
More informationBTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1
BTLA is lymphoyte inhiitory reeptor with similrities to CTLA-4 nd PD-1 Norihiko Wtne 1,5, My Gvrieli 1, John R Sedy 1, Jinfei Yng 1,5, Frnes Fllrino 2, Susn K Loftin 1, Mihelle A Hurhl 1, Ntlie Zimmermn
More informationRNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationA p75 NTR and Nogo receptor complex mediates repulsive signaling by myelin-associated glycoprotein
A p75 NTR nd Nogo reeptor omplex medites repulsive signling y myelin-ssoited glyoprotein Sott T. Wong 1, John R. Henley 1, Kevin C. Knning 2, Kuo-hu Hung 1, Mrk Bothwell 2 nd Mu-ming Poo 1 1 Division of
More informationRESEARCH ARTICLE Activity of intestinal carbohydrases responds to multiple dietary signals in nestling house sparrows
398 The Journl of Experimentl Biology 6, 398-3987 3. Pulished y The Compny of Biologists Ltd doi:.4/je.864 RESEARCH ARTICLE Ativity of intestinl rohydrses responds to multiple dietry signls in nestling
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More information